ID: 1105214919

View in Genome Browser
Species Human (GRCh38)
Location 13:18278415-18278437
Sequence CAGAATTGTCACTCTTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 2, 1: 2, 2: 2, 3: 14, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105214913_1105214919 14 Left 1105214913 13:18278378-18278400 CCCTCAGATCAAGGTCCACACAT 0: 2
1: 2
2: 0
3: 16
4: 121
Right 1105214919 13:18278415-18278437 CAGAATTGTCACTCTTAGCAAGG 0: 2
1: 2
2: 2
3: 14
4: 126
1105214914_1105214919 13 Left 1105214914 13:18278379-18278401 CCTCAGATCAAGGTCCACACATG 0: 2
1: 2
2: 1
3: 9
4: 131
Right 1105214919 13:18278415-18278437 CAGAATTGTCACTCTTAGCAAGG 0: 2
1: 2
2: 2
3: 14
4: 126
1105214910_1105214919 28 Left 1105214910 13:18278364-18278386 CCGAAGCCTCTAAGCCCTCAGAT 0: 3
1: 1
2: 2
3: 20
4: 166
Right 1105214919 13:18278415-18278437 CAGAATTGTCACTCTTAGCAAGG 0: 2
1: 2
2: 2
3: 14
4: 126
1105214916_1105214919 -1 Left 1105214916 13:18278393-18278415 CCACACATGGTCTGCAGCCTGCC 0: 4
1: 0
2: 4
3: 22
4: 275
Right 1105214919 13:18278415-18278437 CAGAATTGTCACTCTTAGCAAGG 0: 2
1: 2
2: 2
3: 14
4: 126
1105214912_1105214919 22 Left 1105214912 13:18278370-18278392 CCTCTAAGCCCTCAGATCAAGGT 0: 2
1: 1
2: 2
3: 12
4: 116
Right 1105214919 13:18278415-18278437 CAGAATTGTCACTCTTAGCAAGG 0: 2
1: 2
2: 2
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105214919 Original CRISPR CAGAATTGTCACTCTTAGCA AGG Intergenic
902263698 1:15246660-15246682 AATAAATGTCACTCTTAACAGGG + Intergenic
905935274 1:41818486-41818508 AAGTATTGTTTCTCTTAGCAAGG + Intronic
910793083 1:91071224-91071246 CAGCATTGTCACTCTTTTCAGGG + Intergenic
911684176 1:100755594-100755616 CAGGACTCTGACTCTTAGCATGG - Intergenic
916243256 1:162660694-162660716 CAGAAGTGTCACTCTCAGGAGGG - Intronic
1064913769 10:20433847-20433869 CAGAATCTTCACTGTCAGCATGG + Intergenic
1066266635 10:33782529-33782551 CAGAAATTCCACTCTTGGCAAGG + Intergenic
1066755372 10:38706532-38706554 CATAATTGTCACACTCACCAAGG + Intergenic
1068762576 10:60729839-60729861 CTGAATTTTCTCTCTTAGGAAGG - Intronic
1071139354 10:82489496-82489518 CAGCAATGTCACTCTTAGGAGGG + Intronic
1071213658 10:83373572-83373594 CAGAATTTTGACTATTAACAGGG + Intergenic
1073997967 10:109338046-109338068 CATAATTGTCAGATTTAGCAAGG - Intergenic
1076783488 10:132737290-132737312 CAGGAGTGTCACTCTGAGCCAGG - Intronic
1081768037 11:45626056-45626078 CAGAATCTTCACTTTTAACAAGG - Intergenic
1085644700 11:78215588-78215610 CAGAATTGTCACTGTTTGTCAGG - Exonic
1086958664 11:92959997-92960019 CAAAATTATCTATCTTAGCAGGG - Intergenic
1087857318 11:103108049-103108071 GAGCATTATCACTCTTACCAAGG - Intergenic
1090559786 11:127919419-127919441 CAGACTTGTGACTCATACCAAGG - Intergenic
1093316148 12:17652722-17652744 GAAAATTGTCTCTCTTAGGAGGG + Intergenic
1093426885 12:19037770-19037792 CAGAGCTTTCAGTCTTAGCAGGG + Intergenic
1095517610 12:43023822-43023844 CACAATAGTCACTCTTAGAAGGG - Intergenic
1096599953 12:52722145-52722167 CTGACCTGTCACTCTCAGCATGG - Intergenic
1097752719 12:63375207-63375229 CTCATATGTCACTCTTAGCATGG + Intergenic
1098054970 12:66495659-66495681 CAGAATTCTCACACTTGGGAGGG - Intronic
1099799537 12:87440343-87440365 CAGACTTGTGACTCATACCAAGG + Intergenic
1102614024 12:114137494-114137516 CAGGCTTGTCACTCTGTGCAAGG - Intergenic
1105214919 13:18278415-18278437 CAGAATTGTCACTCTTAGCAAGG + Intergenic
1106011117 13:25824265-25824287 CAGAATTGACACTGCTAGCAGGG - Intronic
1106959992 13:34987445-34987467 CATAATTGTCAGATTTAGCAAGG - Intronic
1107153402 13:37138938-37138960 CAGAATTGTCATTCTTAAGGTGG - Intergenic
1111218106 13:85170922-85170944 CATAATTTTCACTTTTAACATGG + Intergenic
1114603055 14:23971538-23971560 CATAATTGTCAGACTCAGCAAGG + Intronic
1116998681 14:51350512-51350534 CAAAATGCTCACTCTTACCATGG + Intergenic
1118333822 14:64834898-64834920 CAGAAATGTCAGTCTTAGAATGG + Intronic
1122267487 14:100553499-100553521 GACAGTTGTCCCTCTTAGCAGGG - Intronic
1124070962 15:26393008-26393030 AAAAATTCTCACTCTAAGCATGG + Intergenic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1126083846 15:44991799-44991821 CACAATTGTCAGACTTACCAAGG + Intergenic
1128072353 15:64805884-64805906 CAGAATGGTCTCTCTCAGCTGGG - Intergenic
1128862515 15:71085808-71085830 CAGGATTGACTCCCTTAGCAAGG + Intergenic
1128941246 15:71789547-71789569 CAGAACTGACACCCTGAGCATGG + Intergenic
1130414546 15:83680017-83680039 CAGACTTTTCACTCTTTGCAGGG + Intronic
1130680111 15:85989259-85989281 CAGAATTGCCACACTGAGTAGGG + Intergenic
1132353115 15:101152884-101152906 CACACCTTTCACTCTTAGCAAGG + Intergenic
1135171711 16:20189897-20189919 CTGAATAGGCACTCTTAGAAGGG + Intergenic
1136231738 16:28889702-28889724 CAGAATGGTCACTCATGACAGGG + Intronic
1137314362 16:47300519-47300541 CAGAACTGTCACTCTAGGAAAGG - Intronic
1137806760 16:51313866-51313888 CTGAAATGTCACTCGTAGAATGG + Intergenic
1150989974 17:70246005-70246027 TCAAATTGTCACTCTTAGCATGG + Intergenic
1156687442 18:39667028-39667050 CATATCTGTCAGTCTTAGCAAGG + Intergenic
1156870888 18:41943709-41943731 CAGAATTGTCATTCTTAGCTTGG + Intergenic
1159255386 18:65938290-65938312 AAGAATTGTCACTCTGTGCCAGG + Intergenic
1160817072 19:1041089-1041111 CAGGACTGTCGCTCTGAGCAGGG - Intronic
1162858132 19:13484887-13484909 CAGACTTGTCCCTTTTTGCAAGG + Intronic
1164091135 19:21953355-21953377 CATAATTGTCAGACTTACCAAGG + Intronic
1164180603 19:22815099-22815121 CAGAATTCTCCCTTTCAGCAGGG - Intergenic
1166406065 19:42522745-42522767 CAGGATGGTCACTGTTAGCCAGG + Intronic
928172344 2:29011770-29011792 CAGAATTGTCTCTCTTATCGAGG - Intronic
928449803 2:31368079-31368101 CAGAAATGTGGCTTTTAGCAGGG + Intronic
928662537 2:33517779-33517801 CAGCATTCTCACCCTTAGCATGG + Intronic
934299401 2:91768322-91768344 CAGAATTGTCACTCTTAGCAAGG - Intergenic
935493136 2:103745371-103745393 CAGAATTGTCACTTTTAAGCTGG + Intergenic
937618997 2:123964040-123964062 GATAATTATCACTCTTGGCAAGG + Intergenic
938185369 2:129227065-129227087 AAAAAATGTCACTCTCAGCACGG + Intergenic
943115309 2:183662040-183662062 GAGAACTGTCATTTTTAGCATGG + Intergenic
943337465 2:186635248-186635270 CAGAATTGTCGTTGTTAGAATGG + Intronic
945896249 2:215485738-215485760 GAGAAATGTCACTCTTAGAGTGG - Intergenic
1173085574 20:39912944-39912966 GAGAGCTGTCACACTTAGCAGGG + Intergenic
1177543842 21:22530840-22530862 CTGAACTTTAACTCTTAGCAAGG + Intergenic
1177783689 21:25646466-25646488 CTGAGTTGTCACCCTTAGAATGG + Intronic
1177815356 21:25970588-25970610 CAAAATTCTCTATCTTAGCAAGG - Intronic
1181556632 22:23675156-23675178 CAGTATTGTCACTCTTAGCAAGG + Intergenic
1181697758 22:24602427-24602449 CAGTATTGTCACTCTTAGCAAGG - Intronic
952408294 3:33025528-33025550 CAGCATTGTGACTTTTAGAAAGG - Intronic
953444904 3:42954942-42954964 AAGAATGGTCTCTCATAGCAGGG - Intronic
953676275 3:45005393-45005415 CTGCATTGTCACTCTGTGCAAGG + Exonic
954989256 3:54825412-54825434 CAGAATTGTATCTATAAGCAAGG - Intronic
956143689 3:66171278-66171300 CACATTTGTCACTGTTACCAAGG - Intronic
957531332 3:81443921-81443943 CAGAATTGTTACTGTTGGCTTGG + Intergenic
957800667 3:85075950-85075972 AAGCATTGTCACTATTATCATGG - Intronic
957912245 3:86634984-86635006 CAGAATTGAATCTCTAAGCATGG + Intergenic
959665078 3:108911542-108911564 CAGAATTGTGTTTATTAGCAAGG + Intronic
959953426 3:112207888-112207910 CAATATTCTCAGTCTTAGCAGGG - Intronic
960482934 3:118215292-118215314 CAGAATTGTGAATCTAAGAATGG - Intergenic
961675614 3:128563980-128564002 CATAATTGTCCCTCTAAGCATGG + Intergenic
964576833 3:158180509-158180531 CATGATTGTGACTCTTAGCCTGG - Intronic
967258403 3:187617253-187617275 CAGGATTTTCATTCTTGGCATGG + Intergenic
971088709 4:23313325-23313347 CAGAAATCTAACTTTTAGCAAGG - Intergenic
973752975 4:54042106-54042128 ATGAAGTGTCACTCTTACCATGG + Intronic
982247221 4:153365122-153365144 CAGAATTGTCACTGGTAGCTTGG - Intronic
987360443 5:17101767-17101789 CAGAATTGTCAGCCATGGCAAGG - Intronic
989357924 5:40565848-40565870 CATAATTGTCACATTTACCAAGG - Intergenic
990107090 5:52278185-52278207 CAGAATTCTCATTCTTAAAATGG + Intergenic
991012135 5:61894917-61894939 CAAAATTGGCTCTGTTAGCAAGG - Intergenic
991301644 5:65134358-65134380 CAGAATAGTCACCCTCAGCTAGG + Intergenic
992861873 5:80919523-80919545 AAGAAGTGTCACTCTCTGCAGGG + Intergenic
993238666 5:85349912-85349934 CAGAATTGGCTCTCTAAGGAAGG - Intergenic
993577187 5:89616542-89616564 CAAAAGTGTCACTTTTAGCCTGG - Intergenic
994910503 5:105899247-105899269 CTGCATTGTCTCTCTTTGCAAGG + Intergenic
995538454 5:113160710-113160732 CAGAATTAGCACAATTAGCATGG + Intronic
995973039 5:117996501-117996523 CAGAATTGATACTCTTGCCATGG + Intergenic
996686456 5:126286868-126286890 CAGGATTCTCACTCCTAGAAAGG + Intergenic
996870921 5:128192559-128192581 AAGAACTGTCACGCTTAGAAAGG - Intergenic
997518324 5:134506318-134506340 CAGAACTGTCACTCTCAGGCAGG - Intergenic
1000247765 5:159463063-159463085 CAGAATAGCCACTCTTGGCCTGG - Intergenic
1003935875 6:10974776-10974798 CAAAAGTGTCACCTTTAGCAGGG + Intronic
1005505559 6:26466364-26466386 CTGAAATGTAACTCTTAGGAAGG - Intronic
1007819993 6:44554199-44554221 CAGACTGGTCAGTCTTAGCGAGG - Intergenic
1009514134 6:64592528-64592550 AAGAATTGTAGCCCTTAGCAAGG - Intronic
1011844450 6:91546149-91546171 CAGGATTGGTCCTCTTAGCAAGG - Intergenic
1012869145 6:104653554-104653576 CAGCACAGGCACTCTTAGCAAGG - Intergenic
1013493756 6:110677266-110677288 CAGAAGTGTCACCATTGGCAGGG + Intronic
1021012332 7:15485701-15485723 CAGGCTTCACACTCTTAGCACGG + Intronic
1021663238 7:22943379-22943401 CAGAATTTGCATTCTTAACAAGG - Exonic
1021824300 7:24532755-24532777 CAGAAGTGTCCCTCTAATCATGG - Intergenic
1022472806 7:30692177-30692199 CTGAATGGTGACTCTTGGCAAGG + Intronic
1023565951 7:41523758-41523780 CTGAATTGTTTCTCTCAGCAAGG - Intergenic
1028338507 7:89688397-89688419 CATAATTGTCATTCTTATAAAGG - Intergenic
1031101638 7:117487662-117487684 CAGAGTTCTCTTTCTTAGCATGG + Intronic
1031111083 7:117609296-117609318 CAGATTTGTCACTTGTAGAATGG + Intronic
1031184533 7:118459887-118459909 CAGAATTGTTTCACTTAGAAAGG - Intergenic
1031194034 7:118590058-118590080 TAGAATTGTCACACTAAGCCTGG - Intergenic
1031440784 7:121792381-121792403 AAGACTTATCACTCTTAGCCAGG + Intergenic
1039553528 8:38460396-38460418 CAGTATTCTGACACTTAGCAAGG - Intronic
1043090812 8:75901124-75901146 GAGAATTGTCAGCCTAAGCAAGG + Intergenic
1043852478 8:85230446-85230468 AAGCACTGTCACTGTTAGCATGG + Intronic
1044808085 8:96029313-96029335 CAGACTTGTCAGTCTGAACAAGG - Intergenic
1045530453 8:102980316-102980338 CATTATTGTCACTCTGATCAAGG + Intergenic
1045584244 8:103513472-103513494 AAGATATGTAACTCTTAGCAGGG + Intronic
1046311901 8:112448368-112448390 CACAATTCCCACTCATAGCAGGG + Intronic
1053824274 9:42004286-42004308 CAAAAATGTTACACTTAGCAAGG - Intronic
1054606300 9:67183077-67183099 CAAAAATGTTACACTTAGCAAGG + Intergenic
1055163830 9:73166482-73166504 CAGAATGGTCACTGAGAGCATGG + Intronic
1058689586 9:107508251-107508273 TAAAATTGTCACTCTTGGCAGGG + Intergenic
1060314915 9:122500268-122500290 CAAAATTGTCTCTCTCAGCCTGG + Intergenic
1062308796 9:135924727-135924749 CTGAATTGTCCACCTTAGCACGG - Intergenic
1185787891 X:2906016-2906038 CAGCTCTGCCACTCTTAGCATGG - Exonic
1186206433 X:7205326-7205348 TAGAGTTGTCACTTTTAGCTTGG - Intergenic
1186572030 X:10725078-10725100 CATAATTGTCCCTCTTTGCAGGG - Intronic
1187264215 X:17716594-17716616 CAAAATGGTCACTTTCAGCAAGG + Intronic
1191112484 X:56816298-56816320 CAGAATTCTCAGTTTTAGAAAGG + Intergenic
1194923724 X:99797491-99797513 CAGATTAGACACTTTTAGCATGG - Intergenic
1197445375 X:126547005-126547027 CAAAACTGTCACTGTGAGCATGG + Intergenic
1198803497 X:140471285-140471307 AAGATTTGTCTCTTTTAGCAAGG - Intergenic
1201287103 Y:12388541-12388563 CAGCTCTGCCACTCTTAGCATGG + Intergenic
1201578291 Y:15484043-15484065 CAGAATTGTCACTTTTAGCTTGG - Intergenic