ID: 1105219476

View in Genome Browser
Species Human (GRCh38)
Location 13:18312346-18312368
Sequence AGAAGGCTGGAGGCAGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 7, 1: 0, 2: 5, 3: 64, 4: 552}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105219467_1105219476 -5 Left 1105219467 13:18312328-18312350 CCCATCCATCTCCTGCAAAGAAG 0: 7
1: 1
2: 0
3: 20
4: 207
Right 1105219476 13:18312346-18312368 AGAAGGCTGGAGGCAGGTCAGGG 0: 7
1: 0
2: 5
3: 64
4: 552
1105219466_1105219476 -4 Left 1105219466 13:18312327-18312349 CCCCATCCATCTCCTGCAAAGAA 0: 7
1: 1
2: 3
3: 35
4: 271
Right 1105219476 13:18312346-18312368 AGAAGGCTGGAGGCAGGTCAGGG 0: 7
1: 0
2: 5
3: 64
4: 552
1105219464_1105219476 1 Left 1105219464 13:18312322-18312344 CCAACCCCCATCCATCTCCTGCA 0: 7
1: 1
2: 5
3: 58
4: 639
Right 1105219476 13:18312346-18312368 AGAAGGCTGGAGGCAGGTCAGGG 0: 7
1: 0
2: 5
3: 64
4: 552
1105219470_1105219476 -10 Left 1105219470 13:18312333-18312355 CCATCTCCTGCAAAGAAGGCTGG 0: 7
1: 0
2: 0
3: 23
4: 232
Right 1105219476 13:18312346-18312368 AGAAGGCTGGAGGCAGGTCAGGG 0: 7
1: 0
2: 5
3: 64
4: 552
1105219468_1105219476 -6 Left 1105219468 13:18312329-18312351 CCATCCATCTCCTGCAAAGAAGG 0: 7
1: 1
2: 3
3: 28
4: 257
Right 1105219476 13:18312346-18312368 AGAAGGCTGGAGGCAGGTCAGGG 0: 7
1: 0
2: 5
3: 64
4: 552
1105219465_1105219476 -3 Left 1105219465 13:18312326-18312348 CCCCCATCCATCTCCTGCAAAGA 0: 7
1: 1
2: 1
3: 25
4: 269
Right 1105219476 13:18312346-18312368 AGAAGGCTGGAGGCAGGTCAGGG 0: 7
1: 0
2: 5
3: 64
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105219476 Original CRISPR AGAAGGCTGGAGGCAGGTCA GGG Intergenic
900204867 1:1427487-1427509 GGAGGGCTGGGGGCAGGGCAGGG - Intronic
900656473 1:3761205-3761227 GGTGGGCTGGAGGCAGGTCAGGG + Intronic
900796937 1:4713628-4713650 AGAAAACTGGAGGGAGGTGAGGG - Intronic
900903971 1:5537601-5537623 AGGAGGCTGGAGGCAGAGTAGGG - Intergenic
900953520 1:5873139-5873161 GGAGGGCTGGGGCCAGGTCAGGG - Intronic
901044157 1:6385587-6385609 AGGAGGCTGGTGGCTGGCCAGGG - Exonic
901052473 1:6432243-6432265 AGAAGGCTGGAGGCTGTGCCTGG + Intronic
901091507 1:6644761-6644783 AGGAGGCTGGAGGGAGGGAAGGG - Intronic
901108071 1:6773132-6773154 AGCAGGCTGGAAGAAGGTGAAGG - Intergenic
901755853 1:11441062-11441084 CGAATGCTGGAGGCAGGGCAGGG + Intergenic
902121191 1:14167430-14167452 ACAAGGATGGAGGCAGGGCATGG + Intergenic
902124413 1:14196569-14196591 AGAAGGCTGGAGGGAAGGGAAGG + Intergenic
902126709 1:14220049-14220071 GGAAGGCAGGAGGGAGATCAGGG - Intergenic
902628507 1:17690610-17690632 AGAAGGCTGGATGTAGGCCGAGG + Intronic
902734406 1:18390651-18390673 AGAACGCCGGAGCCTGGTCATGG - Intergenic
903279680 1:22243575-22243597 AGGAGCCTGGGGGCAGCTCAGGG - Intergenic
903339297 1:22643954-22643976 AGAGGGTTGGGGGCAGGTGAGGG + Intronic
903367927 1:22816386-22816408 AGAAGGCAGGAGGCAGGACTGGG - Intronic
903445600 1:23420773-23420795 AGAAGGCAGGAGGCAGAAAAAGG + Intronic
904266801 1:29322988-29323010 AGAAGGCTGGGGGGAGGTTCTGG + Intronic
904430335 1:30460145-30460167 AGAAGGCTGGAGCCAGGGCCTGG - Intergenic
904807967 1:33145096-33145118 AGCAGGCAGCAGGCAGCTCATGG - Intergenic
905502516 1:38450920-38450942 ATGAGGCTGGAGGCAGGTAATGG - Intergenic
906002863 1:42442101-42442123 GGTAGGCAGGGGGCAGGTCATGG + Intronic
906025997 1:42674417-42674439 AGAAGGTTGGAGAGAGGCCAGGG + Intronic
906107001 1:43300705-43300727 AGGAGGCAGGAGGCAGGAAAGGG - Intergenic
906274437 1:44505862-44505884 AGAGGATTGGAGGGAGGTCAAGG - Intronic
906302320 1:44691917-44691939 GGATCCCTGGAGGCAGGTCAAGG + Intronic
906382523 1:45341825-45341847 GAAAGGATGGAGGCAGGTGAGGG - Intronic
906485868 1:46234563-46234585 AGAAGGAAGGAGGCTGGGCATGG - Intergenic
907255286 1:53174176-53174198 AGAAGGCAGGAGGAAAGTGAGGG + Intergenic
907303465 1:53501967-53501989 AGAAGGGTGGAGGAAGGAGAAGG + Intergenic
908469941 1:64433862-64433884 AGAAGGCTGGAAGCAAGTGCTGG + Intergenic
908470178 1:64436565-64436587 AGAAAGAAGGAGGCAGGTCAGGG + Intergenic
908576819 1:65468620-65468642 AGAAGGCTGGAGCCAAGTTATGG + Intronic
908803897 1:67909800-67909822 AAAGGGCTGGAGTCAGATCATGG - Intergenic
908815231 1:68025003-68025025 GGAAGTCTTGAGGCAGGACATGG + Intergenic
909645789 1:77915337-77915359 AGAAAGCTGGTGGCCGGGCATGG + Intronic
909779905 1:79531267-79531289 AGAAGTCTTGAGGCACATCATGG - Intergenic
910220354 1:84883681-84883703 AGAAGGATGAGGGCTGGTCAGGG - Intronic
910616908 1:89208402-89208424 AGAAGGCTGGAAGCAGTTTGAGG + Intergenic
911083979 1:93961006-93961028 AAGAGGCTGGAGGCAGGCCTAGG + Intergenic
912017801 1:105063323-105063345 AGAAAGCTTGATGCAGATCATGG - Intergenic
912411680 1:109484387-109484409 GGAAAGCTGGAGGCAGGTGCAGG - Intronic
913069951 1:115289851-115289873 AAAGGGCTGGATGGAGGTCAGGG - Intronic
913144361 1:115975636-115975658 AGAAGGATACTGGCAGGTCAAGG + Intergenic
913215746 1:116618870-116618892 AGAAGGCTAGAGGCAAGTCAGGG + Intronic
914859001 1:151371504-151371526 AGAGGGCTGGAGGTGGGGCAGGG + Intronic
915287145 1:154860355-154860377 AGAGGCCTGGAGGAAGGTCAGGG - Intronic
915899332 1:159835107-159835129 AGAGGCCTGCAGGCAGGCCAAGG + Exonic
917409430 1:174742603-174742625 AGAAGCCTGGAGGAAGGAGAAGG + Intronic
917679571 1:177352218-177352240 GGAGGGCAGGAGGCAGGGCAAGG + Intergenic
917802987 1:178587163-178587185 AGAGGACTGCAGGAAGGTCAAGG + Intergenic
917854962 1:179092370-179092392 GGAAGGCAGGTGGCAGGTTAAGG - Intronic
917936969 1:179877880-179877902 AGAAGGCAGAAGGCAGGGCACGG - Intergenic
920550967 1:206860417-206860439 ACAAGGCTGTAGGCAGGTAGTGG + Intergenic
921075288 1:211695728-211695750 AGACAGCTGGAGGAGGGTCACGG - Intergenic
921397051 1:214679607-214679629 AGAAGAATGGAGGCTGGGCATGG - Intergenic
921802525 1:219417840-219417862 AGTAGCCTGGATGCAGGGCAAGG - Intergenic
922431593 1:225560212-225560234 CCAAGGCTGGAGGTAGCTCATGG + Intronic
922654817 1:227372821-227372843 AGATGGTTGGAGCCAGGCCAGGG - Intergenic
922894252 1:229088273-229088295 AGGCGGCTGGCGGCAGGTCCCGG + Intergenic
923752544 1:236759565-236759587 AGAAGGATGGAGCCAGCACAAGG - Intronic
924056329 1:240127768-240127790 AGCAGGCTGGGGGCCGGGCATGG - Intronic
924449571 1:244165357-244165379 AGAAGGCAGGAGCCAGAACACGG + Intergenic
924939768 1:248804913-248804935 TGAAGGCTGGAGGAGGCTCATGG - Intergenic
1062849300 10:730751-730773 AAAAGGGCAGAGGCAGGTCAAGG - Intergenic
1062984956 10:1760036-1760058 AGAAGGTGGGAGGCAGGTGCTGG - Intergenic
1063081044 10:2767397-2767419 AGCAGGCTGGAGGTGGGGCATGG - Intergenic
1063353929 10:5380819-5380841 GTGAGGCAGGAGGCAGGTCAGGG - Intergenic
1063759065 10:9051632-9051654 AGAAGGCTTTAAGCAGGGCAGGG - Intergenic
1064715273 10:18170385-18170407 AAAAGGCTGGAGGGATGGCAAGG - Intronic
1065144692 10:22756327-22756349 AGAAGGGAGGAGGCCGGGCAAGG - Intergenic
1065917439 10:30365298-30365320 AGAAGGTTGGGGGCAGAGCAGGG - Intronic
1066304790 10:34129957-34129979 AAAAGGCTGGAGGCCAGGCATGG - Intronic
1066752867 10:38677108-38677130 AGAATGCTGAAGGCCGGGCATGG - Intergenic
1067038233 10:42934353-42934375 CCAGGGCTGGGGGCAGGTCAGGG + Intergenic
1069921771 10:71819926-71819948 AGAAGACGGGAGGCCGGACAAGG + Intronic
1070022376 10:72599655-72599677 GGAAGGATGGAGGCAGGTTTTGG - Intronic
1070190436 10:74107074-74107096 AGAAGGGGGGAGGCAGGACAAGG - Intronic
1070576635 10:77684078-77684100 AAAAGGCTGGAGGGAGGGAATGG + Intergenic
1070838513 10:79467241-79467263 AGAAGGCTGTAGGCTGGGCATGG + Intergenic
1071197868 10:83182358-83182380 AGAAGACTGCTGGCATGTCATGG - Intergenic
1071368686 10:84928066-84928088 AAAATGCTGGTGGCAGGTCAAGG + Intergenic
1071471010 10:85984092-85984114 AGGAGGCTGCTGGGAGGTCATGG - Intronic
1071812990 10:89203972-89203994 GGAGAGCAGGAGGCAGGTCAAGG - Intergenic
1071906307 10:90177966-90177988 AGCAGGATGGAGGAAGGGCAAGG + Intergenic
1072039133 10:91590843-91590865 GGAAGGCTGGGGGTGGGTCAAGG + Intergenic
1072189120 10:93066305-93066327 AGGAGGCAGGAGGCTGGCCATGG - Intronic
1072285635 10:93911841-93911863 CAAAGCCTGGAGCCAGGTCAGGG - Intronic
1072768219 10:98113697-98113719 AGAATGGTAGAGGCAGATCAGGG - Intergenic
1073666940 10:105544144-105544166 AGAAGGTAGGAGGCAGATGAGGG - Intergenic
1074273335 10:111976560-111976582 AGGAGGCTGGAGGAATGGCAAGG + Intergenic
1075501331 10:122977587-122977609 CTCAGGCTGGAGGCAGATCATGG - Intronic
1075678255 10:124312798-124312820 AGATGGCTGCCTGCAGGTCAAGG - Intergenic
1076052849 10:127349147-127349169 AGGAAGCTGGAGGGAGCTCATGG - Intronic
1076326677 10:129629047-129629069 GGAAGGCTGCATGCAGGGCAAGG - Intronic
1076424830 10:130360037-130360059 GGCAGGCTGGAAGCTGGTCAGGG - Intergenic
1077129998 11:966752-966774 AGATGGCTGGTGGCCAGTCAGGG + Intronic
1077466913 11:2737875-2737897 AGTGGGCTGGAGGCAGGGAAAGG + Intronic
1077866467 11:6225679-6225701 AGAGGGCTAGAGTCAGATCAAGG - Intronic
1078699244 11:13665309-13665331 AAAAGGCTGAAGGCTGGGCACGG + Intergenic
1079053746 11:17186989-17187011 AGATTGCTTGAGCCAGGTCAAGG + Intronic
1080328366 11:31106424-31106446 AGAGGAGTGGAAGCAGGTCAGGG + Intronic
1081651144 11:44824939-44824961 AGAAGGGTGTAGGGAGGACAAGG - Intronic
1083141186 11:60723052-60723074 AGAAGCATGGAGGAAGGCCAGGG + Intergenic
1083244526 11:61416184-61416206 AGAAGGCTGGATTGAGGTGAAGG + Exonic
1083488846 11:63000191-63000213 GGAAGGCTGGAGGCCAGACACGG + Intronic
1083976421 11:66125195-66125217 AAAGGGCAGGAGGCAGGTGAGGG + Intronic
1084366549 11:68705015-68705037 AGCAGGATGGAGGCAGGGCTGGG + Intergenic
1084483416 11:69434801-69434823 CAAAGGCAGGAGGCTGGTCAGGG + Intergenic
1084552267 11:69851890-69851912 AAAAGCCTGGAGGCAGGAAATGG - Intergenic
1085017291 11:73183135-73183157 TGAAGGATGGAGGCTGGTAAAGG - Intergenic
1086276659 11:85137826-85137848 AATAGACTGCAGGCAGGTCATGG + Intronic
1086329540 11:85739885-85739907 AGAGGACTGGAGGCAAGTCTGGG + Intronic
1087475211 11:98625704-98625726 AAAAGACTGGAGGAAGGTCAGGG + Intergenic
1088789752 11:113214113-113214135 GGAATGCAGGAGGCAGGACATGG - Intronic
1089192170 11:116661035-116661057 AGAAGGGAGGAGGCTGGTAAGGG + Intergenic
1089289454 11:117428875-117428897 AGAAGACTGGGGGCAGGGGATGG - Intronic
1089396020 11:118136676-118136698 AGAAGCCTGGAGGAAAATCAAGG + Exonic
1089737941 11:120562866-120562888 AAAAGGGAGGAGCCAGGTCAGGG + Intronic
1090837158 11:130462040-130462062 AGAGGGCAGGAGGAAGGACATGG - Intronic
1090908923 11:131101390-131101412 AGAAGCCAGGAGGCAGGGTATGG + Intergenic
1090948006 11:131448702-131448724 AGAAGGCTGCAGGCTGGAGAAGG + Intronic
1091930597 12:4392441-4392463 GGAAGGGAGGAGGCAGGGCAGGG - Intergenic
1091931924 12:4403229-4403251 AGAAAGCTGGAGGAGGGCCAGGG - Intergenic
1092160224 12:6311748-6311770 AAAAAGCTGGAGGGAGGCCATGG - Intronic
1092239914 12:6830031-6830053 AAAAGGCTGGTGGCAAGACAGGG - Intronic
1093228795 12:16517415-16517437 AGAAGGCAGGAGGCATCACAAGG - Intronic
1093777595 12:23095503-23095525 AGAAGACTGGTGAAAGGTCAGGG - Intergenic
1095427301 12:42090363-42090385 AGAGGTCTGGAGTCAGGTAAGGG - Intronic
1095964821 12:47859592-47859614 ACAAGGCTTGATGCAGATCAGGG - Intronic
1096445189 12:51683598-51683620 AGAATGCTGGAGTCAGGGGATGG - Intronic
1096492296 12:52019411-52019433 AGAAGGCTGGTGGGAGGCAAAGG - Intergenic
1096654088 12:53077794-53077816 ATAAGGCAGGAGTCAGATCATGG + Intronic
1096689203 12:53309125-53309147 ACAAGGATGGAGGGAGGGCAAGG - Intronic
1096751410 12:53761243-53761265 AGAAAGCTGGAGGTAGGCAATGG - Intergenic
1096755090 12:53792699-53792721 AGAAGGCTGAAGAGAGGTGAAGG - Intergenic
1097019243 12:56007967-56007989 AAAAGGCGGGAGACAGATCAAGG + Intronic
1097188988 12:57210568-57210590 AGGAGGCTGGAGGCGAGGCAGGG - Intronic
1098206787 12:68119057-68119079 AGCAGGCAAGAGGCAGGTCTGGG - Intergenic
1098296589 12:69010536-69010558 AGCAGGCAGGGGGTAGGTCAGGG - Intergenic
1098647254 12:72919001-72919023 AGGAGGCTTGAGGGAGGTTAAGG - Intergenic
1099417370 12:82408041-82408063 AGAAGGTAAGAGGCAGGTCCAGG - Intronic
1099916728 12:88903976-88903998 CGAAGGATGGAGGCTGGTGAGGG + Intergenic
1100001497 12:89842476-89842498 AGAAGGCTGGAGGGAAGTTCAGG + Intergenic
1100702051 12:97159558-97159580 GGAAAGCTGGAGCCAGGTCTTGG + Intergenic
1100777058 12:97986664-97986686 ACAATGCTGGAGGCAGGTGATGG + Intergenic
1101062684 12:100988321-100988343 TGATGGCTGGATGCAGGGCAGGG + Intronic
1101420311 12:104545282-104545304 AGAAGCCCTGAGGCAGCTCATGG - Intronic
1101722427 12:107361692-107361714 TGTAGACTGGGGGCAGGTCAGGG + Intronic
1101733302 12:107444133-107444155 AGAAGGCTGGCGGAAGGTCAGGG + Intronic
1102018958 12:109668430-109668452 AGAACTCTGGAGGCTGGGCATGG - Intergenic
1102093599 12:110216483-110216505 AGGAGGCTGGGGGCTGGGCACGG - Intronic
1103250723 12:119497667-119497689 AGAAGGCTGGAGGCTCAGCAGGG + Intronic
1103795341 12:123499382-123499404 GGGAGGGTGGACGCAGGTCAGGG + Intronic
1103826928 12:123746552-123746574 AGATTGCTTGAGCCAGGTCAAGG + Intronic
1103917851 12:124385220-124385242 GGAGGGCTTGAGGCAGGCCACGG - Intronic
1104157314 12:126146129-126146151 AGAAGGCTGAGGGCAAGTGAGGG + Intergenic
1104755105 12:131264356-131264378 AGAGGGCTGGAGGCCCCTCAAGG + Intergenic
1104973081 12:132540320-132540342 AGAGGGCTGGGGGCAGGACTGGG - Intronic
1105219476 13:18312346-18312368 AGAAGGCTGGAGGCAGGTCAGGG + Intergenic
1105302916 13:19151681-19151703 AGCAGGCTGGAGGCGGGTAGAGG + Intergenic
1106101054 13:26695436-26695458 AGAAGTCAGGGGGCAGGACACGG - Intergenic
1108086728 13:46801174-46801196 AGAGAGCTGGAGGGAGGACATGG - Intergenic
1110248889 13:73358906-73358928 AGGAGGGTGGAGGCAGGAGAAGG - Intergenic
1111512463 13:89284608-89284630 ATAAGTCTAGAGGCAGGACATGG - Intergenic
1112280363 13:98057641-98057663 AGAAGGTGGGAGGGAGGTGAGGG - Intergenic
1113372872 13:109738609-109738631 CGCAGGCTGGATGCAGGGCAGGG + Intergenic
1113426549 13:110213120-110213142 GGAAGGCTGGAAGGAGGTGAGGG + Intronic
1113804236 13:113104085-113104107 AGAGGGCTGCATGCAGGTGAGGG + Intergenic
1114492543 14:23112536-23112558 AGAAGGCAGGAGGGAGGTGAGGG + Intergenic
1115280712 14:31659440-31659462 AATAGGCTGGAGGCAGGAAATGG + Intronic
1116950831 14:50877126-50877148 ACAGGGCTGGAGCCTGGTCAGGG - Intronic
1117495180 14:56295362-56295384 ACAAGGATGGACGCAGTTCAGGG - Intronic
1117646985 14:57863684-57863706 AGAAAGCTGGAGGAGGGCCAGGG - Intronic
1118808258 14:69256219-69256241 AGCAGGCTGGAGGCAAGGCAGGG - Intergenic
1118910918 14:70061227-70061249 AGAAGGCAGAAGGCGGGTAATGG + Intronic
1119372571 14:74159860-74159882 AGACAGCTGTAGGCAGGGCACGG - Intronic
1120751627 14:88203440-88203462 AGCTGCCTCGAGGCAGGTCAAGG + Intronic
1120860524 14:89251189-89251211 AGAAGGCTGGAGGCTAGAAAAGG - Intronic
1121449125 14:93996569-93996591 AGGAGGCAGGAGCCAGGGCAGGG - Intergenic
1122429303 14:101629858-101629880 AGAAGGCGGGAGGAAAGTCAGGG - Intergenic
1122878464 14:104679391-104679413 AGCTGGCTGGAGCCAGGTCAGGG + Intergenic
1123222581 14:106870894-106870916 AGAAGGATGGAGGCAGGATATGG + Intergenic
1202904660 14_GL000194v1_random:61139-61161 AGAAAGCAGGAGGTAGGGCATGG + Intergenic
1125028434 15:35053290-35053312 AAGCGGCTGGAGGCAGGGCACGG - Intergenic
1125355339 15:38811783-38811805 AGATGGCTGGTAGCAGGACAGGG - Intergenic
1126102471 15:45128231-45128253 AGAAGGCTGGAGGTTGTTCTAGG - Intronic
1126640902 15:50825865-50825887 AGTAGGCTTGAAGCAGGCCAAGG - Intergenic
1126696324 15:51329177-51329199 AGAAGGGAGGAGGCAGGCCAGGG - Intronic
1128452482 15:67813754-67813776 AGATGGCTGGAGGCAGGCAGGGG - Intergenic
1128511314 15:68315644-68315666 AGCTCGCTGCAGGCAGGTCAGGG - Exonic
1128684059 15:69670882-69670904 CAAAGTCTGGAGGCAGGGCAGGG - Intergenic
1128746676 15:70119808-70119830 AGAAGCCTGGAGCAAGGCCAAGG - Intergenic
1129000879 15:72332804-72332826 AGAAGGCTGGAGGCTGGGCATGG - Intronic
1129204036 15:74024821-74024843 AGAAGGTCACAGGCAGGTCAAGG - Intronic
1130423847 15:83775535-83775557 AGAAGGCTGAAGGTAGGGAAGGG + Intronic
1130896864 15:88177489-88177511 AGAAGGGAGTAGGCAGGTAAAGG + Intronic
1131476878 15:92747317-92747339 AGAAGGATGGAGGCAGGGACTGG - Intronic
1131960840 15:97788830-97788852 TGCAGGCTGGAAGCACGTCAGGG - Intergenic
1132399679 15:101497653-101497675 AGAAAGCTGGGGACAGGGCAGGG - Intronic
1132658838 16:1052705-1052727 AGGAGGCAGGAGGGAGGACATGG + Intergenic
1132837702 16:1962714-1962736 GGTAGGCTGGTGGCAGGTGATGG - Exonic
1133271469 16:4612796-4612818 GGGAGGCTGGAGGAAGGTGACGG - Intronic
1133345176 16:5065178-5065200 AGGGGGCTGGAGACAGGCCAAGG - Intronic
1133776873 16:8903587-8903609 AGGAGGCTGTGGGCAGGGCACGG + Intronic
1134429124 16:14184796-14184818 AGAAGACAGAAGGCAGGGCAAGG + Intronic
1134457598 16:14406080-14406102 ACAAGGCGGGGCGCAGGTCAGGG + Intergenic
1134554354 16:15153838-15153860 ATGAGGCTGGAGGCTGGCCACGG - Intergenic
1135660958 16:24296182-24296204 AGAAGGCAGGAGGAAGGACCAGG - Intronic
1135958016 16:26972434-26972456 GGAAGGCTGGAGGTAGGAAAGGG - Intergenic
1136144039 16:28305171-28305193 AGAAACCTTGAGGCAGGTGAGGG - Intronic
1136265731 16:29117034-29117056 AGAAGGCTACAGCCAGGCCAGGG - Intergenic
1136484373 16:30561766-30561788 AGATGGCTGGCGGCTGGGCACGG + Intergenic
1137426452 16:48384999-48385021 CGAAGGCTGAAGGCAGGGGAGGG + Intronic
1137629001 16:49928850-49928872 AGAAAGCTGCAAGCAGGTCTTGG - Intergenic
1137842047 16:51649800-51649822 AGCAAGCTGGAGGCAGGCGAGGG - Intergenic
1138148082 16:54630059-54630081 GGCAGGCTGGAGGCAGGGAAGGG + Intergenic
1138167567 16:54817495-54817517 GGAATGCTGGAGGCTGGTCCCGG + Intergenic
1139442863 16:66977520-66977542 AGAGGGCTGGAGCTAGGACAGGG - Intergenic
1139490755 16:67284814-67284836 AGTGGGCAGGAGGCAAGTCAGGG - Exonic
1139587572 16:67914002-67914024 AGAAAGCAGGAGGCAGGCCTGGG + Intronic
1140320882 16:73950737-73950759 AGCAGTCTGGAGGGAGGTCTGGG - Intergenic
1140478370 16:75250197-75250219 AGCTGGGTGGAGGCAGGGCAGGG - Intronic
1140593331 16:76378678-76378700 AGAAAGCTGGAGTGTGGTCAGGG - Intronic
1141004924 16:80343233-80343255 AGGAGACTGGAGGCCGGGCATGG + Intergenic
1141187596 16:81798935-81798957 TGGAGGCTGGTGGCAGGCCAGGG - Intronic
1141464592 16:84197344-84197366 ACAGGGCTGGAGGCAGGTTTAGG + Intergenic
1141600021 16:85120015-85120037 AGAAGGCTGCATGGAGGTCAGGG - Intergenic
1142045847 16:87924815-87924837 AGAAGCGTGGAAGCAGGTCCGGG + Intronic
1142054549 16:87984968-87984990 AGAAGGCTACAGCCAGGCCAGGG - Intronic
1142666845 17:1468182-1468204 TGAGAGCTGAAGGCAGGTCAGGG - Intronic
1142909193 17:3072527-3072549 AGAAGGTAGGAGGGAGGTGATGG + Intergenic
1142925367 17:3231711-3231733 AGAAGGTAGGAGGGAGGTGATGG - Intergenic
1143276225 17:5712982-5713004 AGAAGGCTGGAGACGGGGCAGGG + Intergenic
1143399813 17:6636963-6636985 AGAATGCTCTAGGCATGTCAGGG - Intronic
1144624318 17:16837044-16837066 GGAAGGCAGGAGGCAGCTTAGGG + Intergenic
1144882111 17:18435676-18435698 GGAAGGCAGGAGGCAGCTTAGGG - Intergenic
1145150122 17:20508710-20508732 GGAAGGCAGGAGGCAGCTTAGGG + Intergenic
1145736966 17:27239912-27239934 AGAAGTCTGAAGGAAGGGCAGGG - Intergenic
1145820426 17:27829639-27829661 AGAAGGCTGGAAGCAGGAGATGG + Intronic
1145821515 17:27840184-27840206 AGAAGGCTGGAAGCAGGAGATGG - Intronic
1146514359 17:33477866-33477888 TAGAGGCTGGAGGCAGCTCAGGG + Intronic
1146574900 17:33982328-33982350 AGAAGGCTGGAGACAGTTACTGG + Intronic
1147250748 17:39151446-39151468 AGCAGGCCGGGGGCAGGTCCGGG - Exonic
1147566651 17:41540534-41540556 CAAAGGCAGGAGGCAGGCCAGGG + Intergenic
1147600182 17:41740356-41740378 AGCAGGCTGGACGCAGCTGACGG - Intergenic
1148093751 17:45038438-45038460 CAAAGGCTGGATGCAGTTCAGGG + Intronic
1148219164 17:45850011-45850033 ACGGGGCTGGAGGCAGGTGATGG + Intergenic
1148577133 17:48720024-48720046 CAAAGGCTGGACGCAGGTCTCGG + Intergenic
1148661669 17:49338974-49338996 AGGAGGCTGGTGGAAGGACAAGG - Intronic
1148857112 17:50584807-50584829 AGAAGGATTGAGGCAGCTCCTGG + Intronic
1148889080 17:50794732-50794754 AGATGGCAGGGGGCAGGGCATGG + Intergenic
1150793736 17:68221437-68221459 AGAAAGCCAGAGGCAGGGCACGG + Intergenic
1151169515 17:72235162-72235184 GGAAGGCTGGTGGCAGGGAAGGG + Intergenic
1151240132 17:72750954-72750976 AGAAGGCAGGAGGCTGTGCATGG + Intronic
1151503924 17:74513562-74513584 AGCAGGCAGGAGGCAGCTCATGG + Intergenic
1151748342 17:76023425-76023447 AGAAGGTGGCCGGCAGGTCAGGG + Intronic
1151893408 17:76964328-76964350 GCAAGGCTGGATGCAGGGCAGGG + Intergenic
1152282952 17:79396151-79396173 AGAAGGTGGGAGGCAGGTTTTGG - Intronic
1153070678 18:1101004-1101026 AAAAGGCTGGGGGCATGTCAAGG - Intergenic
1153073262 18:1131536-1131558 AGGAGGATGGAGGGAGGTAAGGG + Intergenic
1153330457 18:3868193-3868215 AGAAGGCTGGAGGAGTGTTATGG + Intronic
1153923388 18:9811216-9811238 AGAAGGTTGGACGAAGCTCAGGG - Intronic
1154113757 18:11593012-11593034 AGTAGGCTGGATGCAGGAAAGGG + Intergenic
1154345921 18:13543439-13543461 AGTGTGCTGGAGGCAGGACAAGG + Intronic
1155298725 18:24409315-24409337 AAAAGTCTGGAGTCAGGACAAGG + Intergenic
1155877209 18:31101974-31101996 AGAGGGCTCGGGGCAGGTCGCGG + Exonic
1156580601 18:38370462-38370484 GGAAGGCAGGAGGCAGGACCTGG + Intergenic
1156847192 18:41680085-41680107 AGAAGGCAGCAGGAAGTTCAGGG - Intergenic
1156925682 18:42575101-42575123 AGAAGGCTGGCAGCAGGCCAGGG + Intergenic
1157549396 18:48570807-48570829 AGGAGGGTGGAGGGAGGTGAGGG + Intronic
1157802140 18:50629493-50629515 AGAGAGTTGGAGGCAGGTCCAGG + Intronic
1158653354 18:59307392-59307414 AGAAGGTTGGAGGGAAGTGATGG + Intronic
1158702166 18:59758002-59758024 AGAAGGTTGGAGGCTGGCCCGGG - Intergenic
1160048709 18:75411560-75411582 AGAGGCCTGGAGACAGCTCAGGG + Intronic
1160149675 18:76389467-76389489 AGAAAGCAGGAGGCAGCTCTCGG + Intronic
1160384179 18:78485071-78485093 AGGAGGCTGCAGGCAGAGCATGG - Intergenic
1160384246 18:78485407-78485429 AGGAGGCTGCAGGCAGAGCATGG - Intergenic
1160384281 18:78485573-78485595 AGGAGGCTGCAGGCAGAGCATGG - Intergenic
1160384475 18:78486497-78486519 AGGAGGCTGCAGGCAGAGCATGG - Intergenic
1160897468 19:1409361-1409383 AGGAGGCTGGAGAGAGGTGAGGG + Intronic
1160978875 19:1807380-1807402 AGATGGCTGGACCCCGGTCAAGG - Intronic
1161244136 19:3239795-3239817 AGAAGACTGGAGGCCAGTGAGGG - Intronic
1161501003 19:4615704-4615726 AGAGGGCTGTAGGCAGGAGAAGG - Intergenic
1161528634 19:4773251-4773273 AGAGGGCTGGAGGGAGGTCATGG - Intergenic
1161547316 19:4889456-4889478 AGAAGGGTAGAGGCAGGGGACGG + Intergenic
1161620246 19:5293586-5293608 AGGAGGCTGGATGCCGGACAGGG + Intronic
1161858994 19:6783756-6783778 ACAAGAATGGAGGCAGGGCATGG - Intronic
1162050087 19:8027737-8027759 AGAAGGCAGGAGCCAGGACTGGG + Intronic
1162337317 19:10069995-10070017 AAAAGTCTGGTGGCAGGACAGGG + Intergenic
1163157081 19:15445464-15445486 AGAAGGCTGGTGGGAGGCCTGGG + Intronic
1163348861 19:16762716-16762738 GGGAGGCTGGAGGCAGGACCAGG + Intronic
1163494779 19:17639932-17639954 GGATGGATGGAGGCAGGACATGG + Intronic
1164426036 19:28142647-28142669 AGAAGGCAGGAGGGAGGGAAGGG + Intergenic
1164650827 19:29890251-29890273 AGAAGTCTGGAGGGAGGAAATGG - Intergenic
1164913773 19:32033439-32033461 AGAGGACTGGAGACAAGTCATGG - Intergenic
1165005564 19:32803625-32803647 AGAGGGCAAGTGGCAGGTCATGG + Intronic
1165316157 19:35056582-35056604 AGAAGGCTAGAGGGAGCTCCCGG - Intronic
1165406228 19:35632955-35632977 CGAAGGCTGGACGCAGGATAGGG - Exonic
1166108650 19:40610015-40610037 AGCTGGGTGGAGGCGGGTCAGGG - Intronic
1166672871 19:44722142-44722164 AGAAGGCTGCAGGCAGGGCTGGG + Intergenic
1166705020 19:44903755-44903777 AGGCGGCTGGGGGAAGGTCAGGG - Intergenic
1167448937 19:49556069-49556091 GGAGGGCTGGAGGCAGGGAAGGG + Intronic
1168273434 19:55262727-55262749 AGAATGCTGGAGGCAGGGTCCGG - Intronic
1168274632 19:55270579-55270601 AAAAGGACAGAGGCAGGTCAAGG + Intronic
1168492177 19:56820484-56820506 AGAAGGCTGGAGGCATGTGTGGG - Intronic
1168578884 19:57536764-57536786 AGGGAGCTGGAGTCAGGTCAAGG - Intronic
925048152 2:790026-790048 GGGAGGCTGAAGGCAGCTCAGGG + Intergenic
925069333 2:954208-954230 AGAAGGAAGGAGGGAGATCAGGG + Intronic
925364308 2:3301304-3301326 ACAAGCATGGAGGCAGGTCCCGG + Intronic
925404743 2:3598732-3598754 AGGAGGCTGGAGGCGGGCCGTGG + Intronic
925982830 2:9191112-9191134 AGTATGCTGGAGACAGGGCATGG - Intergenic
926164027 2:10507005-10507027 GGTAAGTTGGAGGCAGGTCATGG + Intergenic
927562142 2:24081603-24081625 ATGAGGCTGGAGCCAGATCATGG - Intronic
928333744 2:30377841-30377863 AGAACTGTGGAGGCAGGTGAAGG - Intergenic
929581221 2:43082777-43082799 AGGAGGGTGGAGGCAGCTGAGGG + Intergenic
929595899 2:43175643-43175665 AGAAGGATGGAGGCAGGGAGAGG + Intergenic
930092084 2:47538319-47538341 GGCAGGGAGGAGGCAGGTCATGG + Intronic
931755606 2:65371499-65371521 AGAATGATGAAGGCTGGTCAAGG + Intronic
932576939 2:72967753-72967775 AGAAGGCAGGGGGCAGGGGAGGG - Intronic
932885547 2:75546089-75546111 AGGGGGCTGGGGCCAGGTCATGG + Intronic
933082017 2:78002352-78002374 AGAAGATTGGAGGCAGGTAAAGG + Intergenic
933874499 2:86605153-86605175 AGAAAGCTGGGGGCTGGTCAAGG + Exonic
934184572 2:89660171-89660193 AGAAGGCTGGAGGCAGGTCAGGG - Intergenic
934294854 2:91734309-91734331 AGAAGGCTGGAGGCAGGTCAGGG - Intergenic
934315865 2:91919278-91919300 AGAATGCTGAAGGCCGGGCATGG - Intergenic
934854953 2:97723981-97724003 AGAGGGTCGGAGGCACGTCAGGG - Intronic
934882555 2:97996154-97996176 AGAAGGAGGGAGGCAGGCCCAGG + Intergenic
936744993 2:115564887-115564909 GGAGGTCTGGAGGCAGGTCCTGG + Intronic
938055780 2:128213630-128213652 AGACGGCTGGCTGCAAGTCAAGG + Intergenic
938248442 2:129796405-129796427 AGAAAGCTGGTGCCAGGACAGGG + Intergenic
938961871 2:136351515-136351537 CGGGGGCTGGAGGCAGGTCAGGG - Intergenic
939603427 2:144222514-144222536 AGAAAGCTGGAGGCTGGGCGTGG + Intronic
940736330 2:157456920-157456942 AGAATGCTGAATACAGGTCAGGG - Intronic
940855100 2:158723465-158723487 AGAAGGCTGGGGGCAGGGACGGG - Intergenic
941065960 2:160903106-160903128 AGAAGGCAGATGGCAGGGCAGGG - Intergenic
941857326 2:170244396-170244418 AGAAAACTGAAGCCAGGTCAGGG + Intronic
946071265 2:217036125-217036147 GGAAGGGTGGGGGCAGGCCAAGG + Intergenic
946120913 2:217513698-217513720 AGTAGGCTGGGGCCATGTCAGGG + Intronic
946558246 2:220883701-220883723 AGAAGAATGGAGGCTGGGCACGG + Intergenic
947240212 2:227986420-227986442 AAAGGGTTGGAGGCAGGTGAGGG + Intronic
947699302 2:232219018-232219040 AGAGGCCTGGAGGCAGGAAAGGG - Intronic
948023633 2:234758194-234758216 AGAAGGAGGGAGGCGGATCATGG - Intergenic
948121973 2:235537373-235537395 AGAGGGCTGGCGTCAGCTCAGGG + Intronic
948158557 2:235804831-235804853 AGCAGGCTGTATGCAGGGCAGGG + Intronic
948396995 2:237652151-237652173 AGAAGACTGGAGAGAAGTCAGGG + Intronic
948770260 2:240248156-240248178 AGCAGGCTGGAAACAGGCCAGGG + Intergenic
948785434 2:240350026-240350048 TGCAGGCTGGAGGCGGGTGATGG + Intergenic
948906595 2:240982542-240982564 CCAAGGCTGGAGGCAGGGCAGGG + Intronic
1168960376 20:1865010-1865032 ACAAGGCTGGAGGCAGCACGAGG - Intergenic
1169210790 20:3765299-3765321 AGGAGGCTGGAGGCAGGGCCAGG - Intronic
1169376820 20:5073029-5073051 GGAATGAAGGAGGCAGGTCAGGG + Intronic
1169786597 20:9366097-9366119 AAAAGGCTTGAGGCAGGGCATGG + Intronic
1169898954 20:10534006-10534028 AAAAGGCTGGAGGAAGATCTGGG - Intronic
1170116924 20:12870529-12870551 AGGAGACTCGAGGCAGGACATGG + Intergenic
1170560470 20:17552905-17552927 AGAAATCTGGAGAGAGGTCAAGG + Intronic
1170570268 20:17628623-17628645 AGAAGGCTGGTGGCGGGGCAGGG - Intronic
1170739165 20:19038935-19038957 AGAACGCTGGACACAGGGCAGGG + Intergenic
1171349704 20:24492999-24493021 ACAAGGCTTCAGGCAGGTAAGGG + Intronic
1171456322 20:25274748-25274770 GCAAGGCTGGAGCCAGGTGAGGG + Intronic
1172183109 20:33015646-33015668 AAAAGGCTGGTGCCAGGTCCAGG + Intronic
1172620099 20:36313097-36313119 AGAAGCCAGGCGGCAGGTCAGGG - Intronic
1172683425 20:36735080-36735102 TGACAGCTGGAGGCTGGTCATGG + Intronic
1172842870 20:37912563-37912585 GGGAGCCTGGGGGCAGGTCAGGG + Intronic
1172874635 20:38156728-38156750 AAAAGGCTGTAGGAAGGTGAGGG - Intronic
1173849942 20:46211417-46211439 AACAGGCTGGAGGCAGGACACGG - Intronic
1173872309 20:46349856-46349878 AGAAGGCTCCAGGCAGGGAAAGG + Exonic
1175124140 20:56739148-56739170 AGAAGGATGGAGGAAGGCCAAGG - Intergenic
1175352720 20:58336834-58336856 AGAAGGCTCCAGGCAGGTGAAGG - Intronic
1175389269 20:58616036-58616058 AGTGGGGTGGAGGCAGATCAAGG + Intergenic
1175412250 20:58777911-58777933 GGAAGGGTGGAGGCTGGTGAGGG - Intergenic
1175940209 20:62534311-62534333 TGGAGGCTGGAGGCAGCTCTTGG + Intergenic
1176055894 20:63148909-63148931 AGGAGACTGGAGGCAGCTCCAGG + Intergenic
1176143865 20:63556932-63556954 GGAAGGCCGGAGCCCGGTCACGG - Intergenic
1176424167 21:6537735-6537757 AGAAGGAGGGAGGCAGGTCCAGG + Intergenic
1176624030 21:9075906-9075928 AGAAAGCAGGAGGTAGGGCATGG + Intergenic
1176958152 21:15129756-15129778 ATTCGGCTGGAGGCAGGGCAGGG + Intergenic
1178342085 21:31794230-31794252 AGAAGGATGGCGGCATGGCAGGG + Intergenic
1178528816 21:33357389-33357411 AGAAGCCAGGCGGCAGGTCTGGG - Exonic
1178550838 21:33537950-33537972 ATAAGGGTGGAGGCTGGGCACGG + Intronic
1179028739 21:37701822-37701844 AGCAGGCAGGAGCCAGGCCAGGG + Intronic
1179576231 21:42310140-42310162 AGACGGTCGGAGGCAGGACACGG + Intergenic
1179699660 21:43146050-43146072 AGAAGGAGGGAGGCAGGTCCAGG + Intergenic
1180022646 21:45138258-45138280 AGAAGGTTGGAGAAACGTCACGG - Intronic
1180542634 22:16465151-16465173 AGAATGCTGAAGGCCGGGCATGG - Intergenic
1180614259 22:17117607-17117629 AGAAGGCCGGAGGGAGGGCTTGG - Exonic
1180725447 22:17943457-17943479 AGAAGGATAGATGCAGCTCAGGG - Intronic
1180761987 22:18217491-18217513 ACAGGACTGGAGCCAGGTCATGG - Intergenic
1180773680 22:18407119-18407141 ACAGGACTGGAGCCAGGTCATGG + Intergenic
1180805029 22:18656663-18656685 ACAGGACTGGAGCCAGGTCATGG + Intergenic
1180805714 22:18712745-18712767 ACAGGACTGGAGCCAGGTCATGG - Intergenic
1180817078 22:18797206-18797228 AGAAGGCTGGAGGCAGGTCAGGG + Intergenic
1181069736 22:20325836-20325858 ACAGGACTGGAGCCAGGTCATGG + Intergenic
1181192779 22:21154044-21154066 ACAGGACTGGAGCCAGGTCATGG + Intergenic
1181203267 22:21231551-21231573 AGAAGGCTGGAGGCAGGTCAGGG + Intergenic
1181216663 22:21338530-21338552 ACAGGACTGGAGCCAGGTCATGG - Intergenic
1181463368 22:23098101-23098123 AGAGGGCTGCAGGCAGGCAAAGG - Intronic
1182101837 22:27662977-27662999 AGAGGGCTGGAGGGAGGGCAGGG + Intergenic
1182287265 22:29255741-29255763 AGGAGGTTGGAGGGGGGTCAGGG + Intronic
1182323138 22:29491318-29491340 GGAAGGCTGGGGGCAGGGCAGGG + Exonic
1182994455 22:34799941-34799963 TGAAGGATGGAGGGAGGTGATGG + Intergenic
1183453456 22:37908829-37908851 AGATGGCAGGAGCCAGGTGAGGG + Intronic
1185089741 22:48759141-48759163 AGATGGCTGGAGACAGCCCAAGG + Intronic
1185161281 22:49231392-49231414 TGAGGGATGCAGGCAGGTCAAGG - Intergenic
1203223652 22_KI270731v1_random:63873-63895 AGAAGGCTGGAGGCAGGTCAGGG - Intergenic
1203235510 22_KI270731v1_random:148093-148115 ACAGGACTGGAGCCAGGTCATGG + Intergenic
1203267177 22_KI270734v1_random:22927-22949 AGAAGGCTGGAGGCAGGTCAGGG + Intergenic
949832158 3:8226396-8226418 AGAAGGATGGACGCAGGTGGAGG - Intergenic
950019430 3:9776677-9776699 AGAAGACTGCAGGCCGGGCACGG - Intronic
950207349 3:11091413-11091435 TGGAGGCCGGAGGCTGGTCAGGG - Intergenic
950409024 3:12822587-12822609 AGAATGATGGAGGCTGGGCACGG - Intronic
950681623 3:14588937-14588959 AGAGGGATGGAGGCAGGTTTTGG - Intergenic
951080059 3:18443648-18443670 AGCAGGCAGGTGGCAGGTCCGGG - Intronic
951733593 3:25837400-25837422 ACAAGGCTAGAGCCTGGTCATGG - Intergenic
952029860 3:29128753-29128775 AAAAGGCAGGGGGTAGGTCATGG - Intergenic
952837943 3:37620319-37620341 AGCAGGCTGGAACCAGGTCACGG - Intronic
953577110 3:44121687-44121709 AGAAGCCTGGAGGGAGTCCAGGG + Intergenic
959622750 3:108415838-108415860 AGGAGGCTGGAGCCAGATCAGGG + Intronic
960406164 3:117262422-117262444 AAGAGGCTGGAGCCAGGTCATGG - Intergenic
960944340 3:122956078-122956100 AGCAGGCCCGAGGCAGGGCAAGG - Intronic
961381967 3:126501032-126501054 GGAAGGCTGTGGGCAGGGCAGGG + Intronic
961386518 3:126526095-126526117 TGATGGCTGGAGACAGGCCATGG - Intronic
961795150 3:129403767-129403789 AAAGGGCTGGAGGCAGGTCCCGG + Intronic
962240955 3:133750481-133750503 AGAAGGCTGGAGGGAAGCCAAGG - Intronic
963102955 3:141623294-141623316 AGAGGGCTGGGGGAAGGACAGGG - Intergenic
963681354 3:148381828-148381850 AGATAGCAGGAGGCAGGTTATGG + Intergenic
963763471 3:149308830-149308852 AGAATCCTGGAGGCAGTTCCTGG - Intergenic
965426611 3:168532236-168532258 AGAAAGCTGGAGGATGGTGAGGG + Intergenic
965631032 3:170732907-170732929 AGAAAGCTGGAACTAGGTCATGG + Intronic
965754944 3:172016172-172016194 AGAAGTCTGGAGACAAGTCTAGG + Intergenic
967912571 3:194554613-194554635 AGGAGGCAGGAGGCATGGCAAGG + Intergenic
968431240 4:560324-560346 AGAGGTCTGGAGGTAGGTCGTGG + Intergenic
968577437 4:1374446-1374468 AGGAGGGGAGAGGCAGGTCAGGG + Intronic
968945436 4:3661161-3661183 TGCAGGCTGGAGGCAGGTTGGGG + Intergenic
969313338 4:6366963-6366985 AGAAGGCTCTGGGCAGGACAGGG + Intronic
969459384 4:7320727-7320749 GGAAGGCTGGGGAAAGGTCAAGG + Intronic
969587334 4:8101990-8102012 AGGAGGCTAGAGGCAGGTGCGGG - Intronic
969689254 4:8695103-8695125 GGAAGGCTGCAGGCAGGAAAGGG + Intergenic
971276535 4:25203182-25203204 AGTAGGATGGAGGCAGGCAAGGG - Intronic
973603370 4:52563209-52563231 ACAGGGCTGGAGGCGGGTCAAGG - Intergenic
973604289 4:52571217-52571239 AGCAGGATGGAGGCTGGGCAAGG - Intergenic
974401357 4:61412166-61412188 GGAAGACTTGAGCCAGGTCAAGG - Intronic
975272234 4:72449499-72449521 AGAAAGCTGGAAGGAGGTAATGG - Intronic
975830161 4:78360740-78360762 AGGAAGCTGGAGCCAGGTTATGG - Intronic
976195732 4:82529643-82529665 TGAGGGCTGGAGAGAGGTCAAGG + Intronic
978318954 4:107472127-107472149 TGAAGGATGGAGGCAATTCATGG + Intergenic
981097832 4:140799664-140799686 GGAAGGCGGGAGGAAGATCAGGG - Intergenic
982217658 4:153095997-153096019 GGAAGGCTGGAGGCTGGGCCTGG + Intergenic
982305186 4:153923251-153923273 AGCAGGCTGAAGACAGGACATGG - Intergenic
982306292 4:153934587-153934609 AGAAGGGTGAAGACAGGGCAGGG - Intergenic
982325494 4:154125075-154125097 AGGAGGCTGGAGGCAGAGAAGGG + Intergenic
983867907 4:172790110-172790132 AGAAGCCTGGAGACAGGTGAAGG + Intronic
984806796 4:183758557-183758579 GGAAGGCTGGGGACAGGGCAGGG + Intergenic
985024317 4:185724652-185724674 AGGAGAATGGAGTCAGGTCATGG - Intronic
985231934 4:187827836-187827858 TGCTGGCTGGAGGCAGGCCAGGG - Intergenic
986004228 5:3654704-3654726 AGAAGGATGGAGGCAGCTCCAGG - Intergenic
986163711 5:5253776-5253798 CGAAGGCTGCAGGGAGGCCAGGG - Intronic
986724021 5:10581008-10581030 CCAAGGCTGGAGGCAGGACGAGG - Intronic
987051529 5:14150329-14150351 AGGGGGCAGGAGGCAGGTGAAGG + Intronic
987056717 5:14200218-14200240 AGAAGGATGGAGGCATATAATGG - Intronic
987105720 5:14637160-14637182 AAAAGGCTGCAGGGCGGTCAAGG - Intergenic
989034603 5:37156790-37156812 AGAAGGAGGGAGGAAGGTAAGGG + Intronic
989368373 5:40680399-40680421 AGCAGGTTGGAGGCGGGTCCAGG + Exonic
990610485 5:57452062-57452084 AGAATGTTGGAGGCAGCTGATGG + Intergenic
991645426 5:68796149-68796171 AAAAGGCTAGAGAGAGGTCAGGG - Intergenic
993852005 5:93022215-93022237 TGAAGGCTGGAGACAGATGAGGG + Intergenic
994250497 5:97531382-97531404 AAAAGGCTGGAGGCAGGAGCAGG + Intergenic
996208402 5:120773274-120773296 AGAAGCCTTGAGGCAGATGAGGG + Intergenic
996678832 5:126208030-126208052 AAAGGGCAGGAGGCAGGTGAAGG + Intergenic
997349999 5:133224098-133224120 GGAAAGCTGGTGGCAGATCATGG + Intronic
997634305 5:135393486-135393508 ACAAGGCTGGATGCAGAACATGG - Intronic
998227193 5:140336150-140336172 AGAAGGATGGAGGATGGGCAGGG - Intronic
998306109 5:141078537-141078559 AGAAGCCTGGAGGCCGGGCGCGG - Intergenic
998317603 5:141198078-141198100 AGAAGGCTGAAGTCAAGTAAGGG - Intergenic
998331054 5:141327520-141327542 AGAAGACTGGAGGCAGTTTGAGG + Intergenic
998596361 5:143534624-143534646 AGATGACTGGAGGCAATTCATGG + Intergenic
1000171179 5:158704603-158704625 AAAAGGATGAAGGCAGGTTATGG - Intronic
1000250554 5:159490696-159490718 TGAAGCCTGGAGGCATATCAAGG - Intergenic
1000876603 5:166646883-166646905 AGAAAGCAGAAGGCAGGTCTAGG - Intergenic
1002603915 5:180370838-180370860 GGAAGCCTGCAGGCAGGGCAGGG + Intergenic
1002804777 6:562110-562132 AGAAGGATGGAGGCAGCCCTGGG + Intronic
1003466477 6:6384546-6384568 ACAAGGCTGGAGTCAGCTGAGGG + Intergenic
1004443397 6:15675039-15675061 AGAAGGCTGTCTGCTGGTCAAGG - Intergenic
1004761501 6:18671663-18671685 TGAAGACTGGAGCCAGGTGATGG - Intergenic
1004865141 6:19846017-19846039 AGAAACCTGGAGGCCGGGCACGG + Intergenic
1006289745 6:33125637-33125659 ACAAGGCTGGAGGCCGGGCGCGG + Intergenic
1006427710 6:33976536-33976558 AGAAGCCTGGTGGCAGGTCTTGG + Intergenic
1006521039 6:34571441-34571463 AGAAAAATGGAGGCAGGGCAGGG + Intergenic
1006831435 6:36970552-36970574 TAATGGCTGGAGGCAGGTCTTGG - Intronic
1007272912 6:40651777-40651799 AGAAGGCTGGAGGAAGAACCTGG - Intergenic
1007588646 6:43008147-43008169 AGAATGCTGGAGGGACATCAGGG + Intronic
1007762304 6:44140129-44140151 AGAAGGCTGGTGGCAGTAGAGGG + Intronic
1007809156 6:44474193-44474215 AGAAGGCTGGTGGCAGATCCTGG + Intergenic
1007809191 6:44474301-44474323 AGAAGGCTGGTGGCAGATCCTGG + Intergenic
1007809207 6:44474355-44474377 AGAGGGCTGGTGGCAGATCCTGG + Intergenic
1007824613 6:44590704-44590726 ACACAGCTGAAGGCAGGTCATGG - Intergenic
1007921913 6:45617860-45617882 AGAAGGCTGAAGGCATGGTAGGG + Intronic
1008577360 6:52873970-52873992 AGAAGGCTGGTGTCAGAACATGG + Intronic
1015117617 6:129666629-129666651 GGAAGGGTGGAGGCAGGCCCTGG - Intronic
1015590595 6:134819200-134819222 TGAAGCCTGGTGGCAGGTGAAGG - Intergenic
1018031527 6:159845362-159845384 AGGAGGCTGCAGGCAGGGCCAGG - Intergenic
1018443192 6:163832423-163832445 AGAAGCATGGAGGGAGCTCATGG + Intergenic
1019117221 6:169774797-169774819 AGAAGGCTGGAAGTTGGCCAGGG + Intronic
1019253801 7:35622-35644 AGAAGGTTGGAGGCAGCTCCTGG - Intergenic
1019283295 7:211241-211263 AGGAGGCTGGGGGGAGGTCCAGG - Intronic
1019409488 7:900379-900401 GGAGGGCTGCAGGCACGTCAGGG + Intronic
1019994504 7:4715429-4715451 AGAAGGAGGGAGGCAGGGCAAGG - Intronic
1022152172 7:27618957-27618979 TGAAGCCTGGTGGGAGGTCACGG - Intronic
1022349330 7:29552574-29552596 TGGAGGCTGGGGGCAGGTTAGGG + Intergenic
1023048684 7:36233241-36233263 ATATGCCTGGTGGCAGGTCAAGG - Intronic
1024042320 7:45565123-45565145 AGAAGGCTGCAGGCAGGATTGGG - Intergenic
1024571801 7:50729465-50729487 AAAAGCCTGGAGGCTGGACATGG + Intronic
1024659201 7:51476744-51476766 GGAAGGCTGGAGGCAGAGGAGGG + Intergenic
1024741584 7:52360717-52360739 AGTAGGCTGGAGCCAGGGCCAGG + Intergenic
1025150038 7:56540517-56540539 AGAAGGATGGAGGCATCTGAGGG - Intergenic
1026206414 7:68261559-68261581 AGAAAGCTGGAGGCCAGGCATGG + Intergenic
1026766093 7:73160784-73160806 TGAAGGCTGGAGGCACGCTAGGG - Intergenic
1026848731 7:73711952-73711974 AGAAGGCTGAAGGCTGGACCAGG + Intronic
1026890510 7:73979050-73979072 AGAAGGCTAGCCCCAGGTCAGGG - Intergenic
1027042568 7:74970480-74970502 TGAAGGCTGGAGGCACGCTAGGG - Intronic
1027081075 7:75231877-75231899 TGAAGGCTGGAGGCACGCTAGGG + Intergenic
1029994742 7:104996467-104996489 AAAAGGCAAGAGGCAGATCATGG + Intergenic
1030289487 7:107858224-107858246 ATAAGACTGGAGGCAGGAGATGG - Intergenic
1030405064 7:109100387-109100409 AGAATTCTGAAGGCAGGCCAAGG - Intergenic
1031996196 7:128233007-128233029 AGGAGGCAGGAGGCAGTTCCCGG + Intergenic
1033187667 7:139243655-139243677 GTAAGGCAGGAGGCAGGTCAGGG + Intronic
1033209059 7:139446812-139446834 AGAGGGAGGCAGGCAGGTCAGGG - Intergenic
1033508560 7:142030769-142030791 GGAAGGCTGGAGGCTGGTGGAGG + Intronic
1033663724 7:143422165-143422187 AGGAGGCTGGTGGCAGGTCATGG + Intergenic
1033680459 7:143589413-143589435 AGAATGAAGGAGGCAGGTGATGG + Intergenic
1033704435 7:143872399-143872421 AGAATGAAGGAGGCAGGTGATGG - Intronic
1034271151 7:149803933-149803955 AGAAGGCGGGAGTGAGGGCAGGG + Intergenic
1034532684 7:151706573-151706595 TCAAAGCAGGAGGCAGGTCAGGG - Intronic
1036703972 8:11032756-11032778 AGAGGGCAGGAGGCAGGGCTTGG - Intronic
1036707285 8:11055271-11055293 TGGAGGCTGCAGGCAGGCCAAGG + Intronic
1036790056 8:11711259-11711281 AGAAGGCAGGTGGCAGTTCTTGG - Intronic
1036814982 8:11895408-11895430 ATAGAGATGGAGGCAGGTCATGG - Intergenic
1037880719 8:22572162-22572184 AGAGGGCAGGAGGCAGGCCTGGG + Intronic
1038565358 8:28615862-28615884 AGAAAGCTGCAGGCCGGACATGG - Intronic
1038754689 8:30329697-30329719 AGAAGACTGGAGCCAGACCATGG + Intergenic
1039044491 8:33437518-33437540 AGGAGTCTGAAGGCAGGGCATGG + Intronic
1040053922 8:43041315-43041337 AGAAGGCTAGGGGCCGGGCACGG - Intronic
1041410268 8:57546058-57546080 ACAAGGGTGGTGGCAGATCATGG - Intergenic
1041626182 8:60029989-60030011 AGAGAGGTGGAGGCAGGTGAGGG - Intergenic
1041707260 8:60859772-60859794 AGAAGGCAGGATGCAAATCATGG + Intronic
1041755614 8:61310040-61310062 AGAAGGGAGGAGGCAAGCCAGGG + Intronic
1043360462 8:79466052-79466074 AGAAGGCTGGAGCTTGGTCTTGG + Intergenic
1044132515 8:88542748-88542770 AGAAGGCTGGAGGTATGTTAAGG + Intergenic
1045349976 8:101329748-101329770 GGAAGGAGGGAGGCAGGACAGGG - Intergenic
1047413170 8:124640830-124640852 AGAAGGGTTGAGGCCGGGCACGG - Intronic
1047923708 8:129661373-129661395 AGCAGGCTTGAATCAGGTCAGGG - Intergenic
1048016432 8:130501477-130501499 AGAAGACTGGAGGAAGAGCAGGG + Intergenic
1048283407 8:133122478-133122500 AGAAAGCTGGAGAGAGGGCAGGG - Intronic
1048826867 8:138436497-138436519 AGAAGGCTGGACTCAGGACCTGG - Intronic
1048873271 8:138816175-138816197 AGGAGACAGGAGGCAGGCCAGGG + Intronic
1049101303 8:140580692-140580714 AGGAGGCAGGAGGTAGGCCAGGG + Intronic
1049209743 8:141380254-141380276 GGGAGGCTGGAGACAGGGCAGGG + Intergenic
1049391927 8:142376096-142376118 TGAAGGTTGCACGCAGGTCAGGG - Intronic
1049406516 8:142453967-142453989 GGAAGGTGGGAGGCAGGACAGGG + Intronic
1049784517 8:144444142-144444164 AGGAGGCGGGAGGCAGGGCCGGG - Intronic
1049788780 8:144463526-144463548 AGTAGGGTGGAGGCAGGGGAGGG - Intronic
1050303790 9:4286102-4286124 CCCAGGCTGGAGGCATGTCAGGG - Exonic
1052271414 9:26631840-26631862 TGAAGGCTGGAGACAGGGAATGG + Intergenic
1052350313 9:27451835-27451857 AGTAGGCTGGAGTCAGGAGAAGG + Intronic
1052391849 9:27888543-27888565 GGAGGTCTGGAGTCAGGTCAAGG - Intergenic
1052727987 9:32253115-32253137 AGAAAGCTGGAGGCCGGGCGCGG + Intergenic
1052736137 9:32344559-32344581 AGAAGGCAGAAGGCAGATGAGGG - Intergenic
1052819861 9:33129903-33129925 AAGTGGCTGGAGGTAGGTCAGGG + Intronic
1052850604 9:33376222-33376244 TGAAGTCTGGAGGCAGGACTGGG + Intergenic
1053218289 9:36290855-36290877 AGAGGGCTGGGAGCAGGTGAAGG + Intronic
1053450687 9:38191972-38191994 AGGAGGCTGGGAGAAGGTCACGG - Intergenic
1054920882 9:70541188-70541210 AGAAGGATGGCTGCAGGGCATGG + Intronic
1056031571 9:82559110-82559132 AGAAAGAAGGAGGCAGGGCAGGG + Intergenic
1056261180 9:84850460-84850482 ATAAAGCTGGAGCCAGGTCATGG + Intronic
1056269528 9:84933379-84933401 ACAAGGCAGGAGGCAGTTAAGGG - Intronic
1056304580 9:85277389-85277411 AGAAGCCTGCAGGAAGGACATGG + Intergenic
1056822216 9:89851280-89851302 AGAAGGCAGTGGGCAGATCATGG + Intergenic
1057290981 9:93807429-93807451 ACCAGGCTGGAAGCAGGTTAGGG - Intergenic
1058718196 9:107740567-107740589 AGAGATCTGGAGGCAGGTCTAGG + Intergenic
1059312392 9:113397353-113397375 AGATGGCTGAAGGCAGCTAAAGG - Intronic
1059483896 9:114612420-114612442 AGCAGGGTGGAGGCAGAGCAGGG - Intronic
1060295174 9:122338386-122338408 ACAAGGCTGGAGGGAGGTGTGGG + Intergenic
1060814461 9:126627306-126627328 AGCAGGCTGAGGGCAGGGCAGGG - Intronic
1061448995 9:130658799-130658821 GGAAGGCAGGAGGCGGCTCAGGG + Intergenic
1061632595 9:131882646-131882668 AGAAGGCAGGGCTCAGGTCAGGG - Intronic
1061965299 9:134010432-134010454 GGAAGGGTGGAGGCTGGGCATGG + Intergenic
1062493313 9:136819378-136819400 AGAAGGCTGGGGGAGGGGCAAGG + Intronic
1062548106 9:137072766-137072788 AAAAGACTGGAGGCCGGGCACGG + Intergenic
1062723991 9:138060936-138060958 AGAAGGCTGGCCACAGGACAGGG - Intronic
1062746597 9:138216921-138216943 AGAAGGTTGGAGGGAGCTCCTGG + Intergenic
1203747213 Un_GL000218v1:46334-46356 AGAAAGCAGGAGGTAGGGCATGG + Intergenic
1203562892 Un_KI270744v1:73146-73168 AGAAAGCAGGAGGTAGGGCATGG - Intergenic
1185648015 X:1628795-1628817 AGAAGGAGAGAGGCAGGTGAAGG - Intronic
1185866930 X:3632384-3632406 AGAACGCTGCGGGCAGGTGAGGG - Intronic
1186196691 X:7116419-7116441 AGAAACCAGGAGGCAGGCCAGGG - Intronic
1186933797 X:14424672-14424694 GGAAGGCTGTAGCCAGATCACGG - Intergenic
1186958416 X:14708557-14708579 TGAACTCTGAAGGCAGGTCACGG - Intronic
1188269439 X:28120398-28120420 AGAAGGCAGAAGGCAGATGAGGG - Intergenic
1188498648 X:30803278-30803300 AGAAGGCACGAAGCAAGTCAAGG - Intergenic
1188498884 X:30804971-30804993 AGAAGGCAGAAGGCAAGGCAAGG - Intergenic
1188699775 X:33243880-33243902 AGAAGGGTGGAGGCATGGGAGGG + Intronic
1188802788 X:34551980-34552002 CAAAGCCTGGAGCCAGGTCAGGG + Intergenic
1189167898 X:38879670-38879692 GGAAGGCAGGAAGCAGGACAGGG + Intergenic
1189269030 X:39737372-39737394 ACAAGGCTGGAGGTAGGTGAGGG - Intergenic
1189617621 X:42800048-42800070 AGAAGTCTGGAGGCTGGGCGTGG - Intergenic
1190537316 X:51442006-51442028 AGAAGGCTGCTGTGAGGTCAGGG + Intergenic
1193536544 X:82723509-82723531 AGTAGGCTGTAGTCTGGTCAGGG - Intergenic
1193635396 X:83943952-83943974 AGAAGGCTGCAGTCAGGAAAGGG + Intergenic
1195065772 X:101236952-101236974 AGGAAGCTGGAGGCTGGCCAAGG - Intronic
1195704921 X:107731883-107731905 AGAGGGCTGTAGGAAGGGCAGGG + Intronic
1196193674 X:112818908-112818930 AAGTGGCAGGAGGCAGGTCAGGG - Intronic
1196208504 X:112968042-112968064 AAGAGGCAGGAGGCAGGTCAGGG + Intergenic
1197707157 X:129642288-129642310 GGAAGTCTGGAGTCAGATCAGGG - Intergenic
1197860884 X:130969033-130969055 AAAAGGGTGGAGGCAGGACAGGG - Intergenic
1197916430 X:131540894-131540916 GGAAAGGTGGAGGCAGGCCAAGG + Intergenic
1198020610 X:132653872-132653894 ATATGGCTGAAGCCAGGTCAAGG + Intronic
1198131496 X:133700198-133700220 AGAAGGCTGGAGACGGGGAATGG + Intronic
1198882845 X:141299815-141299837 AGAAGTCAGGAGGTAGGACAGGG - Intergenic
1200140094 X:153896494-153896516 TGAAGTCTGGATGCAGGACAAGG + Intronic
1200157548 X:153985341-153985363 AGAAGGCTCCAGGCAGGCCCCGG + Intergenic
1200328873 X:155273317-155273339 GGAGGGCTGGAGGGAGGTGAAGG + Intergenic
1200797067 Y:7350558-7350580 AGAACGCTGCGGGCAGGTGAGGG + Intergenic
1201160534 Y:11161329-11161351 AGAAAGCAGGAGGTAGGGCATGG + Intergenic
1201183524 Y:11374084-11374106 AGAATGCTGAAGGCCGGGCATGG - Intergenic
1202141224 Y:21724968-21724990 ATAAAGCTTGAGGCAGGGCATGG - Intergenic
1202145641 Y:21778831-21778853 ATAAAGCTTGAGGCAGGGCATGG + Intergenic