ID: 1105219475

View in Genome Browser
Species Human (GRCh38)
Location 13:18312345-18312367
Sequence AAGAAGGCTGGAGGCAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 7, 1: 0, 2: 5, 3: 37, 4: 460}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105219467_1105219475 -6 Left 1105219467 13:18312328-18312350 CCCATCCATCTCCTGCAAAGAAG 0: 7
1: 1
2: 0
3: 20
4: 207
Right 1105219475 13:18312345-18312367 AAGAAGGCTGGAGGCAGGTCAGG 0: 7
1: 0
2: 5
3: 37
4: 460
1105219468_1105219475 -7 Left 1105219468 13:18312329-18312351 CCATCCATCTCCTGCAAAGAAGG 0: 7
1: 1
2: 3
3: 28
4: 257
Right 1105219475 13:18312345-18312367 AAGAAGGCTGGAGGCAGGTCAGG 0: 7
1: 0
2: 5
3: 37
4: 460
1105219464_1105219475 0 Left 1105219464 13:18312322-18312344 CCAACCCCCATCCATCTCCTGCA 0: 7
1: 1
2: 5
3: 58
4: 639
Right 1105219475 13:18312345-18312367 AAGAAGGCTGGAGGCAGGTCAGG 0: 7
1: 0
2: 5
3: 37
4: 460
1105219465_1105219475 -4 Left 1105219465 13:18312326-18312348 CCCCCATCCATCTCCTGCAAAGA 0: 7
1: 1
2: 1
3: 25
4: 269
Right 1105219475 13:18312345-18312367 AAGAAGGCTGGAGGCAGGTCAGG 0: 7
1: 0
2: 5
3: 37
4: 460
1105219466_1105219475 -5 Left 1105219466 13:18312327-18312349 CCCCATCCATCTCCTGCAAAGAA 0: 7
1: 1
2: 3
3: 35
4: 271
Right 1105219475 13:18312345-18312367 AAGAAGGCTGGAGGCAGGTCAGG 0: 7
1: 0
2: 5
3: 37
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105219475 Original CRISPR AAGAAGGCTGGAGGCAGGTC AGG Intergenic
900656472 1:3761204-3761226 GGGTGGGCTGGAGGCAGGTCAGG + Intronic
900679391 1:3908035-3908057 AAGAAGGATGGAGCCAGGCAGGG - Intergenic
901183222 1:7356028-7356050 CAGAAGGCTGGAGAGAGCTCAGG + Intronic
901194336 1:7432029-7432051 AAGAAGCCTGCAGTCAGTTCTGG + Intronic
901755852 1:11441061-11441083 CCGAATGCTGGAGGCAGGGCAGG + Intergenic
902398269 1:16144056-16144078 TGAAAGGCTGGAGGCAGGACAGG - Intronic
903366186 1:22806775-22806797 AAGGAGGTTGGAGGCAGTGCAGG - Intronic
903367928 1:22816387-22816409 AAGAAGGCAGGAGGCAGGACTGG - Intronic
903771354 1:25766450-25766472 AACAAGCCTGAAGGCAGGACAGG + Intronic
903776459 1:25797284-25797306 AATGTGGCTGCAGGCAGGTCAGG + Intergenic
903983080 1:27203959-27203981 CACAAGACTGGAGGCAGGGCAGG - Intergenic
904384426 1:30132181-30132203 TAGAAGGGAGGAGGCAGGGCAGG - Intergenic
904532684 1:31179941-31179963 GTGAGGGCTGGAGGCAGGGCTGG + Exonic
904569373 1:31450014-31450036 AAGAAGGTCAGAGGTAGGTCTGG + Intergenic
906107002 1:43300706-43300728 AAGGAGGCAGGAGGCAGGAAAGG - Intergenic
906112674 1:43334867-43334889 AAGTAGGCAGGGGCCAGGTCAGG + Intergenic
907155983 1:52334365-52334387 AAGCAGGCTGGAGGCCAGGCAGG + Intronic
907255285 1:53174175-53174197 AAGAAGGCAGGAGGAAAGTGAGG + Intergenic
907494641 1:54835795-54835817 AAGAGGGATGAAGGCAGGTCGGG + Intronic
908470177 1:64436564-64436586 AAGAAAGAAGGAGGCAGGTCAGG + Intergenic
908928483 1:69286648-69286670 AAGAAGGCAGCAGGCATTTCAGG - Intergenic
909627211 1:77731296-77731318 TAGAAGGCTGGAGGAAGTGCAGG - Intronic
909683419 1:78318885-78318907 GAGGTGGCTGGAGGCTGGTCAGG + Intronic
911868949 1:103066566-103066588 AAAAAGACTGGAGGCAGGAAAGG + Intronic
913044604 1:115062940-115062962 AAGAACGCTGAGGCCAGGTCCGG - Intronic
913069952 1:115289852-115289874 AAAAGGGCTGGATGGAGGTCAGG - Intronic
913215745 1:116618869-116618891 AAGAAGGCTAGAGGCAAGTCAGG + Intronic
915033870 1:152906430-152906452 CAGAGGGCGGGAGGCAGATCTGG + Intergenic
915287146 1:154860356-154860378 GAGAGGCCTGGAGGAAGGTCAGG - Intronic
915318821 1:155044816-155044838 AGGAAGTCTGGAGGGAGGGCGGG + Intronic
915479047 1:156172800-156172822 AAGGAGGAGGGAGGCAGATCAGG - Intronic
915878511 1:159640489-159640511 AAGAAGGCAGGAGGTAGGATGGG - Intergenic
916675834 1:167063759-167063781 GAGAAGGCATGAGGCAGGTGGGG + Intronic
918685038 1:187403787-187403809 AAGAAAGCTGAAGGAAGCTCTGG - Intergenic
920072083 1:203309179-203309201 ATAAAGACTGGAAGCAGGTCTGG - Exonic
920090855 1:203452007-203452029 AACTAGGGTGGAGGCAGGGCTGG - Intergenic
922322607 1:224501945-224501967 GAGGAGGCTGGAGGAAGGTAGGG + Intronic
922654818 1:227372822-227372844 AAGATGGTTGGAGCCAGGCCAGG - Intergenic
924009611 1:239650179-239650201 AAGAAGTGTGGAGGCAGGAAGGG - Intronic
924488700 1:244513569-244513591 AAGGTGGATGTAGGCAGGTCTGG + Intronic
924626862 1:245702711-245702733 ATGAAGGTTGGTGGCAAGTCTGG + Exonic
1063571179 10:7215749-7215771 AAGGAGGAGGGAAGCAGGTCAGG - Intronic
1065917440 10:30365299-30365321 AAGAAGGTTGGGGGCAGAGCAGG - Intronic
1066386864 10:34948530-34948552 AAGAAAGATGGAGGCAGAGCCGG + Intergenic
1067454997 10:46412922-46412944 AAGAAGGCTGGATGCTGGCTGGG - Intergenic
1067632207 10:47971712-47971734 AAGAAGGCTGGATGCTGGCTGGG + Intergenic
1067798146 10:49335601-49335623 GAGAAGGCTCTATGCAGGTCAGG - Intergenic
1067798151 10:49335643-49335665 GAGAAGGCTGTATGTAGGTCAGG - Intergenic
1070807124 10:79277165-79277187 AACAAGGCTGCAGGAAGGACAGG - Exonic
1073503665 10:103965994-103966016 AAGGGGGCTGGAGGCAGATCAGG + Intergenic
1074117952 10:110471778-110471800 AGGCAGACTGGAGGCAGGTTGGG + Intergenic
1074285291 10:112092082-112092104 AAGAATGTTGAAGGCAGATCAGG - Intergenic
1075521428 10:123146022-123146044 AAGAAAGCTGGGGGCAGGCAGGG - Intergenic
1077073223 11:687324-687346 AAGCAGGAGGGAGGCAGGGCTGG - Intronic
1077369366 11:2174369-2174391 CGGGAGGCTGGAGGCAGGGCAGG - Intergenic
1077468947 11:2747830-2747852 AGGCTGGCTGGAGGCAGGTGAGG + Intronic
1079100482 11:17538645-17538667 GAGAAGGCTGGAGGCATGAAAGG - Intronic
1079136423 11:17778315-17778337 AAGAAGCCTGGGAGGAGGTCTGG - Intronic
1081022244 11:37960537-37960559 GAGAAGGCTGAGGGCAGATCAGG + Intergenic
1081724976 11:45321723-45321745 AAGGAGGCAGGGGGCAGGTATGG - Intergenic
1081775153 11:45671390-45671412 AAGAAGGCTGGAGGCCCTTCTGG + Intergenic
1081824919 11:46040269-46040291 AGGAAGGATGGAGGCAGGGTGGG + Intronic
1081915425 11:46727480-46727502 CAAAAAGCAGGAGGCAGGTCAGG + Intronic
1082876309 11:57992463-57992485 AAGAAAGCTGGAGGGAAGTTCGG - Intergenic
1083141233 11:60723423-60723445 CAGAAGCCTGCAGGGAGGTCTGG - Intergenic
1083272099 11:61577770-61577792 CAGAGGGCTGGGGGCAGGGCAGG + Intronic
1083588606 11:63878657-63878679 AAGAAGACTTGAGCCAGGTGCGG - Intronic
1083653701 11:64219214-64219236 GAGGAGGCTGGAGGCTGGGCTGG - Intronic
1083942127 11:65901681-65901703 AAGAGGGCTGGGGCCAGGTGTGG + Intergenic
1084366548 11:68705014-68705036 GAGCAGGATGGAGGCAGGGCTGG + Intergenic
1085481128 11:76823834-76823856 AGGAAGGAAGGAGGCAGTTCCGG + Intergenic
1085794289 11:79523223-79523245 AATAAGGCTGGGGGGAGGGCGGG + Intergenic
1086329539 11:85739884-85739906 AAGAGGACTGGAGGCAAGTCTGG + Intronic
1086871834 11:92047058-92047080 AGGAAGGTGGGAGGCAGGTGAGG - Intergenic
1087475210 11:98625703-98625725 AAAAAGACTGGAGGAAGGTCAGG + Intergenic
1088667853 11:112111934-112111956 AAGAAGACTAAAGGTAGGTCGGG - Intronic
1089094138 11:115904529-115904551 AAGAAGGGTGGTGGCAGTTGGGG - Intergenic
1089640663 11:119845333-119845355 AAGAAGGCAAGAGGCAGGAGCGG + Intergenic
1090211121 11:124921563-124921585 TGGAAGGCTGCAGACAGGTCTGG + Intronic
1090357183 11:126147762-126147784 AAGAAGGCCAGAGGCAGGTAGGG - Intergenic
1090530248 11:127583416-127583438 AAGAAGGTAGGAGTCAGATCAGG - Intergenic
1090953473 11:131494856-131494878 AAGGTGGGTGGAGGCAGCTCTGG + Intronic
1093372539 12:18381988-18382010 CAGAAGGCTGGAGGCAGAGAAGG - Intronic
1095427302 12:42090364-42090386 AAGAGGTCTGGAGTCAGGTAAGG - Intronic
1095964822 12:47859593-47859615 AACAAGGCTTGATGCAGATCAGG - Intronic
1095996048 12:48085481-48085503 AAGAAGGCTGATGGCAAGCCTGG - Intronic
1096499139 12:52054875-52054897 AAGAAGGCTGGAGGCTGTGGGGG - Exonic
1097188989 12:57210569-57210591 AAGGAGGCTGGAGGCGAGGCAGG - Intronic
1097918154 12:65041835-65041857 AGGAAGGCTGAAGGAAGCTCTGG - Intergenic
1098206788 12:68119058-68119080 CAGCAGGCAAGAGGCAGGTCTGG - Intergenic
1098296590 12:69010537-69010559 AAGCAGGCAGGGGGTAGGTCAGG - Intergenic
1101062683 12:100988320-100988342 ATGATGGCTGGATGCAGGGCAGG + Intronic
1101674099 12:106902101-106902123 AAGAAAGCTGTGGGCAGGTATGG - Intergenic
1101722426 12:107361691-107361713 ATGTAGACTGGGGGCAGGTCAGG + Intronic
1101733301 12:107444132-107444154 AAGAAGGCTGGCGGAAGGTCAGG + Intronic
1102529062 12:113532765-113532787 AAGAGGGCTGGAGGCCCGGCTGG - Intergenic
1102688564 12:114742700-114742722 AAGAGAGATGGAGGCAGGTCTGG + Intergenic
1102814521 12:115853566-115853588 ATGAGGGCTAGAGGCAGGACAGG + Intergenic
1102887691 12:116534139-116534161 AGGAAGGGGGGAGGCAGGTGGGG - Intergenic
1102904591 12:116664813-116664835 TAGAAAGCTAGAGGCAGGTAGGG + Intergenic
1103137200 12:118517978-118518000 AGGGAGGCAGGAGCCAGGTCAGG - Intergenic
1103250722 12:119497666-119497688 AAGAAGGCTGGAGGCTCAGCAGG + Intronic
1103733679 12:123044940-123044962 AAGAAGACTGGAGCCAGGCATGG - Intronic
1104162112 12:126191193-126191215 AGAAAGGCTGGAGGCAGAGCCGG - Intergenic
1104322462 12:127764521-127764543 AAAAAGAATGGAGGAAGGTCTGG - Intergenic
1104488882 12:129176961-129176983 AAGACGGCTGGGGGCAGTCCTGG - Intronic
1104973082 12:132540321-132540343 GAGAGGGCTGGGGGCAGGACTGG - Intronic
1105049981 12:133040269-133040291 AAGAATGCTGAAGCCAGGTGTGG + Intronic
1105219475 13:18312345-18312367 AAGAAGGCTGGAGGCAGGTCAGG + Intergenic
1105929282 13:25037115-25037137 AGGAAGGCTGGAAGCAGGGAGGG - Intergenic
1106192605 13:27466756-27466778 AAGGAGGGTGGAGACAGGCCGGG + Intergenic
1106520827 13:30496278-30496300 ATGAAGCCTGGAGGGAGGACTGG - Intronic
1106854927 13:33841204-33841226 CAGAAGGCTGGAGGAAGGGGTGG - Intronic
1107150732 13:37107721-37107743 AAGCAGGCTGGAAGCATTTCAGG - Intergenic
1108042346 13:46350700-46350722 AGGAAGACTGAAGGCAGGTTAGG + Intronic
1108453871 13:50594482-50594504 GCGAAGGCTGGGGGTAGGTCAGG + Intronic
1108523493 13:51265220-51265242 AAGAAGGCTGCTGGGAAGTCGGG + Intronic
1108862550 13:54880147-54880169 AAGAAGAGTGGAGCCAGGTGCGG - Intergenic
1109342466 13:61078537-61078559 AAAAAGGGTGGAGGGAGATCAGG - Intergenic
1113024053 13:105921093-105921115 AAGAATCCTGGAGGCAAGTTAGG + Intergenic
1113795303 13:113053730-113053752 AAGGAGGCTCCAGGCAGGTGTGG - Intronic
1114492542 14:23112535-23112557 GAGAAGGCAGGAGGGAGGTGAGG + Intergenic
1115559592 14:34571011-34571033 GAGAAGGCTGGGGCCAGGTGCGG - Intronic
1117495181 14:56295363-56295385 AACAAGGATGGACGCAGTTCAGG - Intronic
1117746733 14:58877140-58877162 AAGAAGACTGGAGGAAGAGCTGG + Intergenic
1117774647 14:59170510-59170532 AACAATGCTGGAGCCAGGTGCGG - Intergenic
1117792007 14:59351061-59351083 GAGAAGGCTGGAGGTAGGGTGGG - Intronic
1118325423 14:64777307-64777329 AAGCAGGCAGGGGTCAGGTCAGG + Intronic
1118808259 14:69256220-69256242 GAGCAGGCTGGAGGCAAGGCAGG - Intergenic
1118869316 14:69727916-69727938 AGGAAGGATGGAGGAAGGGCAGG + Intronic
1119972398 14:78986025-78986047 ATGAAGGGTGGAAGCAGGACAGG - Intronic
1121449126 14:93996570-93996592 AAGGAGGCAGGAGCCAGGGCAGG - Intergenic
1121832736 14:97066017-97066039 AAGAAGGAAGGAGGCAGGGAGGG - Intergenic
1122045265 14:99018390-99018412 CAGAAGGCTGTAGGCTGCTCAGG + Intergenic
1122429304 14:101629859-101629881 GAGAAGGCGGGAGGAAAGTCAGG - Intergenic
1122543157 14:102508996-102509018 AAGAAGGCAGTAGGGAGGTTGGG - Intronic
1122856759 14:104563744-104563766 AAGAGGGCTGCAGACAGTTCTGG - Intronic
1122878463 14:104679390-104679412 GAGCTGGCTGGAGCCAGGTCAGG + Intergenic
1124725011 15:32148794-32148816 AAGGAGGCTCCAGGAAGGTCTGG - Intronic
1125449059 15:39788947-39788969 AAGAAGGCCTGAGGCATGACTGG - Intergenic
1126696325 15:51329178-51329200 GAGAAGGGAGGAGGCAGGCCAGG - Intronic
1126800538 15:52293667-52293689 ATGGAGGGTGGAGGCAGGTGAGG - Intronic
1126822243 15:52515754-52515776 AAGCAGGCTGGAAACAGGTTTGG + Intronic
1127772602 15:62243577-62243599 AAGAAGGGTGGGGGCGGGGCAGG - Intergenic
1127812201 15:62573907-62573929 ATGAAAGTTGGAGGCAGGTTGGG + Intronic
1128452483 15:67813755-67813777 TAGATGGCTGGAGGCAGGCAGGG - Intergenic
1128684060 15:69670883-69670905 ACAAAGTCTGGAGGCAGGGCAGG - Intergenic
1129182930 15:73888279-73888301 AAGCAGGCTGGGGAGAGGTCAGG + Intronic
1129184070 15:73894975-73894997 AAGGAGGCTGGTGGCAGGCACGG + Intergenic
1129233312 15:74208779-74208801 AGGTAGGCTGGAGCCAAGTCTGG - Intronic
1129706011 15:77795013-77795035 AAGAAGCCTGGTGGCAGGCCTGG - Intronic
1130882802 15:88069642-88069664 AACAGGGCTGGAGGCAGATGGGG + Intronic
1131826345 15:96324696-96324718 AGGAAGGCTGGACTCAGGGCAGG - Intergenic
1131960841 15:97788831-97788853 ATGCAGGCTGGAAGCACGTCAGG - Intergenic
1132113694 15:99120531-99120553 GAGAAGGCTGAGGGCAGGTGTGG - Intronic
1132141706 15:99402541-99402563 AAGAGGCCTGCAGGCAGGGCCGG + Intergenic
1132396539 15:101479165-101479187 GACAGGGCTGCAGGCAGGTCAGG + Intronic
1132507820 16:321100-321122 GAGGAGGCTGGAGGTAGATCTGG + Intronic
1132557053 16:577138-577160 AAGTAGGCCGGTGGCAGGTGCGG - Intronic
1132700169 16:1218872-1218894 AAGGAGGATGGTGGCAGGTTGGG + Intronic
1132853662 16:2035525-2035547 GAGCAGGCAGGAGGCAGCTCAGG - Intronic
1133273105 16:4620648-4620670 ATGGAGGCTGCAGGCAGGTGAGG - Intronic
1135269593 16:21057661-21057683 GAGAAAGCTGAAGGCAGGACGGG + Intronic
1136007510 16:27341114-27341136 AGGAGGTCTGGAGGGAGGTCTGG + Intronic
1136382385 16:29901548-29901570 AAGGGGGCTGAAGGCAGGTCTGG - Exonic
1138562694 16:57811392-57811414 AAGAAGGAAGGAGGGAGGACAGG + Intronic
1138615694 16:58164152-58164174 AAGAAAGCAGGAGGAAAGTCAGG + Intronic
1139342630 16:66278415-66278437 AGGAAGGGTGGGGGCAGTTCAGG - Intergenic
1139490756 16:67284815-67284837 AAGTGGGCAGGAGGCAAGTCAGG - Exonic
1139587571 16:67914001-67914023 GAGAAAGCAGGAGGCAGGCCTGG + Intronic
1139665396 16:68451572-68451594 AATAAGGCTGGAGGTGGGGCTGG + Intergenic
1140320883 16:73950738-73950760 CAGCAGTCTGGAGGGAGGTCTGG - Intergenic
1140701249 16:77583401-77583423 AAGAAGTGGGGAGGCAGGGCAGG - Intergenic
1141600022 16:85120016-85120038 CAGAAGGCTGCATGGAGGTCAGG - Intergenic
1141730750 16:85821410-85821432 AAGAAGGCTGGCGGGAGTTGGGG + Intergenic
1142045846 16:87924814-87924836 CAGAAGCGTGGAAGCAGGTCCGG + Intronic
1142186075 16:88695317-88695339 AGGAAGGCTGAAGACAGCTCTGG - Intergenic
1142519865 17:497298-497320 ATGCAGGCTGGAGGCAGCTGTGG + Intergenic
1142962380 17:3558860-3558882 GAGGAGGCAGGAGGCAGGTGAGG + Intergenic
1143023533 17:3928627-3928649 AGGCAGGCTGGAGGCGGGACGGG + Intronic
1143157569 17:4848047-4848069 AAGAAGGAGGGAGGGAGGACGGG + Intronic
1143276224 17:5712981-5713003 GAGAAGGCTGGAGACGGGGCAGG + Intergenic
1143712602 17:8744761-8744783 AAGGTGGCTGGAGACAGGTTGGG + Exonic
1143782101 17:9234300-9234322 AACAAGGCTGCATGCAGGTGGGG - Intronic
1145060624 17:19731074-19731096 CAGAAGGCTGCAGGGAGGACTGG - Intergenic
1146064220 17:29622453-29622475 AAGAAGGGTGCAGGGAGGCCGGG - Intronic
1146320545 17:31843257-31843279 AGGAAGGCAGGAGGCAGGGCTGG - Intergenic
1146514358 17:33477865-33477887 ATAGAGGCTGGAGGCAGCTCAGG + Intronic
1146938141 17:36825443-36825465 GGGAAGGGTGGAGGCAGGTGAGG + Intergenic
1147250749 17:39151447-39151469 AAGCAGGCCGGGGGCAGGTCCGG - Exonic
1147566650 17:41540533-41540555 ACAAAGGCAGGAGGCAGGCCAGG + Intergenic
1147739212 17:42660749-42660771 AAGAGTGCTGGGGACAGGTCAGG + Intronic
1148054424 17:44785648-44785670 AAGAAGGCAAGAGACAAGTCAGG + Intergenic
1148113675 17:45162174-45162196 AGGAAGGAGGGAGGCAGGCCAGG + Intronic
1148758697 17:49988071-49988093 AGGAAGGAGGGAGGCAGGGCGGG - Intergenic
1148794719 17:50191504-50191526 AAGAAGACTGGAGTGAGGCCTGG + Intronic
1149510458 17:57237049-57237071 TATTAGGCTGGAGGCAGGTACGG - Intergenic
1150802841 17:68295219-68295241 AAGAAGGTAGGAGGTAGGTGAGG + Intronic
1150837310 17:68576163-68576185 AAGAGTGCTTGAGGCAGGTATGG - Intronic
1151352309 17:73539056-73539078 GAGAAGGCTGGAGAAAGGACAGG + Intronic
1151352982 17:73542601-73542623 AGGAGGGGTGGAGGCAGGGCAGG + Intronic
1151748341 17:76023424-76023446 AAGAAGGTGGCCGGCAGGTCAGG + Intronic
1152053600 17:78002780-78002802 AACAAGGATGGAGGGAGGTGGGG - Intergenic
1152417876 17:80174778-80174800 AGGGAAGCTGGAGGCAGCTCTGG + Intronic
1152660951 17:81541692-81541714 AAGGGGGCGGTAGGCAGGTCTGG - Intronic
1153211143 18:2766286-2766308 AAGAAAACTGGAGACAGGCCGGG - Intronic
1155534881 18:26806683-26806705 GAGAAGGCTGGAGGAAGATGCGG - Intergenic
1156071941 18:33222255-33222277 AAGAAGGAAGGAGGCAGGAAAGG - Intronic
1156262541 18:35458816-35458838 CAGAAGGCAGGAGCCAGGTGGGG + Intronic
1156925681 18:42575100-42575122 CAGAAGGCTGGCAGCAGGCCAGG + Intergenic
1158702167 18:59758003-59758025 GAGAAGGTTGGAGGCTGGCCCGG - Intergenic
1159282505 18:66305012-66305034 AACAGGGCTGGAGGTAGGACGGG - Intergenic
1159608396 18:70498984-70499006 AAGAAGCCCAGAGGCAGTTCTGG - Intergenic
1161111420 19:2472901-2472923 AAGATGCCTGGAGCCAGGGCTGG + Intergenic
1161153006 19:2719499-2719521 AAGAACGCTGGGGGGAGGGCGGG + Intronic
1161527960 19:4769153-4769175 AACAAGACTGGAAGCAGGTGAGG + Intergenic
1162050086 19:8027736-8027758 TAGAAGGCAGGAGCCAGGACTGG + Intronic
1162949988 19:14065532-14065554 AAGAAGGCTGGGGCCAGGCACGG + Intergenic
1163157080 19:15445463-15445485 AAGAAGGCTGGTGGGAGGCCTGG + Intronic
1163676088 19:18656014-18656036 AAGGAGGCTGGAGGCATGGGTGG - Intronic
1163762588 19:19145714-19145736 AAGAGGCCTGGAGGGAGGTGGGG + Exonic
1163841967 19:19616970-19616992 AGGAAGGCTGGGGCCAGGTGCGG - Intronic
1165406229 19:35632956-35632978 ACGAAGGCTGGACGCAGGATAGG - Exonic
1166351348 19:42199895-42199917 GAGAAGGCTGGAGGGAGGAAGGG - Intronic
1166672870 19:44722141-44722163 CAGAAGGCTGCAGGCAGGGCTGG + Intergenic
1166758793 19:45212017-45212039 AAGGAGGTTGGGGGCAGGGCTGG - Intronic
1166877599 19:45906937-45906959 AAGAGGGCTGGAGGCAGAGGCGG + Intergenic
1167422423 19:49412154-49412176 AAGAAGGGTGGGGTCAGCTCCGG + Intronic
1167564183 19:50246036-50246058 AAGAAGGAAGGAGGGAGGGCAGG - Intronic
1168293067 19:55366346-55366368 ATGGAGGCTGGAGTCAGGACGGG + Intronic
1168410246 19:56135418-56135440 GAGAAGCCTGGAGGTAGGGCAGG + Intronic
1168492178 19:56820485-56820507 AAGAAGGCTGGAGGCATGTGTGG - Intronic
924962129 2:45408-45430 CAGAAGGCTGGGGGCGGGGCTGG - Intronic
925189602 2:1872121-1872143 AAGAAGCCTGGGGACTGGTCTGG + Intronic
925321848 2:2976426-2976448 AAGAAGGCAGGCGCGAGGTCAGG + Intergenic
926251562 2:11157935-11157957 TGGAAGGCTGCAGGCAGGGCAGG - Intronic
926380389 2:12281118-12281140 AAGGAGGCAGGAGCCAGGCCAGG + Intergenic
926693085 2:15750924-15750946 CAGTAGGCTGGAGGCAGGCAGGG - Intergenic
926809900 2:16746670-16746692 AAGAAGGAGGGAGGGAGGTGGGG - Intergenic
927714550 2:25343094-25343116 AAGGAGGCTGGAGGCGGGGGTGG - Intergenic
928001017 2:27523192-27523214 AAGAACCCCGGAGGAAGGTCGGG - Intronic
928267708 2:29825568-29825590 GAGTAGGTTGGAGGCAGATCTGG + Intronic
929879681 2:45824923-45824945 AAGAAAGCTGCAGTCAGGGCAGG + Intronic
930180385 2:48350021-48350043 AGGAAGACTGCAGGCAGGCCAGG + Intronic
930180451 2:48350701-48350723 AGGAAGACTGCAGGCAGGCCAGG - Intronic
930327516 2:49938716-49938738 CAGAAAACAGGAGGCAGGTCTGG + Intronic
930385797 2:50693393-50693415 AAGAAGTCAGGAGGCAGCTATGG - Intronic
930863840 2:56103829-56103851 AAGGAGGCTGGGGCCAGATCAGG - Intergenic
931853272 2:66275371-66275393 AAAAAGGCTGGAGGGAGATGGGG - Intergenic
932438258 2:71715908-71715930 AAGGAGGCTGAAGGCAGGAATGG + Intergenic
933726366 2:85429830-85429852 AAGGAGGCTGGGGGCAGAGCTGG - Intronic
933751667 2:85606370-85606392 TAGATGTCTGGAGGCAGGTCTGG + Intronic
933984696 2:87580877-87580899 AAGAAGGCTGTGGGCAGGATTGG + Intergenic
934098411 2:88628157-88628179 AAGGAGGCGGGAGGCGTGTCGGG - Intergenic
934184573 2:89660172-89660194 AAGAAGGCTGGAGGCAGGTCAGG - Intergenic
934294855 2:91734310-91734332 AAGAAGGCTGGAGGCAGGTCAGG - Intergenic
935201717 2:100862511-100862533 CAGAAGGCTGTGGTCAGGTCTGG + Intronic
936019100 2:108981263-108981285 AAGAATGCTGGCGGCAGGGTGGG - Intronic
936309155 2:111369923-111369945 AAGAAGGCTGTGGGCAGGATTGG - Intergenic
936515387 2:113178268-113178290 AGGAAGGGTGGAGACAGATCAGG - Intronic
937005309 2:118506787-118506809 AAGAAGGGTGGGAGCAGCTCTGG + Intergenic
937231672 2:120401512-120401534 AGGGAGGCTGGTGGCAGGTCTGG + Intergenic
937716888 2:125042171-125042193 GTGAAGGCTGGAGGCCTGTCTGG - Intergenic
938247995 2:129793834-129793856 AAGAAGGCTGGGGGCTGGCTGGG - Intergenic
938248441 2:129796404-129796426 AAGAAAGCTGGTGCCAGGACAGG + Intergenic
938415691 2:131101951-131101973 AAGAAGGCTGGGTGCAGGTGAGG - Intergenic
938961872 2:136351516-136351538 CCGGGGGCTGGAGGCAGGTCAGG - Intergenic
940736331 2:157456921-157456943 AAGAATGCTGAATACAGGTCAGG - Intronic
940855101 2:158723466-158723488 TAGAAGGCTGGGGGCAGGGACGG - Intergenic
941065961 2:160903107-160903129 AAGAAGGCAGATGGCAGGGCAGG - Intergenic
941162503 2:162052022-162052044 AAAAGGGCTGGAGGGAGGCCAGG + Intronic
942337806 2:174909259-174909281 AAGAAGGTTGGAGGAAGGGAGGG - Intronic
944303752 2:198156167-198156189 AGGAAGGCTGGAAGCAGGGAGGG - Intronic
945135965 2:206627707-206627729 AAGAAGGAAGGAGGCAGGATTGG - Intergenic
945165204 2:206935974-206935996 AGGAGAGCTGGAGGCAGGTTGGG - Intergenic
945946640 2:216001542-216001564 AACAAAGCAGGAGCCAGGTCTGG - Intronic
945949888 2:216029182-216029204 AAGAAGGATTGAGGCTGGCCAGG + Intronic
946194787 2:218026653-218026675 AAAAGGGCTGGAGGGAGGTAGGG - Intergenic
946463277 2:219889126-219889148 AAGAAGCCTGGGTCCAGGTCTGG + Intergenic
946552979 2:220823528-220823550 AAGAGGGATGGAGGGAGGTAGGG - Intergenic
946588288 2:221215312-221215334 AAAAATGCTGAATGCAGGTCTGG + Intergenic
946877799 2:224147323-224147345 AAGCAGGCTGGACACAGCTCTGG - Intergenic
948282749 2:236760407-236760429 AGGAAGGCTGGAAGGAGGGCAGG + Intergenic
948481512 2:238253249-238253271 AAGAAGGCCTGGGGCAGGTTTGG + Exonic
948644662 2:239396918-239396940 AGGACGCCTGGAGGCAGGTGGGG - Intronic
948906593 2:240982541-240982563 ACCAAGGCTGGAGGCAGGGCAGG + Intronic
1168758000 20:329125-329147 AACAAGTATGCAGGCAGGTCTGG + Exonic
1168876873 20:1177896-1177918 AGGAAGGCCAGAGGCTGGTCAGG - Intronic
1169320665 20:4630856-4630878 AAGAATGCCAGAGGCAGCTCTGG - Intergenic
1169898955 20:10534007-10534029 CAAAAGGCTGGAGGAAGATCTGG - Intronic
1170570269 20:17628624-17628646 GAGAAGGCTGGTGGCGGGGCAGG - Intronic
1171001982 20:21424075-21424097 AAGGAAGATGGAGGAAGGTCTGG - Intergenic
1172511463 20:35503973-35503995 ACGAAGGCTGGAGGAAGAGCTGG + Exonic
1172578321 20:36026687-36026709 ACAAAGGGTGGAGGCAGGACTGG - Intronic
1172620100 20:36313098-36313120 GAGAAGCCAGGCGGCAGGTCAGG - Intronic
1172842869 20:37912562-37912584 AGGGAGCCTGGGGGCAGGTCAGG + Intronic
1172901236 20:38336365-38336387 AAAAAGACTGGAAGCATGTCTGG - Intronic
1173263593 20:41458728-41458750 AAAATGGCTGAAGCCAGGTCTGG - Intronic
1173671547 20:44802540-44802562 AAGAGGGGTGGAGGCAGGCAGGG + Intronic
1173862224 20:46291519-46291541 CAGAAGCCTGGAGCCAGCTCTGG - Intronic
1173919556 20:46733618-46733640 AATAAGGCAGGAGGCAGGAAGGG + Intronic
1174305371 20:49611027-49611049 AAGAAGGCTGTGGGCAGAGCAGG + Intergenic
1175040368 20:56044103-56044125 AAGAAGTCTGGGGATAGGTCTGG + Intergenic
1176417018 21:6482108-6482130 AAGAATGCTGCAGGGAGGCCAGG + Intergenic
1176958151 21:15129755-15129777 AATTCGGCTGGAGGCAGGGCAGG + Intergenic
1177856318 21:26404440-26404462 AAGAAAGCTGGAAACAGGCCTGG - Intergenic
1178476895 21:32944892-32944914 AAGGGGTCTGGAGGCAGGACAGG + Intergenic
1178528817 21:33357390-33357412 CAGAAGCCAGGCGGCAGGTCTGG - Exonic
1178636662 21:34309535-34309557 AATAGGGCTGGAAGCAGGCCTGG - Intergenic
1178885158 21:36479319-36479341 AAGGAAGCTGCAGGCTGGTCTGG - Intronic
1179028738 21:37701821-37701843 AAGCAGGCAGGAGCCAGGCCAGG + Intronic
1179241934 21:39600219-39600241 AAGAGCTCTGGAGGCAGGTCAGG + Intronic
1179247880 21:39649306-39649328 AAGGAGGCTGGAGGCAGGCAGGG - Intronic
1179416600 21:41203470-41203492 AGGAAGGCTTGAGGAAGGTGGGG + Intronic
1179692516 21:43090441-43090463 AAGAATGCTGCAGGGAGGCCAGG + Intergenic
1179987021 21:44927709-44927731 AAGAGGGCTGCAGGCAGGGCTGG + Intronic
1180817077 22:18797205-18797227 AAGAAGGCTGGAGGCAGGTCAGG + Intergenic
1181203266 22:21231550-21231572 AAGAAGGCTGGAGGCAGGTCAGG + Intergenic
1181544901 22:23597147-23597169 AAGAAGGAAGGAGGCAAGGCAGG - Intergenic
1182101836 22:27662976-27662998 CAGAGGGCTGGAGGGAGGGCAGG + Intergenic
1182152125 22:28035183-28035205 AAGAAGCCTGGAGGGGGGTGGGG - Intronic
1182323137 22:29491317-29491339 GGGAAGGCTGGGGGCAGGGCAGG + Exonic
1183469395 22:37997629-37997651 AGGTAGGCTGGAGCCAGGTGGGG - Intronic
1183548734 22:38468976-38468998 AAGATGGCTGGAGGAGGCTCTGG - Intronic
1184019273 22:41809630-41809652 GGGAAGGCAGGAGCCAGGTCTGG + Intronic
1184553797 22:45221061-45221083 AAAGAGCCTGGGGGCAGGTCAGG - Intronic
1185004741 22:48269058-48269080 AAGAAGGAGGGAGGGAGGCCCGG + Intergenic
1185390882 22:50561277-50561299 TAGAAGGATGGAGGCTGGGCCGG + Intronic
1203223653 22_KI270731v1_random:63874-63896 AAGAAGGCTGGAGGCAGGTCAGG - Intergenic
1203267176 22_KI270734v1_random:22926-22948 AAGAAGGCTGGAGGCAGGTCAGG + Intergenic
949798262 3:7875056-7875078 AAGAATGGTGGAGTCATGTCAGG + Intergenic
950004623 3:9683881-9683903 AAGATGGCGGGAGACAGGTCTGG - Intronic
950691987 3:14666325-14666347 AAGAAGGGTGAAGGCTGGCCGGG + Intronic
950965479 3:17143030-17143052 GAGCAGGCTGGGGCCAGGTCAGG + Intergenic
951080060 3:18443649-18443671 AAGCAGGCAGGTGGCAGGTCCGG - Intronic
952956083 3:38558376-38558398 AAAAAGGCTCGGGGCAGGACTGG - Intronic
953151582 3:40330061-40330083 CAGAGGGCTGCAGGCAGGCCTGG + Intergenic
953577109 3:44121686-44121708 AAGAAGCCTGGAGGGAGTCCAGG + Intergenic
954294049 3:49664425-49664447 GTGAAGGCTGGAGCCAGGCCTGG + Exonic
955064908 3:55525814-55525836 AAGCTGGGTGGAGGCAGGTGGGG + Intronic
955484297 3:59420103-59420125 AATAACTCTGGAGGCAGTTCTGG - Intergenic
955596125 3:60592597-60592619 CAGCAGGATGGAGGCAGGGCAGG + Intronic
956446639 3:69332220-69332242 GAGAAGGGAGCAGGCAGGTCTGG + Intronic
957435633 3:80172193-80172215 AGGAAAGCTGGAGGCAGTTATGG - Intergenic
958801151 3:98757439-98757461 ATCAAGGCTGGAGGTAGGGCTGG + Intronic
959622749 3:108415837-108415859 AAGGAGGCTGGAGCCAGATCAGG + Intronic
960504872 3:118480013-118480035 AAGGAGGCTGAAGGCAGGAAGGG + Intergenic
961058387 3:123808113-123808135 AAGGAGGCTGGAGGAAGAGCCGG - Intronic
961146796 3:124600771-124600793 AAGTAGCCTAGAGGCAGGTTTGG + Intronic
961340208 3:126212594-126212616 AAGAAGGCGGGAGGAAGGGAAGG + Intergenic
961560832 3:127728544-127728566 AGGCAGAATGGAGGCAGGTCTGG - Intronic
961562209 3:127738457-127738479 TGGAAGGGTGGAGGCTGGTCAGG + Intronic
961564942 3:127756672-127756694 AAGAAGTCTGGAGATAGGCCAGG - Intronic
961666398 3:128495809-128495831 CAGTAGGCAGGAGGCAGGTGGGG - Intergenic
963063816 3:141246554-141246576 ATGCTGGCTGGAGGCAGGTTGGG + Intronic
966236630 3:177708763-177708785 AAGAAGGCTGGAGGATTGTTAGG - Intergenic
967458715 3:189720759-189720781 AAGAAGACTGGAGGCTGGCAGGG + Intronic
967511734 3:190321266-190321288 GAGAAGGTTGGTGGCAGGTGGGG - Intronic
968131090 3:196193249-196193271 AAGGAGGCAGGAGGCAGACCAGG - Intergenic
968186507 3:196636473-196636495 AGAGAGGCTGGAGGCAGCTCAGG + Intergenic
968828148 4:2914798-2914820 AGGCAGGCTGCAGGCAGGGCGGG - Intronic
968856530 4:3128227-3128249 AAGATGGCAGGTGGCAGGGCCGG - Intronic
968945435 4:3661160-3661182 CTGCAGGCTGGAGGCAGGTTGGG + Intergenic
969587335 4:8101991-8102013 GAGGAGGCTAGAGGCAGGTGCGG - Intronic
969606681 4:8205450-8205472 AAGAGGCCTGGAGGCAGGCAGGG - Intronic
969660841 4:8526563-8526585 AAGGAGGCTGGAGGGAGCACAGG - Intergenic
969689253 4:8695102-8695124 AGGAAGGCTGCAGGCAGGAAAGG + Intergenic
970260397 4:14218419-14218441 AAGCAGGCTGGAGTCAGGTTGGG - Intergenic
971317195 4:25577379-25577401 AAGAAGACGTGAGGCAGGGCTGG - Intergenic
972353039 4:38254918-38254940 AAGAAGGGAGGAGGCAGGGAAGG + Intergenic
973758389 4:54096587-54096609 ATGGAGGCTGCAGGCAGGGCGGG - Intronic
977283403 4:95070165-95070187 AAGAAGGCTAAAGGAAGGTAGGG + Intronic
978065310 4:104392054-104392076 AAGTAGGTTGGAGCCAGGTGCGG + Intergenic
978509603 4:109501902-109501924 AAGAAGGTTGGTGGGAGGTCAGG + Intronic
981048813 4:140291245-140291267 AAGAAGCCGGGAGGCCTGTCAGG + Intronic
981097833 4:140799665-140799687 AGGAAGGCGGGAGGAAGATCAGG - Intergenic
982562478 4:156946979-156947001 AAGAAGGCTGGAAGCAGAAATGG + Intronic
984695491 4:182775321-182775343 GGGGAGGCTGGAGGGAGGTCAGG + Intronic
984833815 4:184000483-184000505 TGGAAGGCTGAAGGCAGGTGTGG - Intronic
985231935 4:187827837-187827859 ATGCTGGCTGGAGGCAGGCCAGG - Intergenic
985993674 5:3584513-3584535 AAGAAGGAGGGAGGCAGGACAGG + Intergenic
986783279 5:11086226-11086248 AAAAGGGATGGAGGCAGGTGTGG + Intronic
987156511 5:15095084-15095106 AAGAAAGCTGGAGGGAAGTGGGG - Intergenic
990810523 5:59717195-59717217 ATGAAGGCTGGATGCAGGGAAGG - Intronic
991924709 5:71693531-71693553 AACAAGGCTGAAGCCAGGTATGG - Intergenic
992645759 5:78809533-78809555 AGGAGGGCAGGAGCCAGGTCTGG + Intronic
993791813 5:92219164-92219186 AAGAAGGCAGGTGGCAGGAGTGG - Intergenic
996208401 5:120773273-120773295 AAGAAGCCTTGAGGCAGATGAGG + Intergenic
996354307 5:122579403-122579425 AAGAACTCTGGAGGGAGGTCAGG - Intergenic
998317604 5:141198079-141198101 AAGAAGGCTGAAGTCAAGTAAGG - Intergenic
998487149 5:142512754-142512776 AAGTAGGCAGGAACCAGGTCAGG - Intergenic
998542596 5:142996750-142996772 AAGAAAACTGGAGGGAGGTTGGG + Intronic
998715579 5:144880359-144880381 AAGAAGTGTGGAAGGAGGTCTGG - Intergenic
999029563 5:148275954-148275976 AAAAAGGCAGGAAACAGGTCGGG - Intronic
999638063 5:153643038-153643060 AAGCAGGCTGCAGGCAGGAGGGG + Intronic
1001085872 5:168699643-168699665 AAGAGGGCTGGAGGTGGGCCTGG + Intronic
1001601909 5:172934446-172934468 AGGAAGGTTGGTGGCAGGGCGGG + Intronic
1001855564 5:175007589-175007611 AAGAAGGATGGAGGCAGAAAGGG - Intergenic
1002603914 5:180370837-180370859 AGGAAGCCTGCAGGCAGGGCAGG + Intergenic
1002804776 6:562109-562131 AAGAAGGATGGAGGCAGCCCTGG + Intronic
1003395524 6:5749378-5749400 AAGAAGGCTGCAGTCAGGGTGGG + Intronic
1003466476 6:6384545-6384567 AACAAGGCTGGAGTCAGCTGAGG + Intergenic
1004237400 6:13886453-13886475 AAGTAGGGTCGAGGCAAGTCTGG + Intergenic
1005988675 6:30890236-30890258 ATGCAGGCAGGAGCCAGGTCAGG - Intronic
1006538042 6:34715988-34716010 AAGAAGGCTGATGGCAAGCCTGG - Intergenic
1007109657 6:39305595-39305617 AAGAAGGGTGGAGGCAGAGCTGG - Intronic
1007342765 6:41202003-41202025 ACGTAGGCTGGAGGCAGGGGAGG - Intergenic
1007347468 6:41243034-41243056 ACGGAGGCTGGAGGCAGGGGAGG + Intergenic
1007383119 6:41503278-41503300 AAGACGGCCGGGGGCAGGGCAGG + Intergenic
1007770236 6:44186257-44186279 AAGAAGGCAGGGGCCAGGGCTGG - Intergenic
1008923052 6:56862783-56862805 AAGAAGGCTGGAGGAAGGTAGGG + Intronic
1011325151 6:86142607-86142629 AAGAAGGTTGGAGTTAGGTGGGG + Intergenic
1012987727 6:105892880-105892902 ATGAAGGCAGGAACCAGGTCTGG + Intergenic
1015466415 6:133553194-133553216 AAGAAGGCTCTGGGCAGGTCAGG + Intergenic
1016093368 6:140006401-140006423 AAGGAGGCAGGGGGCAGGTAGGG - Intergenic
1018845176 6:167551106-167551128 GAGATGGCTGGAGCCAGGCCAGG - Intergenic
1018873396 6:167799855-167799877 AGGAAGGAGGGAGGCAGGTGTGG + Intergenic
1019409487 7:900378-900400 AGGAGGGCTGCAGGCACGTCAGG + Intronic
1022232143 7:28424319-28424341 AAGAAGGCAGCACCCAGGTCAGG + Intronic
1022248142 7:28581291-28581313 AAGAAGGCTGGAGGAATATTCGG - Intronic
1022349329 7:29552573-29552595 ATGGAGGCTGGGGGCAGGTTAGG + Intergenic
1022412127 7:30147425-30147447 GAGAAGGCAGGATGCGGGTCTGG + Intronic
1022632025 7:32094270-32094292 AGGTGGGCTGGAGGCAGCTCTGG - Intronic
1022962732 7:35445048-35445070 AAGAACACTGAAGGAAGGTCCGG + Intergenic
1023252591 7:38281363-38281385 AAGAAGGCAGAAAGCAGGCCAGG + Intergenic
1023741941 7:43288877-43288899 AGGTAGGCTGGGGCCAGGTCTGG - Intronic
1024042321 7:45565124-45565146 GAGAAGGCTGCAGGCAGGATTGG - Intergenic
1024213780 7:47228951-47228973 GAGGAGGATGGAGGCAGGTTTGG - Intergenic
1024659200 7:51476743-51476765 AGGAAGGCTGGAGGCAGAGGAGG + Intergenic
1025985281 7:66445271-66445293 AAGAAGCATGGAGACAGGCCAGG - Intergenic
1026002150 7:66568884-66568906 AAGAAGCATGGAGACAGGCCAGG - Intergenic
1026216859 7:68357221-68357243 AACAAGGCTGGAGACAGATACGG + Intergenic
1026488902 7:70845856-70845878 AAGAAGGCTGTGGCCAGGTGCGG + Intergenic
1027133111 7:75605372-75605394 GAGAAGCCAGGAGGCAGGTGAGG + Intronic
1027176416 7:75906608-75906630 AAGGAGGCAGGAAGAAGGTCTGG + Intronic
1029969589 7:104776342-104776364 AATAAGGCTGTATGCAGGTGGGG - Intronic
1030677521 7:112399458-112399480 ATGAAGTTTGGAGGCAGTTCTGG + Intergenic
1031127232 7:117788567-117788589 AAGCAGGGTGGAGGCAGCTCTGG + Intronic
1031496985 7:122461887-122461909 AAGAAGGCTCTTGGCAGGCCAGG - Intronic
1032082278 7:128865626-128865648 AAGAAGGCTGATGGCAAGCCTGG - Exonic
1033187666 7:139243654-139243676 GGTAAGGCAGGAGGCAGGTCAGG + Intronic
1033209060 7:139446813-139446835 AAGAGGGAGGCAGGCAGGTCAGG - Intergenic
1033432190 7:141299535-141299557 AAGTAGGAAGGAGGCAGGCCTGG - Intronic
1033944501 7:146699550-146699572 AAGAAGGCTAGAGGGAGCTGGGG + Intronic
1034032998 7:147788728-147788750 AGGGGGGTTGGAGGCAGGTCAGG - Intronic
1034271150 7:149803932-149803954 AAGAAGGCGGGAGTGAGGGCAGG + Intergenic
1034313486 7:150110416-150110438 AGCAAGGCTGGAAGCAGGTGGGG + Intergenic
1034469139 7:151246410-151246432 GTGAGGGCTGGAGGCAGGGCAGG + Intronic
1034793374 7:153990248-153990270 AGCAAGGCTGGAAGCAGGTGGGG - Intronic
1035198441 7:157242764-157242786 AGGAAGGGTCGAGCCAGGTCTGG + Intronic
1035551712 8:533061-533083 AAGTGGTCTGGAGGCAGGCCTGG - Intronic
1035765250 8:2100188-2100210 AAGAAGGCGGGAGGCAGGGAGGG - Intronic
1036567392 8:9949135-9949157 AAGCAGGCAGGAAGCAGATCTGG - Intergenic
1037825680 8:22159391-22159413 GAGAAGGCTGCAGACAGGGCTGG + Intronic
1037880718 8:22572161-22572183 CAGAGGGCAGGAGGCAGGCCTGG + Intronic
1037929204 8:22867601-22867623 AAGAAGGCTGGAGCCAGAGGGGG - Intronic
1038281606 8:26170378-26170400 AAAAAGGCTGATGTCAGGTCTGG + Intergenic
1038741486 8:30220762-30220784 AAGGAGGCTGTGGGCAGGTGTGG - Intergenic
1039137747 8:34345474-34345496 AAGAAAGCTGGAGGAAGCTAAGG - Intergenic
1039765683 8:40625635-40625657 AACAAGGTGGGAGGCAGGGCTGG + Intronic
1041755613 8:61310039-61310061 AAGAAGGGAGGAGGCAAGCCAGG + Intronic
1044344966 8:91094828-91094850 AATAAGACTGGAGGCAGGGATGG - Intergenic
1044474852 8:92613910-92613932 TAGGAGGTTGGAGGCAGTTCAGG - Intergenic
1044717820 8:95116838-95116860 AAAAAGTCAGGAGGCAGTTCAGG + Intergenic
1047670013 8:127135944-127135966 AAGAGGGCTGGAGGGAGGGTGGG - Intergenic
1048283408 8:133122479-133122501 AAGAAAGCTGGAGAGAGGGCAGG - Intronic
1048873270 8:138816174-138816196 AAGGAGACAGGAGGCAGGCCAGG + Intronic
1049209742 8:141380253-141380275 AGGGAGGCTGGAGACAGGGCAGG + Intergenic
1049362814 8:142220340-142220362 AAGTGGGCTGGAGGCAGAGCTGG - Intronic
1049395397 8:142397916-142397938 AAGAGGTCTGGAGACAGGGCTGG - Intronic
1049406515 8:142453966-142453988 AGGAAGGTGGGAGGCAGGACAGG + Intronic
1049589621 8:143451182-143451204 CAGAAGGCAGGAAGCAGGACAGG + Intronic
1049784518 8:144444143-144444165 CAGGAGGCGGGAGGCAGGGCCGG - Intronic
1050303792 9:4286103-4286125 ACCCAGGCTGGAGGCATGTCAGG - Exonic
1050306443 9:4310446-4310468 AAGAAGGCCGGCAGCAGGTGTGG - Intronic
1050455978 9:5834416-5834438 ACGAAGGCAGGAATCAGGTCTGG + Intergenic
1052850603 9:33376221-33376243 CTGAAGTCTGGAGGCAGGACTGG + Intergenic
1053018220 9:34676157-34676179 AAGGAGGCTGAAGTCAGGGCTGG + Intergenic
1053459793 9:38259406-38259428 AAGACGGCCAGAGTCAGGTCTGG + Intergenic
1058378935 9:104357721-104357743 AAGAAGGCTGGCAACAGGCCTGG + Intergenic
1058588516 9:106535700-106535722 CAGAAGGCAGGAGGCAGGAAGGG + Intergenic
1060295173 9:122338385-122338407 CACAAGGCTGGAGGGAGGTGTGG + Intergenic
1060814462 9:126627307-126627329 AAGCAGGCTGAGGGCAGGGCAGG - Intronic
1060846671 9:126842785-126842807 AAGAGGGCTGGTGTCAGATCTGG - Intergenic
1060893131 9:127201248-127201270 AAGACTGCTGGAGGCAGAGCCGG - Intronic
1061062538 9:128257930-128257952 AAGAAGGGTGGGGGCGGGGCAGG - Intronic
1061152317 9:128835904-128835926 AAGAAGGCTTTAGCCAGGTCTGG - Intronic
1061371360 9:130199386-130199408 AAAAAGAGAGGAGGCAGGTCAGG - Intronic
1061416498 9:130450115-130450137 CAGGAGGCAGGAGGCAGGACAGG + Intronic
1061497379 9:130982757-130982779 AAGGAGGCTGGGGCCAGGGCAGG - Intergenic
1061764292 9:132871631-132871653 GAGACGGCACGAGGCAGGTCTGG + Intronic
1061942038 9:133889053-133889075 AAGATGGCCTGAGGCAGGTCCGG + Intronic
1062715896 9:138009907-138009929 AAGGAGGCTGGAGGCTGGTTGGG + Intronic
1186196692 X:7116420-7116442 AAGAAACCAGGAGGCAGGCCAGG - Intronic
1186262040 X:7790247-7790269 AAGAAGGCTACAGGCAGTCCAGG - Intergenic
1186363837 X:8871203-8871225 GAGAAGGGTGGAGGCACATCTGG + Intergenic
1188555199 X:31404018-31404040 AAGAAGGCTGGGGGTAGGAAGGG - Intronic
1189269031 X:39737373-39737395 GACAAGGCTGGAGGTAGGTGAGG - Intergenic
1189709135 X:43791275-43791297 AAGAAGGTTGGAGGCAAATGGGG - Intronic
1192217583 X:69173832-69173854 AAGAAAACTGGAGGCCGGCCTGG - Intergenic
1192582929 X:72299722-72299744 ACGAAGGCTGGAAGAAGGTGGGG - Intronic
1196061123 X:111409434-111409456 AAGAAAGCTGTAGGTATGTCTGG - Intronic
1196208503 X:112968041-112968063 GAAGAGGCAGGAGGCAGGTCAGG + Intergenic
1197860885 X:130969034-130969056 AAAAAGGGTGGAGGCAGGACAGG - Intergenic
1198327149 X:135585283-135585305 AGGGAGGCTGGATGCAGGCCAGG + Intergenic
1198800889 X:140446630-140446652 AAGAAGGCAGGAGAGAGTTCTGG - Intergenic
1199023000 X:142904481-142904503 AAGAAGGCTGGTATCAGGTAGGG + Intergenic
1199453232 X:147997011-147997033 AAAAAGGCTGGAGGCTGTTTGGG + Intronic
1201490215 Y:14532856-14532878 AAGAAGGATGGAGGGAGGGAAGG - Intronic