ID: 1105221067

View in Genome Browser
Species Human (GRCh38)
Location 13:18327962-18327984
Sequence GTCACCCCATTCCAAAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 3, 1: 0, 2: 0, 3: 9, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105221067_1105221070 20 Left 1105221067 13:18327962-18327984 CCCATGCTTTGGAATGGGGTGAC 0: 3
1: 0
2: 0
3: 9
4: 110
Right 1105221070 13:18328005-18328027 AAATTCAAATTTGTGTGCATAGG 0: 4
1: 2
2: 1
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105221067 Original CRISPR GTCACCCCATTCCAAAGCAT GGG (reversed) Intergenic
902054885 1:13592248-13592270 GACAACCCAGTCCAAAGGATGGG - Intronic
904351093 1:29907210-29907232 GTCACGTCATTCCACTGCATGGG + Intergenic
905318443 1:37098339-37098361 GTCACCTGACTCCAAAGCCTTGG - Intergenic
905356933 1:37391320-37391342 GTCTCACCATTCCAAACCACAGG - Intergenic
909130477 1:71729500-71729522 CCTACCCCATGCCAAAGCATGGG - Intronic
913176432 1:116276967-116276989 CTCACCCCATCCCAAAGAACAGG + Intergenic
1071184188 10:83021616-83021638 GTCATACCATGTCAAAGCATTGG - Intergenic
1088921578 11:114263080-114263102 TTCACCCCCATCCCAAGCATGGG + Intronic
1090950444 11:131468258-131468280 ATCAACCCATTACACAGCATGGG - Intronic
1091305645 11:134534403-134534425 GTCTCCCCATGCCACAGCCTGGG - Intergenic
1092368406 12:7896217-7896239 GTCTCCCAATTCCAAACAATAGG + Intergenic
1094449718 12:30571879-30571901 GTAACCTCCTTCCAAAACATGGG - Intergenic
1098784036 12:74726673-74726695 GTCAAGCATTTCCAAAGCATTGG - Intergenic
1101756193 12:107622285-107622307 GTCACCCATTCCCCAAGCATGGG + Intronic
1105221067 13:18327962-18327984 GTCACCCCATTCCAAAGCATGGG - Intergenic
1109447505 13:62461744-62461766 GTCAGACAATTTCAAAGCATTGG + Intergenic
1111009391 13:82292275-82292297 GTCTCCACAATCCAGAGCATGGG - Intergenic
1111085700 13:83373096-83373118 GTCACAGCATTCCTGAGCATAGG - Intergenic
1113327112 13:109293096-109293118 CTCACCCCATTCCCAGGGATAGG - Intergenic
1115100896 14:29698120-29698142 GTCTCCCCATTTCAAAGAGTTGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123989019 15:25669438-25669460 GTCAGCTGACTCCAAAGCATAGG + Intergenic
1127273511 15:57422341-57422363 GTCACACCATTAGAAATCATGGG - Intronic
1129520258 15:76181421-76181443 GTCATACCATTCCAAAGCCCTGG + Intronic
1134776636 16:16859183-16859205 GGGACCCCACTCCAAAGCACTGG + Intergenic
1139223646 16:65212457-65212479 GTCACTCCATCCCATAGCAGAGG + Intergenic
1142174913 16:88640710-88640732 CTCACATCATTACAAAGCATAGG - Intergenic
1151571570 17:74928611-74928633 CTCTCCCCATTCCCATGCATAGG + Intronic
1158530291 18:58255003-58255025 GTAAACCCCTTCCCAAGCATCGG - Intronic
1160111234 18:76033784-76033806 TTCAACCCAATGCAAAGCATAGG - Intergenic
1165475279 19:36026773-36026795 GAACCCCCATTCCAGAGCATGGG + Intronic
1167398076 19:49244714-49244736 GTGACTCCATTCCCAAGCATAGG - Intergenic
927559906 2:24062737-24062759 TTCACCCTCTTCCAAAGAATAGG - Intronic
927643686 2:24861721-24861743 GTCACTCCCTCCCAAGGCATTGG - Intronic
934182990 2:89644506-89644528 GTCACCCCATTCCAAAGCATGGG + Intergenic
934293276 2:91718693-91718715 GTCACCCCATTCCAAAGCATGGG + Intergenic
941376461 2:164737302-164737324 GTCACCCCTTTCCCAACCAGGGG + Intronic
942627468 2:177917217-177917239 ATCACCCAATTCCAAATCCTGGG + Intronic
947484966 2:230539656-230539678 ATCACCCCATTAGAGAGCATGGG - Intronic
1169600865 20:7259195-7259217 ATTACCCCATTCCAAAGACTTGG - Intergenic
1176074452 20:63242081-63242103 GGCACCCCATGCCAAAGTCTGGG + Intronic
1178692944 21:34764791-34764813 GTCTCAGCCTTCCAAAGCATTGG + Intergenic
1181162309 22:20966006-20966028 GTCACCCCACTCAAAGGCAAAGG - Intronic
1185400247 22:50611786-50611808 GACACCCCATTGCACAGCCTCGG - Intronic
950468056 3:13167207-13167229 GACAGCCCATGCAAAAGCATCGG - Intergenic
952161684 3:30700118-30700140 GTCACCCAAATTCAAAGCAATGG + Intergenic
960049504 3:113226473-113226495 GTCTCCCCATTCCAATGGCTTGG - Intronic
963179541 3:142339201-142339223 GTCACCCCATCCCCAAGCCCAGG + Intronic
963522740 3:146375891-146375913 GTGATCCTATTCAAAAGCATTGG - Intergenic
964458387 3:156893951-156893973 GTCTCCCAATTCTAAAGCAGTGG + Intronic
964711167 3:159673430-159673452 ATCAACACATTCCAAAGCAATGG - Intronic
968654435 4:1772489-1772511 ACCACCCCATCTCAAAGCATGGG + Intergenic
973267496 4:48225771-48225793 GTGACCACATTTCAAGGCATAGG + Intronic
977361137 4:96007277-96007299 GTCAGCAAATTTCAAAGCATTGG - Intergenic
977654926 4:99509797-99509819 GACACCCCATTCTAAAACAGGGG - Intergenic
979397704 4:120208190-120208212 GTAAGCCCATTGCAAAGCTTTGG - Intergenic
980269748 4:130568695-130568717 AGCACACCATTCCAAAGCCTTGG + Intergenic
983107714 4:163710203-163710225 GTCACCACTTTTCAAAGTATTGG - Intronic
986119348 5:4817192-4817214 GTCCCCCCAGGCCAAGGCATTGG - Intergenic
986376404 5:7136465-7136487 GTAACCCCATTACAAAGCACTGG + Intergenic
989484474 5:41973425-41973447 GCCTCACCATTCCAAAGTATTGG - Intergenic
991556348 5:67898891-67898913 GTCAACCCATTTCAAATCAAGGG - Intergenic
996684218 5:126262793-126262815 GCCACTGCATTCCAGAGCATAGG + Intergenic
998065040 5:139151147-139151169 TTTACCCCATTCCCAACCATTGG + Intronic
998613627 5:143716284-143716306 GGCAGCCCAATTCAAAGCATGGG - Intergenic
1000180426 5:158804869-158804891 GTCACTCCATTGCAAAGCAATGG + Intronic
1005545461 6:26864135-26864157 GTCAGCTCACTCCAAAGAATTGG - Intergenic
1009016164 6:57904899-57904921 GTCAGCTCACTCCAAAGAATTGG - Intergenic
1017649320 6:156566469-156566491 CTCTCCCCAAACCAAAGCATAGG + Intergenic
1019961841 7:4467009-4467031 GTCTCAGCCTTCCAAAGCATTGG - Intergenic
1022461755 7:30615330-30615352 TTCATCCCATTTCAAAGAATGGG - Intronic
1023495071 7:40786751-40786773 GTGACACCATTCCAATGCCTTGG - Intronic
1023888688 7:44377778-44377800 GTCACCCAAGTCCAGAGCCTGGG - Intergenic
1026372657 7:69717203-69717225 GTTGCCCCATTCCAAATCAAAGG - Intronic
1028868123 7:95736737-95736759 GTCACCCCTTTCCCAACCCTGGG - Intergenic
1029379380 7:100202858-100202880 GTTACCCCATTCCATAGACTGGG - Intronic
1029485627 7:100838248-100838270 GCCTCCACCTTCCAAAGCATTGG + Intronic
1033422319 7:141214793-141214815 GTCACCCCAGTTCACAGCATAGG - Intronic
1033913291 7:146290879-146290901 GTCACTGCATAGCAAAGCATTGG + Intronic
1035684685 8:1514668-1514690 GTCACCCCATTCTAAAGGAGGGG + Intronic
1040286383 8:46102641-46102663 GTCACCCTGCTCCAAAGCCTAGG + Intergenic
1040286959 8:46105390-46105412 GTCACCCTGCTCCAAAGCCTGGG + Intergenic
1040287627 8:46108530-46108552 GGCACCCTACTCCAAAGCCTGGG + Intergenic
1040288565 8:46112752-46112774 GTCACCCTACTTCAAAGCCTAGG + Intergenic
1040289700 8:46117971-46117993 GTCACCCTGCTCCAAAGCCTGGG + Intergenic
1040289971 8:46119268-46119290 ATCACCCTGTTCCAAAGCCTGGG + Intergenic
1040290438 8:46121433-46121455 GTCACCCTGCTCCAAAGCCTGGG + Intergenic
1040291367 8:46127297-46127319 GGCACCCTGTTCCAAAGCCTGGG + Intergenic
1040294284 8:46141277-46141299 GGCACCCTGTTCCAAAGCCTGGG + Intergenic
1040295319 8:46145988-46146010 GTCACCCCGCTCCAAAGCCTGGG + Intergenic
1040295611 8:46147570-46147592 GGCACCCTACTCCAAAGCCTGGG + Intergenic
1040298527 8:46175886-46175908 GGCACCCTGTTCCAAAGCGTGGG - Intergenic
1040300099 8:46183525-46183547 GGCACCCTACTCCAAAGCCTGGG + Intergenic
1040304859 8:46206722-46206744 GGCACCCTCTTCCAAAGCCTGGG - Intergenic
1040305110 8:46208014-46208036 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040305578 8:46210103-46210125 GGCACCCTGTTCCAAAGCCTGGG - Intergenic
1040309369 8:46228820-46228842 GGCAACCTATTCCAAAGCCTGGG - Intergenic
1040314667 8:46254629-46254651 GGCACCCCGCTCCAAAGCCTGGG - Intergenic
1040314806 8:46255276-46255298 GGCACCCTACTCCAAAGCTTTGG - Intergenic
1040315455 8:46258519-46258541 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040315920 8:46260859-46260881 GTCACCCTGTTCCGAAGCCTGGG - Intergenic
1040324236 8:46333611-46333633 GTCACCCTGTTCCAAAGTCTGGG - Intergenic
1040324629 8:46335487-46335509 GGCACCCTGTTCCAAAGCCTGGG - Intergenic
1040324679 8:46335702-46335724 GGCACCCCTTTCCAAAGCCTGGG - Intergenic
1040325796 8:46340880-46340902 GGCACCCTGTTCCAAAGCCTGGG - Intergenic
1040330397 8:46382895-46382917 GACACCCTACTCCAAAGCCTGGG - Intergenic
1040334513 8:46409256-46409278 GGCACCCTGTTCCAAAGCCTGGG - Intergenic
1040334562 8:46409473-46409495 GGCACCCTGTTCCAAAGCCTGGG - Intergenic
1040335969 8:46416132-46416154 GTCACCCTACTCCAAATCCTGGG - Intergenic
1040338882 8:46429924-46429946 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040338982 8:46430357-46430379 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040339321 8:46432472-46432494 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040340513 8:46438228-46438250 GTCACCCTACTCCAAAGCCTTGG + Intergenic
1040341364 8:46442796-46442818 GGCACCCTGTTCCAAAGCCTGGG + Intergenic
1051909401 9:22135654-22135676 GTCACCAAAATCAAAAGCATAGG - Intergenic
1053516691 9:38736226-38736248 GTCACCCCCTTCCAAGGCCTGGG - Intergenic
1056295876 9:85192587-85192609 GCCACTGCATTCCAAAGCCTAGG + Intergenic
1059096823 9:111425443-111425465 GTGAGGCCATTCAAAAGCATTGG + Exonic
1059802929 9:117769120-117769142 GTCACCACCTTCCAGAGAATAGG - Intergenic
1186341442 X:8650208-8650230 ATCAGCACATTCCAAAGCAATGG - Intronic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1199305974 X:146268190-146268212 CTCACCCCATTCCCAGGCACTGG - Intergenic