ID: 1105215228

View in Genome Browser
Species Human (GRCh38)
Location 13:18280300-18280322
Sequence GGAAGGGTATGGAGCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 3, 1: 0, 2: 4, 3: 40, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105215228_1105215236 1 Left 1105215228 13:18280300-18280322 CCCCCTGGGCTCCATACCCTTCC 0: 3
1: 0
2: 4
3: 40
4: 378
Right 1105215236 13:18280324-18280346 CAGCACCCTCTATATATCTCTGG 0: 3
1: 0
2: 1
3: 45
4: 1334
1105215228_1105215237 2 Left 1105215228 13:18280300-18280322 CCCCCTGGGCTCCATACCCTTCC 0: 3
1: 0
2: 4
3: 40
4: 378
Right 1105215237 13:18280325-18280347 AGCACCCTCTATATATCTCTGGG 0: 2
1: 0
2: 1
3: 10
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105215228 Original CRISPR GGAAGGGTATGGAGCCCAGG GGG (reversed) Intergenic
900265532 1:1755428-1755450 GGAAGCCCAGGGAGCCCAGGTGG + Exonic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900342880 1:2197084-2197106 GGAAGGAGATGGGTCCCAGGGGG - Intronic
900522575 1:3112846-3112868 TGATGGGGCTGGAGCCCAGGCGG - Intronic
901153531 1:7120633-7120655 ACCAGGGTATGGAGCCCAAGAGG + Intronic
901309442 1:8257745-8257767 GGGAGAGGGTGGAGCCCAGGAGG + Intergenic
902199406 1:14822555-14822577 GGAAGGACACGCAGCCCAGGAGG - Intronic
902335342 1:15751289-15751311 GGGAGGGCATGGAGGCCAGGAGG + Intergenic
902377156 1:16035225-16035247 TGGAGGGGAGGGAGCCCAGGGGG + Intergenic
902511409 1:16968922-16968944 GCAATGGGATGGGGCCCAGGTGG + Intronic
902520510 1:17013051-17013073 GGTAGGGGATAGACCCCAGGAGG + Intergenic
903160918 1:21488599-21488621 GGAAGGGCATGGCATCCAGGAGG + Intergenic
903669916 1:25029248-25029270 GGAAGGGTTTGGCGCCAAGTCGG - Intergenic
904770315 1:32877546-32877568 GGAAGGGAAGGGAACCCGGGTGG + Intergenic
905301223 1:36987426-36987448 GGAAGGGAATGGAGCCAAGAAGG + Intronic
905927338 1:41760826-41760848 GGAAGGCTGGGGAGACCAGGTGG - Intronic
907235919 1:53047368-53047390 GGAAGGGGATGTACACCAGGAGG + Intronic
907461631 1:54608883-54608905 GGAAGGGGTGGGAGCCCAGTGGG - Intronic
907875589 1:58483939-58483961 GGGAGAGTATGGAGTCCAGCAGG + Intronic
908072133 1:60472745-60472767 AGCACTGTATGGAGCCCAGGAGG + Intergenic
909739178 1:79006875-79006897 GGCAGGGAATGGAGCCCAGGAGG - Intergenic
910244078 1:85120292-85120314 GGAAGGGAGTGGAACCCTGGAGG + Intronic
912524008 1:110267187-110267209 GGGAAGGTTTGGGGCCCAGGAGG + Intronic
913043280 1:115051217-115051239 GGAGGATTATTGAGCCCAGGAGG + Intronic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
916022774 1:160808422-160808444 GAAAGAGTATGGAACCCAGCAGG + Intronic
918446285 1:184620419-184620441 GGAAGGGTAGGGAGCCCTATAGG - Exonic
919814705 1:201430047-201430069 GGAAGGGAATGGAGCAGAGGGGG - Intergenic
920200777 1:204258575-204258597 GGAAGGCCATGGGGCCCGGGAGG - Intronic
920947045 1:210539432-210539454 GGAAGGCCTTTGAGCCCAGGTGG + Intronic
920951228 1:210573464-210573486 GCAAGGGGATGGGGTCCAGGAGG - Intronic
921689213 1:218128691-218128713 GGAAAGGCATTGAGACCAGGAGG + Intergenic
922416439 1:225427463-225427485 GGAAGGGTCTGCGGCCGAGGTGG - Intronic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
922769335 1:228173625-228173647 GGAGGAGCAAGGAGCCCAGGAGG - Intronic
922854238 1:228760445-228760467 GGAAGAGCTTGCAGCCCAGGTGG - Intergenic
923888775 1:238187855-238187877 ATAAGGGTATGGATACCAGGAGG + Intergenic
924587413 1:245372126-245372148 GACAGGGGATGGAGCTCAGGAGG - Intronic
924741409 1:246796160-246796182 GGTAGGGCATGGGGCGCAGGAGG + Intergenic
924772563 1:247089829-247089851 GGAAGGGCAGGCAGCCCAGTCGG - Intergenic
1062947826 10:1474473-1474495 GGAGGGGGATGCATCCCAGGAGG + Intronic
1064384326 10:14877909-14877931 GGAGGGGGGTGGAGACCAGGTGG + Intergenic
1064592867 10:16912695-16912717 GGAACGGAATGGAGGCCAGGTGG + Intronic
1065297722 10:24292507-24292529 AGAAGGGTAGGGAGGCCATGAGG + Intronic
1066125614 10:32338846-32338868 GGAGGAGCCTGGAGCCCAGGAGG + Intronic
1067009817 10:42700527-42700549 GGAACGGAACGGAGGCCAGGTGG + Intergenic
1067127960 10:43536246-43536268 GGAAGGGCATTGAGCCAAAGAGG - Intergenic
1067756825 10:49011782-49011804 GGAAGAGCAGGAAGCCCAGGTGG - Intergenic
1068137256 10:52963371-52963393 GGAAAGGCATGGAGCAAAGGTGG + Intergenic
1068756371 10:60658825-60658847 GGAAGGGTAGGGAGGGAAGGAGG + Intronic
1069776930 10:70932823-70932845 GGGAGGGTATAGAACCCTGGGGG - Intergenic
1069891812 10:71656804-71656826 GGAGGGGCATGGAGGCCGGGAGG + Intronic
1069900998 10:71706679-71706701 GGGAGGGTCTGGAGCACTGGTGG + Intronic
1069948253 10:72001999-72002021 GGAAGGGGATAGAGCCCGGATGG - Intronic
1070142268 10:73747150-73747172 GGAAGGGAAGGGCGCCCACGGGG - Intronic
1070304149 10:75228346-75228368 GGAAGGATCTCAAGCCCAGGTGG - Intronic
1070757850 10:79004718-79004740 AGATGGGAATTGAGCCCAGGAGG + Intergenic
1070788409 10:79175664-79175686 TGAAGGGTGTGGTGGCCAGGGGG - Intronic
1072249757 10:93572309-93572331 GCAAGGGGATGGAGACGAGGAGG + Intronic
1073573308 10:104599162-104599184 GGAAGGAGATGCAGCCCTGGGGG - Intergenic
1074352025 10:112747158-112747180 GGAAGTGTTTGGAGGCCCGGTGG - Intronic
1076110839 10:127858107-127858129 GGAAGGGGATGGAACCAAGAAGG + Intergenic
1076265139 10:129103859-129103881 CATAGAGTATGGAGCCCAGGAGG + Intergenic
1076350108 10:129809843-129809865 GGAGGGCTCTGGAGCCAAGGAGG - Intergenic
1076535122 10:131172244-131172266 GGAAGTGAATGGACCCCACGGGG + Intronic
1076535139 10:131172283-131172305 GGAAGTGAATGGACCCCACGGGG + Intronic
1076741432 10:132487717-132487739 GGAAGGATGTGGAACCCTGGAGG - Intergenic
1077076857 11:706006-706028 GGCTGGGGCTGGAGCCCAGGCGG + Intronic
1077463604 11:2723035-2723057 GCACGGGAATGGAGGCCAGGAGG - Intronic
1078456214 11:11477495-11477517 GGAAAGGTGTGGAGGGCAGGAGG - Intronic
1080568201 11:33531767-33531789 GGAAGGGTTTGGCGCCTAAGTGG + Intergenic
1080896671 11:36453902-36453924 GGGAGGGTTTGGAGGACAGGAGG + Intronic
1081586326 11:44386523-44386545 GGATGGAGATGGAGCCCAGAGGG - Intergenic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1082768366 11:57186461-57186483 GGGAAGATAGGGAGCCCAGGGGG + Intronic
1082990265 11:59201394-59201416 GGAAGGGCATGGGCCACAGGAGG - Intronic
1082997128 11:59263357-59263379 GGAAGGGTGGGGACCCCAGTGGG - Intergenic
1083140487 11:60717414-60717436 GGGAGGGGATGGAGCCCTGTGGG - Intergenic
1083752354 11:64767579-64767601 GGAGGGCCATGGTGCCCAGGAGG + Exonic
1085449427 11:76623039-76623061 GGAAGGGTATTGAGGAGAGGAGG - Intergenic
1085486584 11:76868940-76868962 GGAAGGGTCCTGAGCACAGGAGG - Intronic
1087269857 11:96100127-96100149 GGAAGGGCATGGAGTCCAGATGG - Intronic
1087934719 11:104018954-104018976 GGAAGTGCTTGGAGCCGAGGAGG - Intronic
1088986485 11:114913823-114913845 AGAAGGAAATGGAGACCAGGAGG + Intergenic
1089070137 11:115693343-115693365 GAAAGGGGAGGGGGCCCAGGAGG + Intergenic
1089133750 11:116232990-116233012 GCAAAGGTATGGAGGCCAGAAGG - Intergenic
1089151946 11:116371236-116371258 GGAAGTGCCTGGAGCCCAGTGGG + Intergenic
1089259549 11:117214495-117214517 GGAGGGCTATGGAGCCAAGAAGG + Intronic
1090423682 11:126592689-126592711 GCCAGGGTGGGGAGCCCAGGAGG + Intronic
1091713620 12:2760495-2760517 GGGAGGGTCTGGAGCTCAGGAGG + Intergenic
1092728591 12:11507939-11507961 GGAAGGGTGTGGACATCAGGAGG - Intergenic
1093980810 12:25473256-25473278 GGGAGGGGCTTGAGCCCAGGAGG - Intronic
1094411011 12:30169198-30169220 GGAAGGGAAGGGAGCAAAGGTGG + Intergenic
1096694086 12:53337818-53337840 GGAAGGGTTTGGGAACCAGGTGG + Intronic
1098243894 12:68496371-68496393 GGAAGGGAATGAAGCCCAAGTGG - Intergenic
1099051192 12:77783448-77783470 GGAAGGGTGTGGTGCACAGAGGG + Intergenic
1100604590 12:96141256-96141278 GGTAGGTGATGGAGCCCAGCTGG + Intergenic
1101601934 12:106217368-106217390 GGGAGGATCTTGAGCCCAGGAGG - Intergenic
1101964068 12:109270125-109270147 GGAAAGGCATTAAGCCCAGGGGG - Intergenic
1102222435 12:111203684-111203706 GGAAGGGTTTTGAGCAGAGGAGG + Intronic
1102519775 12:113471144-113471166 GGAAAGGTCCCGAGCCCAGGCGG - Intronic
1102555480 12:113723954-113723976 GGGAGGATATTGAGCACAGGAGG + Intergenic
1102861181 12:116337847-116337869 GGAAGGGAAAGAAGCCAAGGAGG - Intergenic
1102995340 12:117345767-117345789 GGAGGATTATTGAGCCCAGGAGG + Intronic
1103997158 12:124837810-124837832 GGGAGGATAACGAGCCCAGGAGG + Intronic
1104054735 12:125220798-125220820 GGAAGGGTTTGGAGCAGAGGAGG - Intronic
1104189027 12:126459975-126459997 TGAGGGGTAAGGAGCCCAGCAGG - Intergenic
1104611725 12:130234581-130234603 GGAAGGGTAGGAAGGGCAGGTGG + Intergenic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1106405622 13:29470521-29470543 GAATGTGTTTGGAGCCCAGGTGG - Intronic
1107349601 13:39500292-39500314 GGAAGGATCTTGAGCCCAGGAGG - Intronic
1109262766 13:60163698-60163720 GGAAGGGTAGGGAGTCCCAGCGG + Exonic
1110754695 13:79159035-79159057 GGAAGGGTATGGAGGTCGGGAGG - Intergenic
1111833522 13:93359056-93359078 GGGAGGATCTCGAGCCCAGGAGG - Intronic
1112012269 13:95301920-95301942 AGAAGGGAAAGGCGCCCAGGGGG - Intergenic
1112485377 13:99814935-99814957 GCAGGAGAATGGAGCCCAGGAGG + Intronic
1112811437 13:103223513-103223535 GTAAGTGTTTGGAGCCCAGAAGG - Intergenic
1114503599 14:23190828-23190850 AGAAGGGTATGAAGTCCAAGTGG - Intronic
1115560710 14:34580390-34580412 GGAAGATTCTTGAGCCCAGGAGG - Intronic
1116688618 14:48075881-48075903 GGGAAGTTCTGGAGCCCAGGAGG + Intergenic
1117744952 14:58860268-58860290 CTAAGGGTATGGAGTCCAGCTGG + Intergenic
1117955941 14:61123776-61123798 GGAGGGGCATGGAACCAAGGGGG - Intergenic
1118774366 14:68964425-68964447 AGAAGTGTATGGGGCCCGGGAGG + Intronic
1119437998 14:74610699-74610721 GGCAGGGGGTGGTGCCCAGGGGG + Intronic
1119644744 14:76340095-76340117 GGCAGGGTGGGGAGCCCAGGAGG + Intronic
1120468233 14:84888844-84888866 GGAGGGGAATGGAGTCGAGGAGG - Intergenic
1122386635 14:101352814-101352836 GGATGGCTCTGGAGCACAGGTGG - Intergenic
1122843057 14:104476090-104476112 GGAGGGGTTGGGAGTCCAGGGGG - Intronic
1122847848 14:104510458-104510480 GGAATGGAAGGGAGACCAGGAGG - Intronic
1122921056 14:104880321-104880343 TGAAGGGTTTGGCGCCCAAGAGG + Exonic
1124438622 15:29671212-29671234 GGAAGGGTCCGGAGCCCAGGAGG - Intergenic
1124632932 15:31347521-31347543 GGCAGGATGTGGGGCCCAGGAGG + Intronic
1124709037 15:31989967-31989989 GGTAGGGCATTGAGCCCAAGAGG - Intergenic
1124872324 15:33555340-33555362 GGGAGGGTATGGAGCAAAGGAGG + Intronic
1129664730 15:77573224-77573246 GGAAGGGCAGGCGGCCCAGGTGG + Intergenic
1131704912 15:94983204-94983226 GGAAGTGTAGGGTGCCCAGCTGG - Intergenic
1132515378 16:363544-363566 GGAAGGGCATGGAGAGCGGGCGG - Intergenic
1132556842 16:576303-576325 GGAAGGCTCTGCTGCCCAGGAGG - Intronic
1132811743 16:1802748-1802770 GGAAGGGCATGGAGACCAGCAGG - Intronic
1132921601 16:2398543-2398565 GAAAGGGTATGGAGCCTCTGTGG + Intergenic
1133019950 16:2963010-2963032 GGAGGGGCGTGGAGCCGAGGTGG - Intergenic
1133972886 16:10580109-10580131 AGAGGGGTACGCAGCCCAGGAGG + Intronic
1134865711 16:17604980-17605002 GGAAGGGTATGAAGGGCATGCGG - Intergenic
1135260200 16:20974109-20974131 GGGAGGGTCCTGAGCCCAGGAGG - Intronic
1136022770 16:27450409-27450431 GGCAGGGTAGGGGGCCCAGCAGG - Exonic
1136247129 16:28982476-28982498 GGAAGGGTGCAGAGCCCAGGAGG - Exonic
1136364714 16:29804705-29804727 GGAAGAGGCTGGAGCGCAGGAGG + Intronic
1136518498 16:30782023-30782045 GGTAGGGTCTGGCCCCCAGGGGG + Exonic
1136922431 16:34344035-34344057 GGAAGGGGATGGAGCCAGAGAGG - Intergenic
1136982142 16:35067771-35067793 GGAAGGGGATGGAGCCAGAGAGG + Intergenic
1137771067 16:51015478-51015500 GGAAGGCCTGGGAGCCCAGGGGG - Intergenic
1138205877 16:55124730-55124752 GTAAGGGTATGAATACCAGGAGG + Intergenic
1138334670 16:56243630-56243652 GGAATTGGAGGGAGCCCAGGAGG + Intronic
1139471482 16:67180282-67180304 GGACGGGGACGGAACCCAGGTGG - Exonic
1139579158 16:67861945-67861967 GGAAGGGTGGGGATCGCAGGAGG + Intronic
1139776515 16:69320071-69320093 GGAAGTGCCGGGAGCCCAGGCGG + Intronic
1140477741 16:75247408-75247430 GGGTGGATATGGTGCCCAGGCGG - Intronic
1140861527 16:79022690-79022712 GTAAGGGGCTGGAGCCCAAGAGG + Intronic
1141605812 16:85152700-85152722 GGCAGGAAAGGGAGCCCAGGGGG - Intergenic
1142178700 16:88656818-88656840 GGAAGGCGCAGGAGCCCAGGTGG + Intronic
1142591439 17:1007880-1007902 GGCAGGGCCTGGAGCCCAGCAGG + Intronic
1143086790 17:4422098-4422120 GGAAGGGCATGAATACCAGGAGG - Intergenic
1143447616 17:7018521-7018543 GGCAGGAAATGGAGACCAGGGGG + Intergenic
1143632299 17:8146240-8146262 GGAACAGTCTGGAGACCAGGAGG + Intronic
1144516350 17:15919737-15919759 GGAAGGGAAGGGAGGCCAGGTGG + Intergenic
1145234746 17:21200613-21200635 GGAAGGGCATGGACTCCAGCAGG - Intronic
1145258723 17:21342260-21342282 GGCAGGGCCTGGAGCCCAGAGGG - Intergenic
1145317906 17:21745744-21745766 GGCAGGGCCTGGAGCCCAGAGGG + Intergenic
1145767328 17:27467898-27467920 AGAATGGAATGGAACCCAGGAGG - Intronic
1146254891 17:31386168-31386190 AGAAGGATCTGGAGCCCAGTTGG + Intergenic
1146290205 17:31601263-31601285 GAAAGGGTCAGGAGCCAAGGCGG + Intergenic
1147371072 17:39993473-39993495 GGAATGGTAAGGGGGCCAGGAGG - Intronic
1147578664 17:41616730-41616752 GGAAGGCTGCGGACCCCAGGGGG + Intergenic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1148569879 17:48659788-48659810 GGAAGGGTATTGAGCGGGGGTGG + Intergenic
1148990874 17:51666258-51666280 GGAAGAGGCTGGAGCCCAGAAGG + Intronic
1150374867 17:64672627-64672649 GGAGGATCATGGAGCCCAGGAGG + Intergenic
1150473956 17:65460262-65460284 GGAAAGCTCTGGAGCCCAGGTGG + Intergenic
1150846122 17:68659760-68659782 GGGAGGATACTGAGCCCAGGAGG + Intergenic
1151870088 17:76830697-76830719 GCAAGGGCATGGATACCAGGAGG + Intergenic
1152127903 17:78458465-78458487 GGAAGAGGAGGGAGCCCAGGTGG - Intronic
1152228499 17:79103450-79103472 GGAGGGGTATGGGCCCCAGGGGG + Intronic
1152585101 17:81185818-81185840 GGGAGAGAATGGAGCCCATGAGG + Intergenic
1152612724 17:81323515-81323537 AGGAGGGTTTGGAGCCCAGGTGG + Intronic
1152795517 17:82304338-82304360 GGAAGGAGAAGGAGCCCTGGGGG + Intergenic
1153731200 18:8013669-8013691 GGGATGGTATGTACCCCAGGAGG - Intronic
1154026370 18:10710734-10710756 GGAAGGGTCTGGTGGCCAGGAGG - Intronic
1154027867 18:10724924-10724946 GGACGGCGATGGAACCCAGGTGG + Intronic
1155387926 18:25301300-25301322 GGAAGGGTACAGAGGGCAGGAGG - Intronic
1156834291 18:41533957-41533979 GGAAGGGTAAGGAGACGAGTAGG - Intergenic
1157419498 18:47533472-47533494 GGAGGGATATAGAGCCCGGGAGG + Intergenic
1158133872 18:54184257-54184279 GGCAGGAGGTGGAGCCCAGGTGG - Intronic
1158642678 18:59217209-59217231 GGAATGGTAGAGACCCCAGGTGG + Intergenic
1159409712 18:68055258-68055280 GGAAGCAGAGGGAGCCCAGGTGG + Intergenic
1160155343 18:76429452-76429474 GGCAGAGTCAGGAGCCCAGGGGG - Intronic
1160292480 18:77607248-77607270 CGTGGGGAATGGAGCCCAGGCGG + Intergenic
1161153934 19:2722658-2722680 GAAGGGGTCTGGAGGCCAGGAGG - Intronic
1162478879 19:10916518-10916540 GGCAGGCTGTGGGGCCCAGGCGG - Intronic
1162526994 19:11211916-11211938 GGAAGTGAAGGGAGCCAAGGTGG + Intronic
1162647077 19:12057629-12057651 GGAGGGATGTGCAGCCCAGGAGG + Intergenic
1162719201 19:12652092-12652114 GGGAAGTTATGGAGCCCAAGAGG - Intronic
1162727653 19:12699815-12699837 TGGAGGGTCTGGCGCCCAGGAGG + Exonic
1162819838 19:13216008-13216030 GGGAGGATCTTGAGCCCAGGAGG - Intronic
1163045512 19:14638631-14638653 TGAAGGGATTGGTGCCCAGGTGG - Intronic
1164156652 19:22601454-22601476 GGAAGAGGAGGGAGCCCAGGAGG + Intergenic
1164577177 19:29412311-29412333 GGGAGGATCTTGAGCCCAGGAGG - Intergenic
1164974994 19:32566286-32566308 GGAAGACGATTGAGCCCAGGAGG + Intergenic
1165434212 19:35787724-35787746 GGAAGGATGGGGGGCCCAGGGGG - Exonic
1166198161 19:41219857-41219879 GGAGGGCTCTGGAGCCCTGGGGG + Intronic
1166368013 19:42286948-42286970 GCAAGGGTGTGGGGTCCAGGTGG + Intronic
1167431955 19:49460327-49460349 GGGAGGATTTTGAGCCCAGGAGG - Intronic
1167619583 19:50553297-50553319 GGAAGGCTGTGGAGCAGAGGCGG - Intronic
1167744495 19:51342581-51342603 GGGAGGGTTTGGAGCAGAGGAGG - Intergenic
1168651895 19:58097318-58097340 GGAAAAGGAAGGAGCCCAGGAGG + Intronic
1168720838 19:58554264-58554286 TGTAGGGCATGGGGCCCAGGAGG + Exonic
925296551 2:2781008-2781030 TGCAGGGTGTGAAGCCCAGGAGG - Intergenic
925719960 2:6817504-6817526 GGGAGGGTCTGGAAACCAGGAGG + Intergenic
927194604 2:20538887-20538909 GGAAGGGGAGGGGCCCCAGGAGG - Intergenic
929944289 2:46358855-46358877 GGAAGGCTTTGAAGGCCAGGTGG + Intronic
929949108 2:46392915-46392937 GGAAGGGTCTGGAGGTGAGGAGG + Intergenic
930254520 2:49075033-49075055 GGAAGGGTATGGGGACGAGAAGG + Intronic
932593729 2:73081579-73081601 GGGAGGGGCCGGAGCCCAGGGGG + Intronic
932659866 2:73642570-73642592 AGAAGGGCAAGGAACCCAGGCGG - Intergenic
932666435 2:73702246-73702268 AGAAGGGCAAGGAACCCAGGCGG - Intergenic
933247254 2:79989544-79989566 GGAAGATCATTGAGCCCAGGAGG + Intronic
933638035 2:84728399-84728421 GGAGGGGTATTGAGGTCAGGAGG + Intronic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
934111969 2:88752454-88752476 GGAAGCCTCTGGAGCACAGGAGG - Intergenic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
935652276 2:105392380-105392402 GGGAGGATCTTGAGCCCAGGAGG + Intronic
936775920 2:115973008-115973030 GGAGGTGGATGGAGCTCAGGTGG + Intergenic
937260079 2:120579727-120579749 GGGAGGAGATAGAGCCCAGGTGG - Intergenic
940612492 2:156007555-156007577 GGAAGGGAATGGAGAGGAGGTGG - Intergenic
942320688 2:174733070-174733092 GGCAGGGCATGGAACCCAGAGGG - Intergenic
944353486 2:198758020-198758042 GAAATGGTATGGAGCCCAGATGG - Intergenic
947625854 2:231618249-231618271 AGAAGGGCATGGAGACCAGAGGG - Intergenic
947670961 2:231935031-231935053 GGCAGGGCCTGGAGGCCAGGCGG + Intergenic
948362283 2:237431022-237431044 GGGAGGAGCTGGAGCCCAGGAGG + Intergenic
948759673 2:240182888-240182910 GGCAGGGTCTGAAGCCCAGTGGG + Intergenic
948760011 2:240184501-240184523 GGTAGGGGATGGATACCAGGAGG - Intergenic
1169442165 20:5641654-5641676 GAAAGGGTATGAACACCAGGAGG + Intergenic
1170786030 20:19468458-19468480 GTATGGGTATAGAGACCAGGAGG + Intronic
1171126876 20:22610293-22610315 GAAGAGGTCTGGAGCCCAGGGGG - Intergenic
1171410488 20:24943725-24943747 AGAACAGTATGCAGCCCAGGAGG - Intergenic
1171447396 20:25214431-25214453 GGCAGTGTTTGGAGCCCAGCAGG + Intronic
1172444794 20:34987399-34987421 GTAAGGGTTTGGAGCTGAGGAGG - Intronic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1175172436 20:57090055-57090077 GGAAGTGCAAGGAGCCCTGGGGG - Intergenic
1175771630 20:61627933-61627955 GGAAGGCCAGGGGGCCCAGGAGG - Intronic
1175795459 20:61767722-61767744 GGAAGAGGAGGGAGCACAGGAGG + Intronic
1175853232 20:62104836-62104858 AGAAGGGAAGGGAGCCCAGGGGG + Intergenic
1176253633 20:64139362-64139384 GCTGGGGTAGGGAGCCCAGGGGG + Intergenic
1178499159 21:33111226-33111248 GGCAGAGTAAGGGGCCCAGGTGG + Intergenic
1179358314 21:40682648-40682670 GGAAGGGAAGGGAGCGGAGGGGG + Intronic
1180644481 22:17327247-17327269 GGGAGGATCTTGAGCCCAGGAGG + Intergenic
1180965808 22:19787427-19787449 GGAAGGGTGTGGGATCCAGGTGG - Exonic
1181160343 22:20956521-20956543 GGGGCGCTATGGAGCCCAGGCGG + Intergenic
1181419092 22:22785607-22785629 GCAGGGGTGTGGAGGCCAGGGGG - Intronic
1181521122 22:23449325-23449347 GGAAGGGCATGGAGGCCACAGGG - Intergenic
1182505517 22:30779591-30779613 GGAAGGGAAGGGAGGCCAAGTGG - Intronic
1182782623 22:32880367-32880389 GGAAGGGGAAGAAGCCAAGGAGG + Intronic
1183520692 22:38294611-38294633 AGAAGGGGAGGGAGGCCAGGTGG + Intronic
1184057100 22:42059984-42060006 TGATGGGCATGGAGCTCAGGAGG + Exonic
1184108132 22:42380364-42380386 GGACGGGTATGGAGGCTGGGAGG + Intergenic
1184451574 22:44585849-44585871 GGAAGGGAGAGGAGCCGAGGGGG - Intergenic
1184498623 22:44858689-44858711 GGAAGGCTATGGAGCTCCAGTGG + Intronic
1184500208 22:44866953-44866975 GGAAGGCTATGGAGCTCCAGTGG - Intergenic
1185068522 22:48643842-48643864 GGAAGGGTCTGGGGTCAAGGTGG + Intronic
949813692 3:8035857-8035879 GATAGGGTGTGGGGCCCAGGAGG + Intergenic
949879426 3:8649848-8649870 GGAAGGGTGTTGAGCAGAGGAGG - Intronic
950297523 3:11845015-11845037 GGAAGGGTAGGGAGCCGTGTTGG + Intronic
950455675 3:13091521-13091543 GGGAGGGCAGGGAGGCCAGGAGG - Intergenic
950579168 3:13851445-13851467 TGAAGGATAAGGAGTCCAGGTGG - Intronic
951519742 3:23600226-23600248 GGAAGGGTCTGGAACCCAGGGGG - Intergenic
951522417 3:23621867-23621889 GGAAGGGGATGGAGCGTAGCTGG - Intergenic
951530953 3:23697685-23697707 GGAGGGGTATGGAGCTGAGCGGG + Intergenic
953032744 3:39188821-39188843 GGGAGGGGCGGGAGCCCAGGCGG + Exonic
953475236 3:43200387-43200409 GGAAGAGTATGGCCACCAGGAGG - Intergenic
954370107 3:50165824-50165846 GTCAGGGACTGGAGCCCAGGAGG - Intronic
954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG + Intergenic
955446486 3:59016388-59016410 GGAAGGGTATGGGGAGCAGTTGG + Intronic
956261742 3:67350744-67350766 GGAAGGGCAGGTGGCCCAGGGGG - Intergenic
956460224 3:69464260-69464282 GGAAGGGTATGTTGGCCAGGAGG + Intronic
956780426 3:72599071-72599093 GGGTGGGTAAGGAGACCAGGGGG + Intergenic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
961434132 3:126904909-126904931 GGAAGGGTGGGGTGCCCTGGTGG + Intronic
961503990 3:127358119-127358141 GGAGGGGGCTGGTGCCCAGGTGG - Intergenic
961811901 3:129526898-129526920 GTAGGGGGCTGGAGCCCAGGTGG + Intergenic
962110756 3:132444108-132444130 GGAGGTGGATGGAGCTCAGGCGG - Intronic
962960539 3:140307340-140307362 GGAAGGGCAAGGAGAGCAGGAGG - Intronic
964205507 3:154170544-154170566 AGAAGGGAATGGAATCCAGGTGG - Intronic
964424519 3:156537013-156537035 GGAAGAATATGGGGGCCAGGGGG + Exonic
966081294 3:176004989-176005011 TGAAGGGCATGGAGTCCAGGTGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967818326 3:193817330-193817352 GGTAGAATGTGGAGCCCAGGAGG + Intergenic
968524635 4:1049724-1049746 GGCAGGAGATGCAGCCCAGGAGG + Intergenic
968736786 4:2301481-2301503 GGAAAGGGAAGGAGCCCAGGTGG - Intronic
972410041 4:38784366-38784388 GACAGGGTGTGGAGCTCAGGTGG - Intergenic
977717824 4:100202581-100202603 GGAAGAAGATCGAGCCCAGGAGG + Intergenic
978747739 4:112212865-112212887 GACAGGGGATGGAGCTCAGGTGG + Intergenic
979087483 4:116430918-116430940 TGATGGGGATGGAGGCCAGGTGG - Intergenic
979349933 4:119631429-119631451 GCAAGAGGATTGAGCCCAGGAGG + Intergenic
982814778 4:159871252-159871274 GAGAGGGTATGGAGAGCAGGAGG + Intergenic
985658267 5:1143099-1143121 GGAGGGGCATGTTGCCCAGGAGG - Intergenic
986690228 5:10307850-10307872 GGAAGGGAAGGAAGGCCAGGAGG + Exonic
986830934 5:11577454-11577476 GGAAGGGTGTGGGGACAAGGAGG + Intronic
988273705 5:29053025-29053047 GGAAAGGCATGGAGCAAAGGTGG - Intergenic
990802362 5:59619263-59619285 GGAAGGGAATGGAGGCAAGGAGG + Intronic
990813573 5:59756648-59756670 GGAAGGGTATGGATCCCCCTGGG + Intronic
992152084 5:73914813-73914835 GGAGGTGGATGGAGCCCAGGAGG - Intronic
995535639 5:113133283-113133305 GGAAGGGTAGGGAGGAGAGGGGG - Intronic
997200711 5:132008545-132008567 GGAAGAGAGTGGAGTCCAGGAGG - Intronic
997518340 5:134506369-134506391 GCCAGGGTGTGGGGCCCAGGAGG + Intergenic
997781819 5:136667228-136667250 GGGAGGGTGTGGGGCCCAGCAGG - Intergenic
997850961 5:137332178-137332200 GGAAGGGTGGGGATCCCAGGAGG - Intronic
998136987 5:139679075-139679097 TCAAGGGAATGGAGCCCAGCAGG - Intronic
999296990 5:150465919-150465941 GGTAGAGGAGGGAGCCCAGGTGG + Intergenic
999342519 5:150784360-150784382 GGAAGCATATGGAGTCCTGGTGG - Intronic
999814655 5:155163725-155163747 GGAAGGGGGTGGAGCCAAGATGG - Intergenic
999817015 5:155187249-155187271 GGAAGGGTAAGGAGGGCAGGTGG - Intergenic
1000197390 5:158972819-158972841 GGAAGGCTATGGAGGCCAGTGGG - Intronic
1001226269 5:169946967-169946989 GGAATGGAATGAAGGCCAGGGGG + Intronic
1001520304 5:172386717-172386739 GGGAGGATCTCGAGCCCAGGAGG - Intronic
1001614551 5:173032060-173032082 GGAAGGAACTTGAGCCCAGGAGG + Intronic
1001938908 5:175727288-175727310 TGTATGGGATGGAGCCCAGGTGG + Intergenic
1002607055 5:180389736-180389758 GGACGGCTGTGCAGCCCAGGAGG + Intergenic
1002879552 6:1238760-1238782 GGGAGGAGATGGTGCCCAGGGGG - Intergenic
1003088627 6:3082148-3082170 GGAAGGGGAAGCAGCCCTGGGGG + Intronic
1003264410 6:4552746-4552768 GGTAGGGTGTGGAGCCGTGGTGG - Intergenic
1003322855 6:5067622-5067644 GGAAGGGTGTGAACACCAGGAGG + Intergenic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1003719987 6:8691620-8691642 GAAAGGAGATGGAGCTCAGGTGG + Intergenic
1004127771 6:12890078-12890100 GGTAGGAGATGGAGCTCAGGCGG - Intronic
1004443565 6:15676486-15676508 GGAAGGATATGGGGCACAGAAGG - Intergenic
1004727823 6:18327680-18327702 GGGAGAGTGGGGAGCCCAGGGGG + Intergenic
1006010753 6:31041114-31041136 GGAAGGGCCGGGAGCCCAGGTGG - Intergenic
1006379055 6:33687360-33687382 GGCGGGGTATGGTGGCCAGGGGG - Intronic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1006898370 6:37484736-37484758 GGAAGGGTCAGAAGCCCAAGGGG - Intronic
1007111384 6:39315100-39315122 GCAAGGCTGTGGAGCCAAGGCGG - Exonic
1007210000 6:40185759-40185781 AGAAGGGGCTGGAGCCCAGGAGG + Intergenic
1009631250 6:66203327-66203349 GGTAGGGAATGGCGCCCAGCAGG - Intergenic
1011141412 6:84161520-84161542 GGCAGGGTTTGGACCCCATGGGG + Intronic
1012450695 6:99349959-99349981 GGGAGGGGCTGGAGCGCAGGCGG - Intronic
1012647225 6:101700839-101700861 GGACTGGTATAGAGCCCAGGGGG + Intronic
1013215448 6:108023455-108023477 GGGAGGATCTTGAGCCCAGGAGG - Intergenic
1013418770 6:109947665-109947687 GGAATGGCATGGAGGGCAGGGGG - Intergenic
1013443019 6:110190746-110190768 GGAAGGGGTGGGAGCCCAGTGGG + Intronic
1013545389 6:111151890-111151912 GGAGGGGTATCCAGCCCAGATGG - Intronic
1014093608 6:117434656-117434678 GGAAGGGTACGGAGAACAGAGGG - Intronic
1015811013 6:137162313-137162335 GGAAGGGTATGGGGCATAGCAGG - Intronic
1015843341 6:137495243-137495265 GGAAGGAAAAGGAGCCAAGGAGG + Intergenic
1017184611 6:151588436-151588458 GGGAAGGTAGGGAGCCCAGTTGG + Intronic
1017442284 6:154475326-154475348 GGGAGGGAAGGGCGCCCAGGGGG - Intronic
1018117724 6:160604235-160604257 GCAAGGTGATGGAGCCCAGATGG - Intronic
1018754549 6:166837697-166837719 TGAAGGGTGGGGAGCCCGGGAGG - Intronic
1019590217 7:1827153-1827175 GGAAGGGCATGGAGGCCACAGGG + Intronic
1019684548 7:2373802-2373824 GGCATGGGATGGAGCCCATGCGG - Intronic
1019881259 7:3863245-3863267 GGAGAGGTAAGGAACCCAGGAGG - Intronic
1022716599 7:32904287-32904309 GGAGGATCATGGAGCCCAGGAGG + Intergenic
1023435669 7:40138120-40138142 GGAAGGGGATGGACTACAGGAGG - Intronic
1023842688 7:44105968-44105990 GGAAGGATAGGGAGTCCTGGGGG - Intronic
1023915506 7:44585678-44585700 GGAAATGGCTGGAGCCCAGGAGG + Intergenic
1023938895 7:44757744-44757766 GAAAGGGTATGGTGCCCACATGG + Intronic
1025026981 7:55524745-55524767 TGATGGGAATGGAGACCAGGAGG + Intronic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1026955652 7:74374979-74375001 GGAAGGATATCCAGCCCAAGGGG - Intronic
1029514694 7:101017874-101017896 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514715 7:101017915-101017937 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514736 7:101017956-101017978 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514757 7:101017997-101018019 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514778 7:101018038-101018060 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514843 7:101018162-101018184 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514864 7:101018203-101018225 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG + Intronic
1030735023 7:113037774-113037796 TTAGGGGAATGGAGCCCAGGAGG + Intergenic
1031275973 7:119724197-119724219 GGCAGGTGAAGGAGCCCAGGTGG + Intergenic
1032479499 7:132235150-132235172 GGAAGGGGAGGGGGACCAGGAGG + Intronic
1032705029 7:134414190-134414212 GGCAGGAAATGGAGCCCTGGGGG + Intergenic
1034266301 7:149782698-149782720 GCAGGGGTAGGGAGCTCAGGTGG + Intergenic
1034446396 7:151116179-151116201 TGAAGGGAAGGGAGCCCAGGAGG + Intronic
1034464413 7:151218064-151218086 GGAGAGGTATGGTGCCAAGGTGG - Exonic
1034633243 7:152547194-152547216 AGAAGTGGATGGAGCTCAGGTGG + Intergenic
1035465289 7:159071301-159071323 GGAAGGTTCTGGAGTCCAGAGGG - Intronic
1035573297 8:688124-688146 GGGAGGGTCTGCAACCCAGGCGG + Intronic
1035684975 8:1517331-1517353 GAACGGATGTGGAGCCCAGGAGG + Intronic
1036695766 8:10974142-10974164 GGAAGAGTAAGTACCCCAGGAGG + Intronic
1038745891 8:30254398-30254420 GGAGGTGGATGGAGCTCAGGCGG + Intergenic
1039009420 8:33076171-33076193 GGAAGGGAAGTGAGCCCAGTGGG - Intergenic
1039572572 8:38599506-38599528 GGAAGGGTAAGCAGCCCAACAGG - Intergenic
1045122966 8:99058719-99058741 GAAAAGTTATGGAGCCCAGATGG + Intronic
1046132084 8:109977837-109977859 GGAAGGGCACAGAGCACAGGTGG - Intergenic
1046216384 8:111152804-111152826 GAATGTGCATGGAGCCCAGGTGG - Intergenic
1047028322 8:120848994-120849016 AGAAGAGAATGCAGCCCAGGAGG - Intergenic
1048115569 8:131517983-131518005 AGAAGGGCATGGATACCAGGAGG + Intergenic
1048192571 8:132303073-132303095 GGAAAGGGAAGGAGCCCAAGAGG + Intronic
1049217902 8:141416069-141416091 GCAAGGGGGTGGAGCCCGGGTGG + Intronic
1049306798 8:141908257-141908279 GGAAGGGAAGGGAGACGAGGTGG + Intergenic
1049307451 8:141912337-141912359 GAAAGGTCAGGGAGCCCAGGTGG + Intergenic
1049358262 8:142199363-142199385 GGAAGTGTGGGCAGCCCAGGGGG - Intergenic
1049480691 8:142821075-142821097 GGCAGGGTTTACAGCCCAGGTGG + Intergenic
1051007527 9:12365252-12365274 GGAAAGGTAAGGAACACAGGAGG - Intergenic
1053287544 9:36859589-36859611 GGAAGGGTGAGGAGCCGGGGAGG - Intronic
1055532912 9:77204714-77204736 GGGAGGATCTTGAGCCCAGGAGG - Intronic
1057007018 9:91569231-91569253 TCAAGGGCATGGAGCCCAGGGGG - Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1058861722 9:109123002-109123024 GGAAGGGTTTTGAACCCATGTGG - Intergenic
1059256477 9:112935736-112935758 GGAAGGGAATTGAGCGCAGCTGG - Intergenic
1061521383 9:131120328-131120350 GGAAGGCTGGGGAGTCCAGGCGG - Exonic
1062033672 9:134373188-134373210 GGAAGTGTCTGGGGCCCGGGTGG + Intronic
1062261792 9:135666595-135666617 GGAAGGGAAGGGGGCCCTGGGGG - Intergenic
1062446558 9:136597714-136597736 GGAAGGGTGGAGGGCCCAGGTGG + Intergenic
1185581210 X:1212915-1212937 GGAAGGGAATGGAGGGGAGGGGG - Intergenic
1185647960 X:1628526-1628548 GGAAGGGTATGAAGGACAAGGGG + Intronic
1186248479 X:7640281-7640303 GGAAGGGTTTGGAGCGGAGAGGG - Intergenic
1186454150 X:9698105-9698127 CGCCGAGTATGGAGCCCAGGAGG + Intronic
1187930410 X:24288531-24288553 CAAAGGGTGTGGATCCCAGGAGG + Intergenic
1189248375 X:39580921-39580943 GGAAGGGCATGGAGGCAAGGTGG - Intergenic
1191739605 X:64422896-64422918 GAAAGGGAAAGGAGCCCAGGTGG + Intergenic
1191955664 X:66640018-66640040 GGAAGGGTTTGGGGGCCAGTAGG + Intergenic
1192177333 X:68894308-68894330 GGGAGGGGAGGGAGCCCAGCAGG + Intergenic
1195254298 X:103078216-103078238 GGAAGGATCTTGAGCCCAGGAGG - Intronic
1195277332 X:103294497-103294519 GGTAGGATCTTGAGCCCAGGAGG - Intergenic
1196325661 X:114399273-114399295 GGAAGATCATTGAGCCCAGGAGG + Intergenic
1198502139 X:137260758-137260780 CGAAGGGTATGAATACCAGGAGG + Intergenic