ID: 1105214011

View in Genome Browser
Species Human (GRCh38)
Location 13:18273960-18273982
Sequence AAGAGACAGACTTGTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 2, 1: 1, 2: 0, 3: 14, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105214002_1105214011 21 Left 1105214002 13:18273916-18273938 CCTCTTCCTCAGAAGACAGTTCT 0: 3
1: 0
2: 1
3: 27
4: 323
Right 1105214011 13:18273960-18273982 AAGAGACAGACTTGTCTGCCTGG 0: 2
1: 1
2: 0
3: 14
4: 209
1105214005_1105214011 15 Left 1105214005 13:18273922-18273944 CCTCAGAAGACAGTTCTGGGCTG 0: 3
1: 0
2: 2
3: 18
4: 236
Right 1105214011 13:18273960-18273982 AAGAGACAGACTTGTCTGCCTGG 0: 2
1: 1
2: 0
3: 14
4: 209
1105214010_1105214011 -10 Left 1105214010 13:18273947-18273969 CCTGCTGGGGAGGAAGAGACAGA 0: 2
1: 1
2: 5
3: 53
4: 681
Right 1105214011 13:18273960-18273982 AAGAGACAGACTTGTCTGCCTGG 0: 2
1: 1
2: 0
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105214011 Original CRISPR AAGAGACAGACTTGTCTGCC TGG Intergenic
901720237 1:11191539-11191561 AAGAGACAGCCTTTTCTGATAGG - Intronic
902265389 1:15259833-15259855 AAGAGAAAGCCTGGTTTGCCAGG + Intronic
904349419 1:29895345-29895367 AATGGACAGGCTTGGCTGCCAGG + Intergenic
906262852 1:44406752-44406774 AAGAGAAAGCCTTTTCTTCCAGG + Intronic
907870710 1:58440182-58440204 ATGAGACAGACTTTCATGCCGGG + Intronic
908692437 1:66797446-66797468 AAGACACAGACCTGTCTCCTGGG + Intergenic
909882051 1:80892000-80892022 AAGATACAGTTTTCTCTGCCAGG - Intergenic
911130340 1:94381391-94381413 AAGGCACAGACCTGTCTCCCAGG + Intergenic
911746061 1:101443008-101443030 AAGGCACAGACTTGTCTACTGGG - Intergenic
916318284 1:163474546-163474568 AAGAGACAGACTTCTGTGTTAGG - Intergenic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917511823 1:175675145-175675167 AAGAGAGGTCCTTGTCTGCCTGG - Intronic
919501630 1:198344776-198344798 AACAACCAGACTTGTTTGCCAGG - Intergenic
920820696 1:209378027-209378049 AAAAGAGAGCCTTGTCTACCTGG + Intergenic
921258388 1:213363151-213363173 AGGAAACAGACTTGTGTCCCTGG - Intergenic
923206896 1:231767955-231767977 AAGAGACAGAGTTGTAAGTCCGG + Intronic
924106429 1:240654074-240654096 AAGAGAGATAATTGTCTGACTGG + Intergenic
924784248 1:247180689-247180711 AAGACACAGGCTGGTCTGCATGG - Intergenic
1065774222 10:29104414-29104436 TGAAGACAGTCTTGTCTGCCAGG + Intergenic
1067510257 10:46888824-46888846 AAGAGAAAGGTTTGTGTGCCAGG - Intergenic
1067651998 10:48163040-48163062 AAGAGAAAGGTTTGTGTGCCAGG + Intronic
1068292395 10:55021070-55021092 AAGGCATAGACTTGTCTCCCAGG + Intronic
1069071862 10:63997900-63997922 AAGAGACAGAGATGACTGGCAGG + Intergenic
1070568238 10:77620103-77620125 AACAGACAGGCTTGTGGGCCTGG - Intronic
1071310364 10:84337754-84337776 GAAAGACAGACTTGTCTCCCTGG - Intronic
1071509593 10:86253174-86253196 AAAAGACAGAGCTGTCAGCCTGG - Intronic
1071687524 10:87775783-87775805 ACGAGACAGACTTGTATCCTAGG - Intronic
1073800013 10:107031501-107031523 AAAAGACTGACTTTTCTGCAAGG + Intronic
1074259747 10:111840048-111840070 AAGAGACAGAATTCTCAGTCTGG + Intergenic
1074496744 10:113986124-113986146 CAGAGCCGGCCTTGTCTGCCAGG - Intergenic
1079897008 11:26132757-26132779 GAGAAACAGACTTCTCTTCCTGG - Intergenic
1081280921 11:41208759-41208781 AGAAAACAGACTTGTCTGCTTGG - Intronic
1081510388 11:43766245-43766267 AGTAGACAGACTTGACTGCTGGG + Intronic
1081625762 11:44654212-44654234 AAGAGACAGACTTGGTTGGGGGG + Intergenic
1081800601 11:45856499-45856521 AAAAGTCAGCCTTTTCTGCCGGG + Intronic
1081962795 11:47150708-47150730 GAGGGACAGACTTGTCTGGAGGG + Intronic
1083288349 11:61675463-61675485 CAGAGACAGACTTATTTACCTGG + Intergenic
1083541391 11:63513975-63513997 AAGACACAGTGTTGTCTGGCAGG + Intronic
1083871840 11:65493168-65493190 AAGTGACAGGCCTGTCTGCTGGG + Intergenic
1084079349 11:66810471-66810493 AAGGCACAGACCTGTCTCCCAGG - Intronic
1085675947 11:78518429-78518451 CTGAGACAGACTTGTCTTCAAGG + Intronic
1085766648 11:79288996-79289018 AAGAGAAAATCTTGTCTCCCAGG + Intronic
1087313330 11:96576894-96576916 CAGGGAGAGACTTCTCTGCCTGG - Intergenic
1089487140 11:118855229-118855251 TAGAGACAGGCTTGGCTGCATGG - Intergenic
1090294956 11:125579368-125579390 AAGAGACAGACGGGTCGGCTGGG + Intronic
1092202832 12:6597248-6597270 TTGAGACAGACTTGTCACCCAGG - Intronic
1093058450 12:14578489-14578511 TAGAGACAGAGTTGTTGGCCAGG - Intergenic
1094018565 12:25889877-25889899 AAGGCACAGACCTGTCTCCCAGG - Intergenic
1097205637 12:57318324-57318346 AAGAGCTGGACTTCTCTGCCTGG - Intronic
1098691087 12:73488836-73488858 TAGAGAGACACTTGTATGCCAGG - Intergenic
1099088638 12:78278381-78278403 AACAGACAGACTTTGCTGCAGGG + Intergenic
1101901630 12:108795109-108795131 AAGGCACAGACGTGTCTCCCAGG + Intronic
1101993446 12:109506644-109506666 AAGAAACAGATTTGGCAGCCCGG - Intronic
1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG + Intronic
1103619847 12:122180590-122180612 AAGAGACAGTGTTGGCTGCAGGG + Intronic
1103853093 12:123946226-123946248 GAGAATCAGACTGGTCTGCCCGG + Intronic
1104041205 12:125132390-125132412 AACATACAGTCTTGTTTGCCTGG - Intronic
1105214011 13:18273960-18273982 AAGAGACAGACTTGTCTGCCTGG + Intergenic
1109208693 13:59509898-59509920 AAGATATAGAGTTGTCGGCCGGG + Intergenic
1110343788 13:74422952-74422974 AAGAATCAGATTTGTCAGCCTGG - Intergenic
1110924863 13:81138392-81138414 AAGAGAGAGAATTCTCTGGCTGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114649600 14:24275872-24275894 AAGACAGAGACTTGTCTTTCTGG - Intergenic
1116050175 14:39792952-39792974 CAGAGAAAGAATTGTCTGCCTGG + Intergenic
1117861295 14:60095095-60095117 AAGACATAGACTTGCCTCCCGGG - Intronic
1118474625 14:66105180-66105202 AAGAGGGAGACTTCCCTGCCAGG + Intergenic
1122252701 14:100451194-100451216 AAAAGACAGACATGCTTGCCAGG + Intronic
1122654299 14:103247089-103247111 AATAGACCGAATTGTCTGACAGG + Intergenic
1124464899 15:29928646-29928668 AAAACACACACTTGTCGGCCGGG + Intronic
1127716430 15:61653384-61653406 AGGAGGTGGACTTGTCTGCCGGG - Intergenic
1129240602 15:74249860-74249882 AAGAGACTGAGTTGTCTGGAGGG - Intronic
1129926091 15:79365466-79365488 AAGGCACAGACTTGTCTCCTGGG - Intronic
1131624327 15:94101596-94101618 AAGAAACTTACTTGTCGGCCGGG + Intergenic
1133481176 16:6172192-6172214 AAGTGACACACTTGGCTGCAAGG - Intronic
1134293925 16:12927827-12927849 ATGAGATAGACTTTTCTGGCTGG - Intronic
1136711432 16:32240327-32240349 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1136756478 16:32689078-32689100 AAGAGACAGAGGTGGCTGACTGG + Intergenic
1136811633 16:33181295-33181317 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1136818109 16:33291375-33291397 AAGAGACAGAGGTGGCTGACTGG - Intronic
1136824673 16:33347904-33347926 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1136829739 16:33446675-33446697 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1139919897 16:70453085-70453107 AAGGTACAGACCTGTCTCCCAGG - Intergenic
1141518402 16:84561659-84561681 AAGAGACTGGCTAGTCTGCCGGG - Intergenic
1202990211 16_KI270728v1_random:4264-4286 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1203058622 16_KI270728v1_random:949432-949454 AAGAGACAGAGGTGGCTGACTGG + Intergenic
1143077998 17:4361641-4361663 AAAAGACACATTTGTCAGCCAGG + Intronic
1143860953 17:9890302-9890324 AAGAGACAGTCTGCTCTCCCAGG + Exonic
1147553200 17:41459797-41459819 CAGAGACAGACATGTTTGCAAGG + Exonic
1151626181 17:75277315-75277337 AAGGGTCAGAGCTGTCTGCCTGG + Intronic
1152959369 18:69484-69506 AAGAGAGAGAATTCTCTGTCTGG - Intronic
1152984172 18:307001-307023 AAGACATAGACCTGTCTCCCAGG + Intergenic
1154000107 18:10475546-10475568 AAGTGACAGAGTTGTCTATCTGG + Intronic
1154329152 18:13415522-13415544 TATAGGCAGACTTGTCTCCCCGG + Intronic
1155664481 18:28292077-28292099 CAGGGAAAGACTTATCTGCCAGG - Intergenic
1156802492 18:41134104-41134126 AAGAGACAGACATTTCTGAGGGG + Intergenic
1157499885 18:48182322-48182344 AAGAGAAAAACATATCTGCCAGG + Intronic
1159814446 18:73055195-73055217 AAGAGACAGAGTTTTCGGCCGGG - Intergenic
1162367311 19:10257271-10257293 AAGAGAGAGTCATCTCTGCCTGG - Intronic
925611950 2:5708713-5708735 AAGAGAAACAATTGTCTTCCAGG + Intergenic
926306272 2:11639453-11639475 AGGAGAAAGACTCGTCTACCAGG - Intronic
927492702 2:23531133-23531155 AGGAGACAGGCTTCTCAGCCAGG - Intronic
928029125 2:27764028-27764050 AAGAGATAAAGATGTCTGCCTGG + Intergenic
930635689 2:53803164-53803186 AAGAAACATACTTGGCTGCAAGG + Intronic
933047105 2:77553098-77553120 CAGAGCCAGGCTTGTCTCCCTGG - Intronic
933468937 2:82695138-82695160 ATGGGAGAGACTTATCTGCCAGG + Intergenic
933725111 2:85422435-85422457 AGGACACAGAATGGTCTGCCTGG + Intronic
934300312 2:91772789-91772811 AAGAAACAGACTTGTCTGCCTGG - Intergenic
934570798 2:95372168-95372190 AAGAGGCAGACTTTTCAGACTGG - Intronic
935177956 2:100665623-100665645 AAGAGTCACACTTGTGTGCCAGG - Intergenic
937097188 2:119242989-119243011 AGGAGACAGTATTTTCTGCCTGG - Intronic
939467776 2:142580702-142580724 AAGAGCCTGATTTGTCAGCCGGG - Intergenic
940076934 2:149751962-149751984 AAAAGACAGACATGTAGGCCAGG - Intergenic
941528205 2:166632012-166632034 TGGAGACAGACTCCTCTGCCTGG - Intergenic
943841275 2:192584309-192584331 AAAAGACAGACTTTTGTGCATGG + Intergenic
944721602 2:202428350-202428372 GAGAGACAGACTCGACTGCGGGG - Intronic
944995252 2:205286671-205286693 AGGAGAGAGACCTGTCTCCCAGG - Intronic
945462695 2:210128560-210128582 AAGAGACAGACATAGTTGCCAGG + Intronic
946627705 2:221632170-221632192 AATTGATAGACTTGTCGGCCAGG + Intergenic
946765917 2:223040543-223040565 ACGACACAGACCTGTCTCCCAGG + Intergenic
947581359 2:231321204-231321226 TAGAGACAGACTGGCCTGACTGG + Intronic
1168854247 20:997691-997713 AGGAGACAGTGCTGTCTGCCTGG + Intronic
1172002137 20:31787548-31787570 AAGGTACAGACCTGTCTCCCAGG - Intronic
1172715700 20:36961863-36961885 AAGAGAGAGAGTTCTCTGACTGG + Intergenic
1173109728 20:40175431-40175453 AACACACAGAGCTGTCTGCCTGG + Intergenic
1175226381 20:57446576-57446598 AAGACATAGACCTGTCTCCCAGG - Intergenic
1175979039 20:62727876-62727898 AAGGGACAGACCTGTGTTCCCGG + Intronic
1178077644 21:29026473-29026495 AAGAGACAGACTTGATTGGCAGG + Intronic
1179177646 21:39020851-39020873 AGGAAACAGACGTGTGTGCCGGG + Intergenic
1179278543 21:39913868-39913890 AAGAGAAACACCTGTCTGCAGGG + Intronic
1180147865 21:45931269-45931291 AACAGACACAGTTGTTTGCCTGG + Intronic
1180719811 22:17899371-17899393 AAGAGAAAGAATTGTCTGATGGG - Intronic
1181698666 22:24607922-24607944 AAGAGACAGACTTGTCTGCCTGG - Intronic
1182394998 22:30028869-30028891 AATACACAGACTGGGCTGCCTGG - Intronic
1184819429 22:46898381-46898403 AAGACATAGACCTGTCTCCCAGG - Intronic
949181534 3:1137047-1137069 AAGAGACAGAATGGGGTGCCAGG - Intronic
950500217 3:13358954-13358976 AAGAGGGAAACCTGTCTGCCTGG + Intronic
951787915 3:26443250-26443272 AAGAGACAAACTTGACTCCAAGG - Intergenic
955339375 3:58113250-58113272 AAAATCCAGACTTTTCTGCCAGG - Intronic
955884060 3:63578780-63578802 AAGAGCCTGACTTGCCTGCATGG + Intronic
956138199 3:66119549-66119571 AAGGTACAGACTTGTCTACCAGG + Intergenic
957125503 3:76154804-76154826 AAAATACATATTTGTCTGCCTGG - Intronic
958906171 3:99944412-99944434 GAGAGACAGACGTGACAGCCTGG - Intronic
961393920 3:126572851-126572873 AAGGCACAGACCTGTCTCCCGGG - Intronic
963914328 3:150843654-150843676 AAGGCACAGACCTGTCTCCCAGG + Intergenic
964358062 3:155868639-155868661 AAAATACAGACTTGTTGGCCAGG - Intergenic
965510462 3:169563184-169563206 AGGATTCTGACTTGTCTGCCAGG - Intronic
968375304 4:35330-35352 AGGAGACAAACATGTGTGCCGGG - Intergenic
969592095 4:8127793-8127815 CAGAGACACACCTGTCTCCCAGG + Intronic
974626402 4:64432524-64432546 AAGACAAAGACTTGTCTCTCAGG - Intergenic
976064254 4:81165607-81165629 CAGAGACACATTTGTTTGCCAGG + Intronic
978203507 4:106051025-106051047 AAGAGACTGGCATGTTTGCCCGG + Intronic
978556241 4:109983667-109983689 AAGAGACAGACTTGAGTCCAAGG - Intronic
980633335 4:135467398-135467420 AAGAGAGATATTTGTATGCCAGG - Intergenic
981132622 4:141174816-141174838 TAAAAACAGACTTTTCTGCCTGG + Intronic
982415208 4:155123002-155123024 AAGGTACAGACCTGTCTCCCAGG - Intergenic
983175050 4:164578441-164578463 AATAGGCAGACTTTACTGCCAGG - Intergenic
985067011 4:186132533-186132555 AAGGCACAGACCTGTCTCCCTGG - Intronic
985459740 4:190093717-190093739 AGGAGACAAACATGTGTGCCGGG + Intergenic
986097735 5:4576518-4576540 AACAGACAGACTTGTCTTGGGGG - Intergenic
991504273 5:67307886-67307908 TATAGACAGACTTATCTGGCAGG + Intergenic
993467847 5:88269511-88269533 AAGAGGCAGAATTTTCTTCCTGG - Intergenic
994098081 5:95865299-95865321 GTGAGCCACACTTGTCTGCCTGG - Intergenic
994102681 5:95911155-95911177 AAGATACAGACTGAGCTGCCTGG + Intronic
995963812 5:117879340-117879362 AAATGACAGACTAGTCTGACTGG - Intergenic
996108126 5:119530825-119530847 TTGAGACAGACTTGTCGCCCAGG - Intronic
996309248 5:122084415-122084437 AGAAGACAGGCTTGTTTGCCAGG + Intergenic
998123600 5:139599987-139600009 TAGAGACAGGCTTGTTGGCCAGG + Intronic
1001666880 5:173440623-173440645 AAGAGACAAACTCCCCTGCCAGG - Intergenic
1002618208 5:180468450-180468472 AAGAGACCAACCTGGCTGCCCGG - Intergenic
1003538606 6:6998372-6998394 AAGAGACAGAATATCCTGCCAGG + Intergenic
1003790250 6:9538403-9538425 AAGTGACACACTTGGCTTCCTGG + Intergenic
1003974955 6:11333631-11333653 TAGAGACAGCCTTCCCTGCCAGG - Intronic
1005627501 6:27677164-27677186 TAGAGAAATACTAGTCTGCCGGG - Intergenic
1006213621 6:32419256-32419278 AAGCCACAGACTTGTCTTCTGGG - Intergenic
1008897424 6:56572930-56572952 AAATGAAAGACTTGTCTGCTCGG - Exonic
1009726708 6:67544100-67544122 AAGAGGCAGACTTGCCTGTGGGG - Intergenic
1013460331 6:110368964-110368986 AGAAGACAGACTTCTCTGACTGG + Intergenic
1014961788 6:127695360-127695382 AAGAGACAGCCCTGTCACCCAGG + Intergenic
1016244019 6:141961971-141961993 AAGACACAAATTTGGCTGCCTGG + Intergenic
1016441372 6:144087626-144087648 AAGAGACAAACTTTTCTGCAAGG + Intergenic
1017367773 6:153665508-153665530 AAGGGATAGACTTGTCTTCTGGG - Intergenic
1017557737 6:155590309-155590331 AAGAAATAGTATTGTCTGCCTGG - Intergenic
1020052311 7:5089952-5089974 AAGACATAGACCTGTCTCCCAGG - Intergenic
1020568514 7:9826774-9826796 AATATACAGTCATGTCTGCCAGG + Intergenic
1021330660 7:19335117-19335139 AACAGAAAGACTTGTTTGGCTGG - Intergenic
1021768034 7:23968794-23968816 AAGGCACAGACCTGTCTCCCAGG + Intergenic
1022608854 7:31847932-31847954 AAGAGAGAGATTTGTAGGCCAGG - Intronic
1022656267 7:32322301-32322323 AAAAGACAGACATGTTAGCCAGG + Intergenic
1022979804 7:35593831-35593853 AAGAAACAGGCTTGTCGGACTGG + Intergenic
1025089309 7:56049452-56049474 AACAGCGAGACTTGTCTCCCAGG - Intronic
1025197432 7:56943940-56943962 AAGACACAGCCTCCTCTGCCTGG + Intergenic
1025674515 7:63632999-63633021 AAGACACAGCCTCCTCTGCCTGG - Intergenic
1025729579 7:64098111-64098133 AAGATACAGACCTGCCTCCCAGG - Intronic
1025789614 7:64677070-64677092 AAGACATAGACTTGTCTCCAGGG + Intronic
1027903324 7:84147575-84147597 GAGAGACAGGCTTGTGTGGCTGG + Intronic
1028530948 7:91838005-91838027 AAGACACAGTCTTCTCTTCCTGG - Intronic
1028908574 7:96182397-96182419 AAGAGACAGAGCTGTCTGTCAGG - Intronic
1030183234 7:106732355-106732377 AAGAGACACACCCTTCTGCCTGG - Intergenic
1033044111 7:137945562-137945584 AAAAGACAGACTTTTCTGCAGGG + Intronic
1033053975 7:138032574-138032596 AAGAAACAGGCCTGTCTCCCAGG + Intronic
1033069615 7:138190248-138190270 AAGACATAGACCTGTCTCCCGGG - Intergenic
1033602314 7:142897068-142897090 AAGAGACAGAGATTTCTGCCTGG + Intergenic
1033643157 7:143281873-143281895 AAGGCATAGACTTGTCTCCCGGG + Intronic
1035336513 7:158132909-158132931 AAGAGAAGGACGTGTCTGCCTGG - Intronic
1042413847 8:68496720-68496742 AAAACTCAGATTTGTCTGCCTGG - Intronic
1044723737 8:95175351-95175373 AAAAGACAGACTCACCTGCCTGG + Intergenic
1044731906 8:95235658-95235680 AAGAGACAAATTTGTCTCCAGGG - Intergenic
1047486151 8:125332980-125333002 AAGAGACAGAGTTGTCTGAGTGG + Intronic
1047953238 8:129953116-129953138 AGGAAACAGACTTGTCTTCTAGG + Intronic
1048797028 8:138160105-138160127 ATGACACAGACTGGTGTGCCTGG + Intronic
1055360601 9:75485941-75485963 AAAAGACAGGCTTGTCTGGCAGG + Intergenic
1056207311 9:84333029-84333051 AAGGGATAGACCTGTCTCCCAGG - Intronic
1057174618 9:92987017-92987039 AAGAGGCAGACTTGCCTCCGAGG + Intronic
1057901013 9:98948301-98948323 TAAAGACACACTTGTCGGCCGGG + Intronic
1059061878 9:111041576-111041598 TAGAGACAGACATGTTGGCCAGG - Intergenic
1188927064 X:36056790-36056812 AAGAGGCAGACTTGCCTGATAGG - Intronic
1191712295 X:64163172-64163194 AAGGCATAGACTTGTCTCCCAGG + Intergenic
1195112805 X:101664447-101664469 AAGAGACAGGCTTGACAACCTGG + Intergenic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195581036 X:106502847-106502869 AAGGCACAGACCTGTCTCCCAGG + Intergenic
1195582302 X:106519685-106519707 TAGAGACAGGGTTGTCTCCCAGG - Intergenic
1196795885 X:119501677-119501699 GAGAGAAAGACTTGTCAGGCAGG + Intergenic
1199642930 X:149881379-149881401 AGGGGGCAGACTTGTCTGGCTGG + Intronic
1200703513 Y:6422155-6422177 AAAAGCCAGACATGGCTGCCTGG + Intergenic
1200928896 Y:8679282-8679304 ATGAGGCAGACTCGTGTGCCTGG + Intergenic
1201030598 Y:9742552-9742574 AAAAGCCAGACATGGCTGCCTGG - Intergenic