ID: 1105221068

View in Genome Browser
Species Human (GRCh38)
Location 13:18327963-18327985
Sequence GGTCACCCCATTCCAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105221068_1105221070 19 Left 1105221068 13:18327963-18327985 CCATGCTTTGGAATGGGGTGACC 0: 3
1: 0
2: 1
3: 7
4: 110
Right 1105221070 13:18328005-18328027 AAATTCAAATTTGTGTGCATAGG 0: 4
1: 2
2: 1
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105221068 Original CRISPR GGTCACCCCATTCCAAAGCA TGG (reversed) Intergenic
902742162 1:18446134-18446156 GGTCAGCCCATGCAAAATCACGG - Intergenic
904002751 1:27348091-27348113 GGTCTCCCCATTCCCAGGCTGGG - Intronic
904039876 1:27577582-27577604 GCTCCCCCCACTCCCAAGCAAGG + Intronic
905452399 1:38065041-38065063 GGTGTCCCAATTCCAAAGCTGGG - Intergenic
906967023 1:50467790-50467812 AGTTTCCCTATTCCAAAGCAGGG + Intronic
909130479 1:71729501-71729523 GCCTACCCCATGCCAAAGCATGG - Intronic
912169393 1:107080161-107080183 GGTTACCCCATGCCAAAACTTGG + Intergenic
920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG + Intronic
920956980 1:210628576-210628598 AGTGACCCCATGCCAAGGCAAGG + Intronic
921137239 1:212272756-212272778 GGTCACCCAATTCAAAACCTTGG + Intergenic
922993423 1:229936675-229936697 TGTGACCCCATTGCAAATCAAGG - Intergenic
1062801781 10:386407-386429 GGTCCTCCAATCCCAAAGCAGGG + Intronic
1063275115 10:4557566-4557588 GGTCACTCCACTCCAAAGGGTGG + Intergenic
1063386595 10:5619960-5619982 AGTCCCCCCACTCCGAAGCAGGG - Intergenic
1065844875 10:29736078-29736100 GGGCACCCCTTCCCAAAACAGGG + Intronic
1067599823 10:47587895-47587917 GGTCACCCCAGTTCACAGCCAGG - Intergenic
1067702754 10:48585551-48585573 GGACAACCCCTTCCAGAGCAGGG - Intronic
1070323010 10:75368700-75368722 GGTCATCCATTTCCAATGCAGGG - Intergenic
1070647899 10:78214211-78214233 GGCCATCCCATTCCACAGGAGGG + Intergenic
1072117976 10:92381997-92382019 GAGCACCCCACTCCTAAGCATGG - Intergenic
1072477931 10:95781374-95781396 AGTCACCCTATTGCAAACCAAGG - Intronic
1075090928 10:119443909-119443931 GACCACCCCAGTCCACAGCAAGG - Intronic
1075246236 10:120824404-120824426 GGGAGCCCCATTCCCAAGCATGG + Intergenic
1076853097 10:133102731-133102753 GGTCACTCCTATCCACAGCATGG - Exonic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1085544188 11:77301747-77301769 GGACACCCCGTGCCAGAGCAAGG + Intergenic
1089627048 11:119757866-119757888 GGACACCCCATCCCAAAGCTAGG - Intergenic
1090452787 11:126821372-126821394 GGTAAGCCCTTTCCAAAGGAAGG - Intronic
1092913767 12:13171527-13171549 GGACACCCCAGTCCACAGGAGGG - Intergenic
1101160831 12:101973709-101973731 AGCCATCCCATTGCAAAGCAGGG + Intronic
1102340204 12:112115585-112115607 GGTGACTTCATTCCAAATCAAGG - Intergenic
1102664109 12:114555289-114555311 GGTCACCTCATTTCAAACCTAGG + Intergenic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1107054659 13:36090095-36090117 TGTCACCCCACTCTAAAGTAAGG - Intronic
1107103145 13:36615624-36615646 GTTCATCCAATCCCAAAGCAGGG - Intergenic
1111009392 13:82292276-82292298 GGTCTCCACAATCCAGAGCATGG - Intergenic
1111945758 13:94663778-94663800 GGCAACCCCATTCAGAAGCAAGG + Intergenic
1114564082 14:23615185-23615207 GGCCACCCCATGCCAGAGCTGGG - Intergenic
1116876992 14:50121932-50121954 GGACACCCCAATTCAAGGCAAGG + Intronic
1117599716 14:57362786-57362808 AGTTACCCCCTTCCCAAGCATGG - Intergenic
1118985843 14:70753973-70753995 GGTCACCTCCTTTCAGAGCATGG - Intronic
1119577157 14:75735289-75735311 GGTAAGCCAATTCCACAGCAGGG + Exonic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1127545413 15:59990119-59990141 GGTCACACAATAGCAAAGCAGGG - Intergenic
1137574576 16:49590480-49590502 GCTCACCCCAATTAAAAGCAGGG + Intronic
1138528426 16:57621859-57621881 GGTGACCCCATGCCAAGGCTGGG + Intronic
1142231608 16:88902707-88902729 GGTCAGCCAGTGCCAAAGCAAGG + Intronic
1142329120 16:89439365-89439387 GGTAACCCCATTGCAAGTCAAGG - Intronic
1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG + Intronic
1148020042 17:44547658-44547680 GGTCGCCCCAAGCCAGAGCAGGG + Intergenic
1148807122 17:50269526-50269548 GGTCACCTCATTGCCAAGGAGGG - Intergenic
1149536293 17:57436145-57436167 GTTCATCTCATTCCAAAGCTCGG - Intronic
1151547127 17:74800006-74800028 CGTCATCCCATTTCACAGCAGGG + Intronic
1152626590 17:81390532-81390554 TGTCCCCCCACTCCAAGGCACGG + Intergenic
1160320028 18:77881946-77881968 GGTCATGCCATTGGAAAGCATGG + Intergenic
1162049912 19:8026860-8026882 GTTCACCCCATTTTACAGCAAGG + Intronic
1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG + Intergenic
1165475278 19:36026772-36026794 GGAACCCCCATTCCAGAGCATGG + Intronic
928290029 2:30028961-30028983 GCTCACCCCATGCCAACCCATGG - Intergenic
928317617 2:30258292-30258314 GGTCACCCCATTCTACTCCATGG + Exonic
930008922 2:46919859-46919881 GGTCACCCTCATCCAATGCAAGG - Intronic
932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG + Intronic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
937138110 2:119572886-119572908 GGTGACTCCATTCCAAAGCCAGG + Intronic
941376460 2:164737301-164737323 TGTCACCCCTTTCCCAACCAGGG + Intronic
942401571 2:175608984-175609006 GGGCAACCCTTTCCATAGCATGG + Intergenic
942888840 2:180962800-180962822 GTTCAACCCATACCAAAGCCCGG + Intergenic
943971664 2:194416315-194416337 TGTCACCTCACTCAAAAGCAGGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
1169399467 20:5267709-5267731 GGTTACCTCATTCCAAAGAGAGG + Intergenic
1170728954 20:18955669-18955691 GGTCACACCAGTCGACAGCATGG - Intergenic
1172173645 20:32959728-32959750 TGTCCCCCCACTGCAAAGCAGGG - Intronic
1174545405 20:51321514-51321536 TGTCACCCAATGCCACAGCATGG + Intergenic
1174845271 20:53937282-53937304 GTTCACCCCATTCTAAAGTAAGG - Intronic
1176113222 20:63420019-63420041 GGTCACGTCCTTCCCAAGCAGGG - Intronic
1177164543 21:17585368-17585390 GGTCACACAATTCGAAAACATGG - Intronic
1179214724 21:39357609-39357631 GTTCACCGAATCCCAAAGCATGG - Intergenic
1180727471 22:17957114-17957136 GGTTACCTCATAACAAAGCATGG - Intronic
1181694500 22:24586098-24586120 GGTCCACCCAAGCCAAAGCAGGG + Exonic
1182975859 22:34623585-34623607 GCTCACCCCATTGCACAGCCTGG - Intergenic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
962258338 3:133887137-133887159 GGGCACCCCTTTCCACAGCCTGG - Intronic
963037623 3:141046199-141046221 GGTCAGCCTATTCAAATGCAGGG - Intergenic
964433603 3:156630095-156630117 GCTGACCCCAGTCCACAGCATGG + Intergenic
965612301 3:170557259-170557281 GGGCTCCACATTCCAAAGGATGG - Intronic
968598114 4:1495753-1495775 GGTCTCCACACTCCAAGGCAGGG - Intergenic
971105370 4:23518441-23518463 CCTCACCCCATTCAAAATCAAGG - Intergenic
977654927 4:99509798-99509820 TGACACCCCATTCTAAAACAGGG - Intergenic
985352651 4:189082747-189082769 GTACACCCCTTTCCAAAACAGGG - Intergenic
985642370 5:1069625-1069647 GGGCACCTCATTCCCAGGCAGGG - Intronic
986308843 5:6536252-6536274 GGTCAGGCCAATCCAAGGCAGGG + Intergenic
991556349 5:67898892-67898914 TGTCAACCCATTTCAAATCAAGG - Intergenic
998649957 5:144107516-144107538 GGTGCCCCCATTCCAAGGCCAGG + Intergenic
999326068 5:150644482-150644504 GGTCACCCCATTCCACTCCCTGG - Intronic
1001328791 5:170747899-170747921 GGTCACCCCACTCCACCCCAGGG + Intergenic
1013513534 6:110865059-110865081 CCTCCCCACATTCCAAAGCAAGG - Intronic
1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG + Intronic
1018681478 6:166269430-166269452 GGTCACCTCCTTCCAGACCATGG - Intergenic
1023054716 7:36282496-36282518 GGTAACCCCATTCCAGGTCAGGG + Intronic
1023712377 7:43008691-43008713 GGTCACCCATTTCCCAAACAAGG + Intergenic
1023888689 7:44377779-44377801 GGTCACCCAAGTCCAGAGCCTGG - Intergenic
1030308590 7:108045969-108045991 TCTCACCCCATTCCCAAGCTTGG + Intronic
1033725274 7:144109692-144109714 GATGACCCCATTCCCCAGCAGGG - Exonic
1033726947 7:144129222-144129244 GATGACCCCATTCCCCAGCAGGG - Exonic
1034348082 7:150399115-150399137 CCTCACGCCCTTCCAAAGCAGGG + Intronic
1035037948 7:155907584-155907606 GGACACTCCAGACCAAAGCATGG - Intergenic
1035684684 8:1514667-1514689 TGTCACCCCATTCTAAAGGAGGG + Intronic
1040295318 8:46145987-46146009 AGTCACCCCGCTCCAAAGCCTGG + Intergenic
1040324680 8:46335703-46335725 AGGCACCCCTTTCCAAAGCCTGG - Intergenic
1047971791 8:130090999-130091021 GGTCACCCCATCACGAAACAGGG - Intronic
1048878912 8:138857470-138857492 GGTCTCCCTATTTCACAGCAAGG + Intronic
1051142669 9:13994663-13994685 GTTCATCCAATCCCAAAGCATGG - Intergenic
1053108698 9:35438097-35438119 GGTCACCACATCCCAAGGAAGGG + Intergenic
1053516692 9:38736227-38736249 AGTCACCCCCTTCCAAGGCCTGG - Intergenic
1056735703 9:89207881-89207903 GATAAGCCCATTCCAGAGCAGGG - Intergenic
1061682577 9:132250284-132250306 GGTCTCCCCATGCCCAAGAAAGG + Intergenic
1187038965 X:15573201-15573223 TGTAACCCCATTGTAAAGCAAGG + Intronic
1187264964 X:17723295-17723317 GGTGACCAAATTCCAAAGCACGG + Intronic
1197692536 X:129518470-129518492 TGTCACCAAATTGCAAAGCAAGG + Intronic