ID: 1105219468

View in Genome Browser
Species Human (GRCh38)
Location 13:18312329-18312351
Sequence CCTTCTTTGCAGGAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 7, 1: 1, 2: 3, 3: 28, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105219468_1105219476 -6 Left 1105219468 13:18312329-18312351 CCATCCATCTCCTGCAAAGAAGG 0: 7
1: 1
2: 3
3: 28
4: 257
Right 1105219476 13:18312346-18312368 AGAAGGCTGGAGGCAGGTCAGGG 0: 7
1: 0
2: 5
3: 64
4: 552
1105219468_1105219475 -7 Left 1105219468 13:18312329-18312351 CCATCCATCTCCTGCAAAGAAGG 0: 7
1: 1
2: 3
3: 28
4: 257
Right 1105219475 13:18312345-18312367 AAGAAGGCTGGAGGCAGGTCAGG 0: 7
1: 0
2: 5
3: 37
4: 460
1105219468_1105219477 13 Left 1105219468 13:18312329-18312351 CCATCCATCTCCTGCAAAGAAGG 0: 7
1: 1
2: 3
3: 28
4: 257
Right 1105219477 13:18312365-18312387 AGGGTACACCAGCATCTTCAAGG 0: 3
1: 1
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105219468 Original CRISPR CCTTCTTTGCAGGAGATGGA TGG (reversed) Intergenic
902154193 1:14470663-14470685 CTTTGTTTGCAGGAAAAGGAAGG + Intergenic
903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG + Intronic
904310017 1:29622815-29622837 ACTTCTTTGGAGGAGGAGGAGGG + Intergenic
905122181 1:35690817-35690839 CCTTGATAGCAGGAGATAGAGGG - Intergenic
905259317 1:36706360-36706382 ACTTCTTCCCAGGAGATGGCAGG + Intergenic
905495920 1:38386032-38386054 TCTACTTTGTAGGAGATAGAGGG + Intergenic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
907059736 1:51409346-51409368 CCTTCTTTAGAGGAAATAGAAGG - Intronic
907316140 1:53574013-53574035 CTATCTTTGCAGGAGCTGGCTGG - Intronic
907334124 1:53689348-53689370 GCTTCTTGCCAGGAGAAGGAGGG - Intronic
907583568 1:55593927-55593949 CCTAATTTGAAGGAGATGGAAGG - Intergenic
908113508 1:60919793-60919815 CCTTCTTGAAAGGAGGTGGAAGG + Intronic
908903171 1:68979486-68979508 CTTTCTTTGCTGGGGAGGGAAGG + Intergenic
909462883 1:75939303-75939325 CTTTTTTTCTAGGAGATGGAAGG - Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
915224474 1:154402459-154402481 CCCCCTTTACAGGAGACGGAGGG + Intergenic
915919934 1:159968565-159968587 CCTTCTTTGTAGGGGAGAGAGGG + Intergenic
915945123 1:160144162-160144184 GCTTGTGTGCTGGAGATGGAGGG + Intergenic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
916653045 1:166848694-166848716 CCTTCTTTGCAGATGAAGAAGGG - Intronic
917932671 1:179834137-179834159 CCTTGTTTCCAGAAAATGGAAGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
920813751 1:209311447-209311469 CATACTTTGCAGGGCATGGATGG + Intergenic
920934459 1:210418219-210418241 CCTTCTTTGCTGGTGGTGGCTGG + Exonic
923017208 1:230136151-230136173 CCATCTTCTCAGGAGTTGGAGGG + Intronic
924061672 1:240181494-240181516 CCTTCTTTGTATGAATTGGAAGG + Intronic
924280145 1:242428980-242429002 CCATCTTTAGAGGAGATGGACGG - Intronic
1063287768 10:4709071-4709093 CTTTCTCTGCAGGACATGGCAGG + Intergenic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1063484865 10:6410441-6410463 CCTTCTTGGGAGGAAATGTAGGG + Intergenic
1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG + Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1069026938 10:63552623-63552645 CCTTCTTTTCAGTTGATAGATGG + Intronic
1069855270 10:71436953-71436975 GCTTCTTTGCAGGATATGATAGG + Intronic
1073475204 10:103748046-103748068 CCATCCTTGCAGGAGATGGGTGG - Intronic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1074875937 10:117613468-117613490 CCTTCTCTGCCAGGGATGGATGG - Intergenic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076251624 10:128988686-128988708 CCTTCCTGTCAGGAGATGTAAGG + Intergenic
1076498553 10:130915933-130915955 GCTTGTTTGCAGGAGATGAGGGG + Intergenic
1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG + Intronic
1077528793 11:3085517-3085539 GCAACTTTGCAGGAGGTGGAAGG - Intergenic
1078442621 11:11379771-11379793 CCATCTTTCCAGGAAGTGGATGG + Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079842191 11:25417385-25417407 CCTTCTTGGCAGAAGAAGCATGG + Intergenic
1080480825 11:32648046-32648068 CCTACTTTGCAGAAGATTGGAGG - Intronic
1080607652 11:33877030-33877052 CTTTCTTTGCTGGACATAGATGG + Intronic
1082863164 11:57874275-57874297 CCTTCTTTGCTGAACATTGAGGG + Intergenic
1084034955 11:66504020-66504042 CCTTATTTGTAGGAGAGGAATGG + Intronic
1084230875 11:67751746-67751768 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1084752330 11:71212611-71212633 CCATCTTTGGCCGAGATGGAAGG + Intronic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085766540 11:79288064-79288086 TCTTCCTTGAAGGAGAAGGATGG + Intronic
1086055218 11:82638738-82638760 ACATCTTTGGAGGAGGTGGAGGG + Intergenic
1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG + Intergenic
1089092862 11:115892755-115892777 CCCACTTTGCTGGAGATGAATGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1090628966 11:128629587-128629609 CCTGTTTTACAGGATATGGAGGG - Intergenic
1092203196 12:6600002-6600024 CCTTTACTGCAGGAGAAGGAAGG - Exonic
1093089413 12:14904642-14904664 CCGTCTTTGCAGAAGATAAAGGG + Intronic
1093415775 12:18918975-18918997 CGTTCTTTGCAGGGCATGGCTGG + Intergenic
1094713218 12:32986124-32986146 ACTTGTTTGCAGGCGATGCAGGG - Intergenic
1099435669 12:82642466-82642488 ATGTCTTTGCAGGACATGGATGG + Intergenic
1099986043 12:89665709-89665731 CCTTCTGTTCAGGAGCTAGAAGG + Intronic
1100286867 12:93174955-93174977 CCTTATTTCCAGGAGAAGGTGGG - Intergenic
1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG + Intronic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1102918856 12:116776728-116776750 CCTGCTTTGGAGGAGACAGATGG + Intronic
1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG + Intronic
1103928102 12:124434737-124434759 CCTTCCTCGCAGGAGACAGAGGG + Intronic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106989871 13:35406020-35406042 CTTTTTTTTCTGGAGATGGAGGG - Intronic
1107414508 13:40188387-40188409 CCTTCTTGGTAGGAGAAGGCAGG - Intergenic
1107456511 13:40560425-40560447 CCATCTTTGCGGCAGATGGCGGG + Exonic
1108266140 13:48710901-48710923 CCTTTTTTTCAGGAAATGAAGGG + Exonic
1108371042 13:49768923-49768945 CCTTATTTGCATGAAATGTAAGG - Intronic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG + Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109196669 13:59385209-59385231 CCATCTTTGCAGGGGAGGAATGG + Intergenic
1109285368 13:60402250-60402272 CCTTTTTTCCAGGAGATTGCTGG + Intronic
1110155625 13:72313355-72313377 CTTTCTTTTGGGGAGATGGAAGG - Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1112819146 13:103310651-103310673 CTTTCTTGGACGGAGATGGATGG + Intergenic
1113886151 13:113659267-113659289 CCATCTCTGCAGGAGGTTGATGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1120407781 14:84110388-84110410 ACTTCTTTGCAAGATATTGATGG + Intergenic
1121442098 14:93955846-93955868 CCTTCTCTGCAGGACACGGCTGG - Intronic
1121629733 14:95413500-95413522 CCTGCCTTGCAGGGGATGGGAGG - Intronic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1124558654 15:30750387-30750409 TCTTCTTTCCTGCAGATGGATGG + Intronic
1124672597 15:31655243-31655265 TCTTCTTTCCTGCAGATGGATGG - Exonic
1125889204 15:43253171-43253193 CCAGCTTTGCAGGGGATGGGAGG - Intronic
1126231076 15:46325845-46325867 CCTTGTCTGCAGGATTTGGAAGG - Intergenic
1128058910 15:64721183-64721205 CGTTCTTTGTAGGAGAAAGAGGG - Intergenic
1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG + Intergenic
1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG + Intergenic
1129714831 15:77840936-77840958 CTTACTTTGCAGGTGAGGGAGGG - Intergenic
1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG + Intronic
1133255442 16:4513419-4513441 CCTTGTGTGCAGGAGAGGGGTGG - Intronic
1133468610 16:6052210-6052232 CCTACTATGAAGGAAATGGAAGG - Intronic
1139286877 16:65823165-65823187 ACGTTTTTGCAGGAGATTGAGGG - Intergenic
1140681727 16:77391878-77391900 CCTTCTTTCCATGATGTGGATGG - Intronic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1142721942 17:1782256-1782278 CCTTCTTTGCTGGGGTTGGTGGG + Intronic
1143434592 17:6914258-6914280 CCGGCTTTGCAGGACAGGGAAGG + Intronic
1147562031 17:41515189-41515211 CATTCTCTGCATGAGATAGATGG - Intronic
1149539600 17:57459019-57459041 CCCTCTTTGTAAGAGCTGGATGG + Intronic
1150331855 17:64300834-64300856 CCTTGCTTGCCAGAGATGGATGG - Intergenic
1151351342 17:73533798-73533820 ACTTCCTTGAAGGAGCTGGAGGG - Intronic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1153533041 18:6069092-6069114 CCATCTTTGATGGAGATGGCAGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153560303 18:6365708-6365730 GCATTTTTGCAGAAGATGGAAGG - Intronic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1155107378 18:22680850-22680872 CTTTCCTTGCAGGAGAAAGATGG + Intergenic
1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG + Intronic
1156503104 18:37572202-37572224 CCTCCTTTGTAGGAGGTGGGAGG - Intergenic
1158581889 18:58691108-58691130 TCTTCTCTGGAGGAGATGGCGGG - Intronic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160162320 18:76483164-76483186 CCTGCTTTGCTGGAGAAGGCAGG + Intronic
1161669701 19:5599325-5599347 CCTTTATTGCTGGAGATGAATGG - Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
925306938 2:2854490-2854512 CCTTGTAAGCAGGACATGGAAGG - Intergenic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
928259947 2:29757457-29757479 CCTTCCTTACAGGACATGAAAGG - Intronic
929967374 2:46545201-46545223 CCTTCATTGGAGGATGTGGAGGG + Intronic
930623980 2:53675894-53675916 CCTGCATTGCAGGGCATGGAGGG + Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931593856 2:63918210-63918232 ACTTCTTTGGAGGATATTGATGG - Intronic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935317332 2:101848652-101848674 CCCTTTTTGCAGGTGAGGGAGGG + Intronic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
939991463 2:148879940-148879962 ATTTCTTGGCAGTAGATGGATGG + Intronic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
941959022 2:171235524-171235546 GCTTCTGTGCAGGAGATAGGAGG + Intergenic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG + Intergenic
1168861185 20:1047127-1047149 CGTTCTTTGGATGAGATGGTTGG + Intergenic
1169933318 20:10857175-10857197 CCTTCTCTTCAGGAGATTGAAGG - Intergenic
1170916111 20:20627656-20627678 CTTTCTGTGCAGCAGAGGGAGGG + Intronic
1171296860 20:24024731-24024753 CCTTCTTTCCAGGATGTGAAGGG + Intergenic
1173628862 20:44494678-44494700 CCTCCTCTGCAGGTGAGGGAGGG + Intergenic
1175521124 20:59603636-59603658 CCCCCTTTGCAGGTGCTGGAAGG - Intronic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1178428827 21:32501465-32501487 CCTTCTTTGAAGCAGAAAGATGG + Exonic
1179410128 21:41156120-41156142 GGCTCTTTGCAGGATATGGATGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG + Intronic
952625703 3:35400296-35400318 CCTGATTTGCAGCATATGGAAGG + Intergenic
953351135 3:42217049-42217071 CCTTCTTGGCAGGAAATAGGGGG - Intronic
953352696 3:42227825-42227847 CCTTCCTTACAGTAGAAGGAAGG + Intergenic
953541335 3:43821213-43821235 CCTTCATTCCCTGAGATGGATGG + Intergenic
953791477 3:45951102-45951124 TCTTCTTTGCAGGAGACGACTGG + Intronic
954196622 3:49000936-49000958 CCATCTTTGCAGGAAATTGGAGG + Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
956802415 3:72772275-72772297 TCTACTTGGCAGGAGAGGGAGGG + Intronic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
961879505 3:130050925-130050947 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
962613658 3:137103220-137103242 CCTTCTTTGTGTGATATGGAAGG + Intergenic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
963067607 3:141275663-141275685 CTTTCTTTCCAGTAGTTGGAAGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964719961 3:159761585-159761607 GGTTCCTGGCAGGAGATGGAAGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967965614 3:194957861-194957883 CTGTCTTTGCAGTTGATGGAAGG + Intergenic
968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG + Exonic
968991717 4:3917829-3917851 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG + Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972557300 4:40193996-40194018 CCTTCTACTTAGGAGATGGAGGG + Intronic
972981689 4:44712092-44712114 TCTTATTTGAAGGAAATGGAAGG + Intronic
973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG + Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
977545054 4:98367312-98367334 CCTACATTGCAGGAAATGTATGG + Intronic
983177635 4:164610199-164610221 CTTTCTTTTCATAAGATGGAGGG + Intergenic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983502316 4:168513194-168513216 CCTTCTTTGCATCACATTGAAGG - Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
989268703 5:39506703-39506725 GCTTCTATGCAGCTGATGGAGGG - Intergenic
990970922 5:61505362-61505384 CCTCCTTTTCAAGAGAGGGAAGG - Intronic
991564766 5:67993416-67993438 TCTTCTGAGCTGGAGATGGATGG + Intergenic
992972129 5:82072090-82072112 ACTTCTTTGCAGTTGATGGATGG + Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993267489 5:85744625-85744647 CCTTCCTTGAAGCAGAAGGAAGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996062849 5:119051070-119051092 CCTTTTCTTCAGGTGATGGAAGG + Intronic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
1000050233 5:157556617-157556639 CCTTCATTGCAGGGTGTGGAAGG - Intronic
1000710232 5:164565715-164565737 GCTTCTTTCCAGGAGAGTGAGGG - Intergenic
1001024673 5:168214076-168214098 GCTTTTTTGCAGGGGCTGGAGGG - Intronic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1001363785 5:171116315-171116337 CCCTCTTTGTAGAAGATGGGAGG - Intronic
1001737849 5:174021523-174021545 CTTTCTTTGGTGGAGATGTATGG + Intergenic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1003133653 6:3416737-3416759 ACTTCTTTGCAGCAGAAGCAGGG - Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1013056473 6:106588010-106588032 GCTGCTTTGATGGAGATGGAAGG + Intronic
1013365358 6:109433578-109433600 CCTTCTTTGGAGCAGAGAGAGGG + Intronic
1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG + Intergenic
1015182604 6:130377339-130377361 CCTTGTTACCTGGAGATGGATGG - Intronic
1018488185 6:164263668-164263690 CCTTTTTGGGAGGAGAAGGAAGG + Intergenic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG + Intergenic
1019782146 7:2947541-2947563 ACCTCTTTGCGGGAGAGGGAGGG - Intronic
1020314523 7:6895611-6895633 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1022258925 7:28685474-28685496 CCTTTTTTCCTGGAGCTGGATGG - Intronic
1023314526 7:38921610-38921632 CCTTCTTTGCAAGATTTGGATGG + Intronic
1023579849 7:41670168-41670190 CCTTCACTGCATGAGATGTAAGG - Intergenic
1023650518 7:42364371-42364393 CCTTCATTTCAGAAGATGTAGGG - Intergenic
1025155940 7:56606003-56606025 CCTTCCTTGCATGAGGTGGGGGG - Intergenic
1030495758 7:110297893-110297915 CCTGCTTTGGGGGAGATGGATGG - Intergenic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1034014218 7:147564954-147564976 CATTCTTTCCAGGAAAAGGAAGG - Intronic
1035052258 7:156005632-156005654 CTCTCTTTGCAGCAGAAGGAGGG + Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1036496870 8:9277696-9277718 CCTTCTCTTCAGAATATGGAGGG + Intergenic
1039104335 8:33973932-33973954 GCTTCTTTGAAGAAGAAGGAAGG - Intergenic
1039669551 8:39581026-39581048 CCATCTTAGCAAGAGACGGATGG - Intergenic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1044668359 8:94653854-94653876 CCTTGTTAGCTGGAGGTGGAAGG + Intronic
1044738803 8:95304769-95304791 CCTTCTCTTCAGGATTTGGAAGG - Intergenic
1044931132 8:97252707-97252729 TCTTCTAAGCAGGAGAAGGATGG - Intergenic
1050567850 9:6905245-6905267 CCGTCTTGGCAGGAGATTGAGGG + Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051405389 9:16732143-16732165 TTTTTTTTGCAGGAAATGGAGGG - Intronic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1052081319 9:24209619-24209641 CTCTCTTTGAAGGATATGGATGG + Intergenic
1052782558 9:32795998-32796020 CCTACATTTCAGGAGATGTATGG - Intergenic
1052891262 9:33702339-33702361 CCGTCTAGGAAGGAGATGGATGG + Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1058327903 9:103721147-103721169 CTTTCTTTGAATAAGATGGAGGG - Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1058678298 9:107420115-107420137 CCTTCTTTGAAGGTGAGGGCTGG - Intergenic
1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG + Intronic
1059427490 9:114230333-114230355 CCTTCCTTGCAGAGGAAGGAAGG + Intronic
1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG + Exonic
1059666191 9:116448425-116448447 CCCTCACTGCAGGAGATGGGAGG - Intronic
1059901285 9:118928939-118928961 GCTGCTTTGCAGGAGAAAGAAGG + Intergenic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1060940341 9:127539797-127539819 CCCTGTTTGCAGGTGATGGGGGG - Intronic
1061573944 9:131494689-131494711 CCTTCTCTGCAGGACAAGGAAGG - Intronic
1061996716 9:134189898-134189920 CCTGCTTTGCACCAGATGGAAGG - Intergenic
1062092847 9:134687594-134687616 CCTTCTGTGCATCAGATGGTCGG + Intronic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1186551689 X:10512641-10512663 CCATCTTTGCAGGTGTTGGAAGG - Intronic
1187115765 X:16348856-16348878 GCTTCTTTGCATCAGAAGGAAGG - Intergenic
1187279938 X:17850494-17850516 GCTTCTTTGGAGGAGTTTGAGGG - Intronic
1190034220 X:47005610-47005632 CCATCTTTGCTGGAGAAGGTTGG - Intronic
1192005571 X:67208448-67208470 CCTTCCTTGTGGGTGATGGATGG + Intergenic
1192005728 X:67210031-67210053 CCATCTTTGAAGGAATTGGAAGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1194936870 X:99960819-99960841 CCTTCTTTGGAGGGGGTTGAAGG - Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1195996532 X:110737265-110737287 CCTTCTTGAGAGGAGAAGGAGGG + Intronic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic
1199829787 X:151538184-151538206 CCTTCTTTTTTGGGGATGGACGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic
1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202224298 Y:22585515-22585537 CTTTCCTTGCTGGAGATGGAGGG - Intergenic
1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202551952 Y:26059912-26059934 CTTTCCTTGCTGGAGATGGAGGG - Intergenic