ID: 1105224670

View in Genome Browser
Species Human (GRCh38)
Location 13:18419822-18419844
Sequence CTCTAAGAATGTAATAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 3, 1: 1, 2: 7, 3: 48, 4: 421}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105224670 Original CRISPR CTCTAAGAATGTAATAAATT TGG Intronic
901271560 1:7955730-7955752 CTCTAAAAATGAAATAAAACCGG + Intronic
903694774 1:25198665-25198687 CTTTAATTAAGTAATAAATTTGG + Intergenic
905728123 1:40272646-40272668 CTCAAAGAAAGTAATAGACTGGG - Intronic
906571797 1:46847994-46848016 CTTTAAGAATGTTAAATATTGGG - Intergenic
907168766 1:52440900-52440922 CACTAAGAATATAATTATTTTGG + Intronic
907984832 1:59520476-59520498 TTCTAAGAATGGATTAAATTTGG - Intronic
908134170 1:61113095-61113117 TTGAAAGACTGTAATAAATTAGG - Intronic
908895392 1:68892913-68892935 CTCTAAAAATGTCATTAATTTGG - Intergenic
909941702 1:81618425-81618447 TTCTCAGAATGTAAAAAATTTGG - Intronic
911097530 1:94066999-94067021 CTCAAAGAATGTACTATCTTTGG - Intronic
911337906 1:96603473-96603495 GTCTAAGACTGTAATACAATGGG - Intergenic
911710269 1:101063760-101063782 CTCTAAGAATTTAATAATCTAGG + Intergenic
912731814 1:112113856-112113878 CACTAAGAATTTTATAAATGGGG + Intergenic
913138876 1:115920014-115920036 TTGTAAGAATGAAATAAATAGGG + Intergenic
915041106 1:152969038-152969060 CACTAAGAATGTAATATTCTGGG - Intergenic
917049811 1:170908272-170908294 CTGTATAAATGTAATAAATGTGG + Intergenic
917362559 1:174193203-174193225 ATTTAAGAATGTAACAAATGTGG - Intronic
917823435 1:178790283-178790305 CACTAAGAGTGTATTAAATCTGG + Intronic
917898231 1:179514404-179514426 CTCTCAGAGTGGAATAAAATTGG - Intronic
918071775 1:181138547-181138569 ATCTATGCTTGTAATAAATTGGG + Intergenic
919098380 1:193063723-193063745 CACTAAGAATGCCATTAATTTGG + Intronic
919497301 1:198289020-198289042 TACTAACAATGAAATAAATTTGG + Intronic
919601392 1:199627068-199627090 TTCCATGTATGTAATAAATTTGG - Intergenic
921653204 1:217703611-217703633 ATCTAAGAATTTAAAAAATATGG + Intronic
922243526 1:223773254-223773276 CTCTAAAAAAATAAAAAATTAGG + Intronic
922309027 1:224370594-224370616 TTCTAAGAACTTAATAAAATTGG + Intronic
922691653 1:227697116-227697138 CCCTATGAATGTAATCAATGTGG - Intergenic
922860668 1:228813087-228813109 CTCTAAGTATGTCATAAAAGTGG - Intergenic
924764246 1:247016979-247017001 CCCTACAAATGTAATAATTTTGG + Intergenic
924764258 1:247017144-247017166 CTCTACAAATGTAATAAATGTGG + Intergenic
924766576 1:247037507-247037529 CCCTATGAATGTAAGAAATGTGG - Exonic
924773808 1:247100498-247100520 CCCTATGAATGTAAGAAATGCGG - Exonic
1064215120 10:13393928-13393950 ATCTCAGAATGTAACACATTTGG + Intergenic
1064742370 10:18446896-18446918 CTCTAAAAAAATAAAAAATTAGG + Intronic
1065322641 10:24523395-24523417 CTCTAAGAATCTAAGGGATTGGG + Intronic
1065596358 10:27316402-27316424 GTCTAAGAACTTAATAAATTTGG + Intergenic
1065597883 10:27334294-27334316 CTCTAAGAACTTAATAAATTTGG - Intergenic
1065691592 10:28339587-28339609 CCCTACGAATGTAATACATGGGG - Intergenic
1065940161 10:30557031-30557053 CTCTAAAAAAATAAAAAATTAGG + Intergenic
1066603550 10:37136521-37136543 CTCTAAGAACTTAATAAATTTGG + Intronic
1066627152 10:37418462-37418484 CTCTATGAATCTAACTAATTAGG + Intergenic
1066676725 10:37895733-37895755 CCCTATGAATGTAATCAATGTGG + Intergenic
1066676730 10:37895817-37895839 CCCTATGAATGTAATGAATGTGG + Intergenic
1066682900 10:37952455-37952477 CCCTTTGAATGTAATAAATGTGG - Exonic
1066693416 10:38055946-38055968 CCCTATGAATGTAATGAATGTGG + Exonic
1066991702 10:42520747-42520769 CACTATGAATGTAATGAATGTGG - Intergenic
1066999389 10:42593106-42593128 CCCTATGAATGTAATGAATGTGG - Exonic
1067122116 10:43482324-43482346 CTCTATGAATGTAGTGAATGTGG + Exonic
1067126822 10:43524786-43524808 CCCTATGAATGTAATGAATGTGG + Intergenic
1069039556 10:63681090-63681112 CTCTAACAATCTAACAAATGAGG + Intergenic
1069287943 10:66740248-66740270 CTTTAATAATGAAAGAAATTAGG + Intronic
1069308391 10:67001768-67001790 CTCAAAGCATGTAATAAAAAAGG + Intronic
1070385761 10:75922910-75922932 CTGTAAGAGTGTGATAAATATGG - Intronic
1070431681 10:76346314-76346336 CTCAAAGAAGGTGATAACTTTGG + Intronic
1070889097 10:79928815-79928837 CTCTAAAAATACAAAAAATTAGG + Intergenic
1070906089 10:80074519-80074541 CTATAATAATGTAAAACATTTGG - Intergenic
1071014460 10:80978470-80978492 CTATAAAAATGAAAGAAATTTGG - Intergenic
1071853058 10:89595048-89595070 TTCTAAGAATAAAATCAATTTGG + Intronic
1073157237 10:101356962-101356984 CTCTAAAAATACAAAAAATTAGG + Intronic
1074582792 10:114736291-114736313 AAATAAGAATGTAATAAAATGGG + Intergenic
1076415405 10:130283742-130283764 CTCTATGGATGTAATGAATGTGG - Intergenic
1078392638 11:10949916-10949938 CTCTAAGAACTTTATAAATCTGG + Intergenic
1080552013 11:33380698-33380720 CTCTAAGAATTTTATGAATCTGG + Intergenic
1081893256 11:46562959-46562981 CACTAAAAATATAAAAAATTAGG - Intronic
1082178802 11:49093782-49093804 TTCTAAGAACTAAATAAATTTGG - Intergenic
1082202879 11:49394924-49394946 CTATAAAAATGTGATAGATTTGG - Intergenic
1083230924 11:61318576-61318598 CTATAAATATGTTATAAATTAGG + Intronic
1084989797 11:72911839-72911861 CTCTTAAAATGAAAGAAATTGGG - Intronic
1086686473 11:89739051-89739073 TTCTAAGAACTAAATAAATTTGG + Intergenic
1087426229 11:97990505-97990527 CTCCAAGAAAGCAATTAATTTGG + Intergenic
1087556496 11:99728377-99728399 CTCTCAGAATATAGTATATTTGG - Intronic
1087811456 11:102613035-102613057 CTTTAAGAATGTATTATTTTGGG - Intronic
1087995471 11:104801729-104801751 ATGTAACAATGTAATATATTTGG + Intergenic
1088111222 11:106264330-106264352 CCCTATGAATGTAAGAAATGTGG + Intergenic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1090781253 11:130008862-130008884 CTCTATGAATGTAAGAAATGTGG + Intergenic
1093079219 12:14789814-14789836 CACTAAGAATGACATAAAATAGG + Intronic
1095705139 12:45228856-45228878 CTCTAAGAATCTTCTAAAATTGG + Intronic
1096261316 12:50093780-50093802 CTCTAAAAATAAAAAAAATTCGG - Intronic
1096350323 12:50893196-50893218 TTATTAGATTGTAATAAATTCGG + Intergenic
1097691994 12:62742192-62742214 ATTTAAGAAAGTAATAAACTAGG - Intronic
1098782408 12:74703658-74703680 CTTTAAAAATATATTAAATTTGG + Intergenic
1098830194 12:75351844-75351866 CTTTAAGAATGTTAAATATTGGG - Intronic
1099111557 12:78568287-78568309 CTGTAAGAATGAAATGAATTAGG + Intergenic
1099155119 12:79165315-79165337 CTACAAATATGTAATAAATTTGG - Intronic
1099630626 12:85139049-85139071 TTCTAGGACTGTAATAAACTGGG + Intronic
1100322237 12:93506592-93506614 CTCTAAGCATGTAATCTTTTCGG + Exonic
1100480753 12:94976114-94976136 CTATAAGTATTAAATAAATTAGG - Intronic
1100601930 12:96119217-96119239 TTCTAAGAATTTTATAATTTTGG - Intergenic
1100670733 12:96809858-96809880 TTCTCAGAATGTAGTAAATTAGG - Intronic
1100803755 12:98260115-98260137 CTTAATGAATGTAATATATTTGG + Intergenic
1102177680 12:110887935-110887957 CACTAAGAATTTAACAACTTGGG - Intronic
1102427142 12:112852757-112852779 CTTTTAGAATGTATTAAGTTTGG + Intronic
1102779860 12:115554828-115554850 TTCCAAAAATGTAATAATTTGGG + Intergenic
1104043234 12:125144114-125144136 CTCCAGGACTGTAATAAACTGGG - Intergenic
1104064122 12:125292721-125292743 CTATACGAATGACATAAATTTGG - Intronic
1104324639 12:127784871-127784893 CTCTAATATATTAATAAATTGGG - Intergenic
1105056621 12:133106343-133106365 CTCTATGAATGTGATGAATGTGG + Exonic
1105057972 12:133120774-133120796 CCCTATGAATGTAATCAATGTGG - Exonic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1105496406 13:20934565-20934587 ATTTAAGAATGAAATAAACTGGG - Intergenic
1105897957 13:24733405-24733427 CACTAAGAATAGAATAATTTTGG - Intergenic
1107201863 13:37730166-37730188 CTCTAAAAATGTAGCAGATTAGG + Intronic
1109435117 13:62288864-62288886 CTTTAAGAGTATAATTAATTTGG + Intergenic
1110190326 13:72722867-72722889 CTCTAAGCATATAAAAAAATAGG - Intronic
1110308432 13:74018009-74018031 ATGGAAGAATGTGATAAATTAGG + Intronic
1110570701 13:76999943-76999965 CTTGAAGAATGGAATAAAATTGG + Intronic
1110950670 13:81486106-81486128 CTCTGATAATGTATTAAATAAGG - Intergenic
1111256352 13:85674468-85674490 CTTTAATTATGTAATAAAATTGG - Intergenic
1111270696 13:85880382-85880404 CTCTAATATTTTAATTAATTTGG + Intergenic
1111802865 13:93001303-93001325 CTCTAACCATGTAATAATTTTGG - Intergenic
1112180582 13:97075538-97075560 ATCAAAGATTATAATAAATTGGG + Intergenic
1113986143 13:114317322-114317344 CTTTAAGAAATTAATAAACTGGG - Intronic
1114008772 14:18344320-18344342 CCCTAAGAACTTAATAAATTTGG + Intergenic
1114404408 14:22442462-22442484 CCCTAAGAATGTATTAAACTTGG - Intergenic
1115058697 14:29164337-29164359 TTCTAAGTAGGTAATTAATTTGG - Intergenic
1115380522 14:32732802-32732824 CTCTCAGATTTTAATAATTTTGG + Intronic
1116321268 14:43466756-43466778 TTATAAGTATGTAATAAAATAGG - Intergenic
1117019675 14:51556989-51557011 CTATAAGAAAGTAATAAACTGGG + Intronic
1117345690 14:54829837-54829859 CTCTGATAATGTACTGAATTTGG - Intergenic
1117787781 14:59305009-59305031 CTTTCAGAATGTCATAAAGTAGG - Intronic
1120238362 14:81919028-81919050 CCCTAGGAAAGTAATACATTCGG - Intergenic
1120488313 14:85143997-85144019 CTCTTACAATGTGAGAAATTTGG + Intergenic
1120728575 14:87976256-87976278 TTCTGAGAATGTAATCAAATGGG + Intronic
1202888783 14_KI270722v1_random:135328-135350 CCCTATGAATGTAATGAATGTGG + Intergenic
1202940572 14_KI270725v1_random:141840-141862 CTCTACAAATGTAATTCATTTGG - Intergenic
1123391974 15:19884896-19884918 CCCTAAGAACTTCATAAATTTGG + Intergenic
1126292889 15:47101399-47101421 CTCTACTAATGTAATTCATTTGG + Intergenic
1126584815 15:50273707-50273729 CACTTAGGATGTATTAAATTTGG + Intergenic
1127834426 15:62778992-62779014 CTCTCAGAATTTCATTAATTTGG + Intronic
1128086560 15:64890858-64890880 CTCTAAAAATTTTAAAAATTAGG - Intronic
1130114180 15:80991886-80991908 CTCTAAGGAGGAAATCAATTCGG + Intergenic
1131759937 15:95611451-95611473 CTCCAAGAATGTTATTAATTAGG - Intergenic
1134301785 16:12998122-12998144 CTCTAAGAAAATATTATATTTGG - Intronic
1135861439 16:26059434-26059456 GCCTAAGAATGAAATAAAGTAGG + Intronic
1136018032 16:27418367-27418389 CTCAAAAAATGAAATAAAATAGG - Intronic
1136866378 16:33759669-33759691 CTCTAATAATTTAGTATATTTGG - Intergenic
1137022831 16:35447025-35447047 CCCTATGAATGTAAGAAATGTGG - Intergenic
1137022853 16:35447275-35447297 CCCTATGAATGTAAAAAATGTGG - Intergenic
1137432780 16:48432071-48432093 CTCTAAGAGTCTAAGAACTTAGG + Intronic
1139681152 16:68564525-68564547 CCCTATGAATGTAATGAATGTGG + Exonic
1140852376 16:78947185-78947207 CCATAACAATGAAATAAATTAGG + Intronic
1203105781 16_KI270728v1_random:1356531-1356553 CTCTAATAATTTAGTATATTTGG + Intergenic
1203127733 16_KI270728v1_random:1605837-1605859 CTCTAATAATTTAGTATATTTGG - Intergenic
1143198134 17:5092510-5092532 CCCTATGAATGTAATGAATGTGG + Exonic
1144280917 17:13725732-13725754 CTCTAAGGATGTAATCAGTGTGG - Intergenic
1144601883 17:16623369-16623391 CCCTATGAATGTAATGAATGTGG - Exonic
1144609067 17:16692902-16692924 CTCTAAAAATTTAATATATTTGG + Intronic
1144903695 17:18622624-18622646 CTCCAAAAATTTAATATATTTGG - Intergenic
1145128883 17:20324106-20324128 CTCTAAAAATTTAATATATTTGG + Intergenic
1145195788 17:20893514-20893536 CTCTAAAAATTTAATATATTTGG - Intronic
1146599957 17:34205551-34205573 CACAAAGAATGTAATACCTTGGG - Intergenic
1147036356 17:37684495-37684517 CTCAAACAATCTAATAAAGTAGG + Intergenic
1147873163 17:43602322-43602344 CACTAAAAATATAAAAAATTGGG - Intergenic
1149073014 17:52565737-52565759 TTTTAAAAATTTAATAAATTTGG + Intergenic
1149439543 17:56663142-56663164 CTCTAAGGATGAAATGAAATAGG - Intergenic
1149557452 17:57584299-57584321 CTGGAAGAATATAATAAAATAGG + Intronic
1150177273 17:63071854-63071876 CTCAAAATATTTAATAAATTTGG + Intronic
1152670227 17:81599365-81599387 CTGTAAGATTATAACAAATTAGG + Intronic
1152976161 18:221248-221270 TTCTCAGAATTTAATAAATTTGG - Intronic
1153392769 18:4581183-4581205 ATATAAGAATTAAATAAATTAGG + Intergenic
1153439772 18:5103393-5103415 CTATAAGCAGGAAATAAATTTGG + Intergenic
1154476147 18:14760472-14760494 CTCTAAGAACTTAATAAATTTGG + Intronic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1155014787 18:21822931-21822953 CTCTAAAAAATTAAAAAATTAGG + Intronic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1156240158 18:35245975-35245997 CCCTATGAATGTAATGAATGTGG + Exonic
1157162821 18:45330069-45330091 CTCAAAGAATTAAATAATTTTGG + Intronic
1157504061 18:48213682-48213704 AAATAAGAAGGTAATAAATTTGG - Intronic
1160073878 18:75653314-75653336 CACTAAGAATGCAGTAAATTTGG - Intergenic
1162234338 19:9295379-9295401 CCCTATGAATGTAAGAAAGTAGG - Exonic
1162234384 19:9295794-9295816 CCCTATGAATGTAAGAAATGTGG - Exonic
1162253483 19:9467298-9467320 CTCTATCAATGTAAGAAATGTGG - Exonic
1162603128 19:11685335-11685357 CCCTATGAATGTAATAAATGTGG + Intergenic
1162603199 19:11686166-11686188 CTCTATGAATGTAAAGAATGTGG + Intergenic
1162623983 19:11868462-11868484 CCCTATGAATGTAAGAAATGTGG + Exonic
1162624009 19:11868812-11868834 CCCTATGAATGTAAGAAATGTGG + Exonic
1162665578 19:12208497-12208519 CCCTATGAATGTAAAAAATGTGG + Intergenic
1162669912 19:12248010-12248032 CCCTATGAATGTAAAAAATGTGG - Intronic
1162702425 19:12527080-12527102 CCCTATGAATGTAATAAATGTGG - Exonic
1162715429 19:12628676-12628698 CCCTACGAATGTAAAAAATGTGG + Exonic
1163853359 19:19679998-19680020 CCTTATGAATGTAATAAATGTGG + Exonic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164252374 19:23491179-23491201 CCCTGCCAATGTAATAAATTTGG - Intergenic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164409155 19:27983792-27983814 CACTAAGACTGAATTAAATTTGG - Intergenic
1164419168 19:28072941-28072963 CTAAATGAATGTAATTAATTTGG + Intergenic
1164700137 19:30279192-30279214 CTCTAAGAAGATAATAAAGCTGG - Intronic
1164886830 19:31785579-31785601 CTCTGAGAATGTAACAGATCAGG - Intergenic
1165298055 19:34944581-34944603 CCCTATGAATGTAACAAATGTGG + Exonic
1165524339 19:36340873-36340895 CTCTATGAATGTAAGGAATGTGG - Exonic
1165530271 19:36393645-36393667 CTCTATGAATGTAAGGAATGTGG - Exonic
1165543617 19:36514310-36514332 CCCTATGAATGTAATAAATGTGG - Exonic
1165589069 19:36950318-36950340 CCCTATAAATGTAATAAATGTGG + Exonic
1165589113 19:36950906-36950928 CCCTATGAATGTAATAAATGTGG + Exonic
1165620504 19:37242741-37242763 CCCTATGAATGTAAGAAATGTGG + Exonic
1165641286 19:37389622-37389644 CCCTATGAATGTAACAAATGTGG + Exonic
1165643601 19:37412823-37412845 CCCTATGAATGTAATAAATGTGG - Exonic
1165666625 19:37635882-37635904 CTCTATGAATGTAAAAAATGTGG - Exonic
1165670016 19:37669110-37669132 CCCTATGAATGTAATGAATGTGG - Exonic
1165673377 19:37698935-37698957 CCCTATGAATGTAACAAATGTGG - Exonic
1166578849 19:43873720-43873742 CCCTATGAATGTAATGAATGTGG - Exonic
1166638904 19:44477069-44477091 CCCTATGAATGTAATCAATGTGG - Exonic
1167861832 19:52290767-52290789 CTTTACAAATGTAATAAATGTGG + Exonic
1167872553 19:52384631-52384653 CTTTACAAATGTAATAAATGTGG + Exonic
1168442710 19:56384383-56384405 CTCTATGAATGTAAGGAATGTGG - Exonic
1168448187 19:56441229-56441251 CCCTATGAATGTAGTAAATGTGG - Exonic
1168448194 19:56441313-56441335 CCCTATGAATGTAATGAATGTGG - Exonic
1168605428 19:57755737-57755759 ACCTAAGAATGAAATAAATCTGG - Exonic
1168633821 19:57978707-57978729 CCCTATGAATGCAATAAATGTGG - Exonic
1168633830 19:57978791-57978813 CCCTATGAATGTAATAAATGTGG - Exonic
1168633875 19:57979295-57979317 CCCTATGAATGTAATAAATGTGG - Exonic
1168633883 19:57979379-57979401 CCCTATGAATGTGATAAATGTGG - Exonic
1202664180 1_KI270708v1_random:102123-102145 CCCTATGAATGTAATGAATGTGG + Intergenic
926176708 2:10599669-10599691 CTAAAAGAATGTAATAAACGAGG + Intronic
926408388 2:12576870-12576892 CTCTAAGACTGTAAGTAACTTGG + Intergenic
926563060 2:14438771-14438793 CTCTAATCATGTGATGAATTGGG + Intergenic
928955865 2:36866680-36866702 CTCTAAGAATTTATTAATCTGGG + Intronic
929019272 2:37535353-37535375 CCTTAAAAATGTAATAAATTTGG - Intergenic
930206741 2:48594602-48594624 TTCCAAGAAGGTAATAAAATAGG + Intronic
931496515 2:62813303-62813325 CTGTAAGAATGCAAGAACTTTGG + Intronic
931585725 2:63825036-63825058 CTTTAAGACCTTAATAAATTTGG + Intronic
933234386 2:79849140-79849162 CTCTCAGAAAACAATAAATTAGG - Intronic
934635069 2:95978245-95978267 CTCTAATAATTTAGTATATTTGG - Intronic
934699186 2:96425298-96425320 CTCTATGTATTTAATAATTTAGG + Intergenic
934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG + Intronic
934798559 2:97126989-97127011 CTCTAATAATTTAGTATATTTGG + Intronic
934834870 2:97576502-97576524 CTCTAATAATTTAGTATATTTGG - Intronic
935456940 2:103281235-103281257 CACTAAGAATGCAGTACATTTGG + Intergenic
935616614 2:105090718-105090740 CTTCCAGAAAGTAATAAATTTGG - Intronic
937136069 2:119554592-119554614 CTCTAAGGCTGTAATAGAATAGG - Intronic
938527794 2:132151037-132151059 CCCTAAGAATGTAATAAATTTGG - Intronic
938830698 2:135047750-135047772 GTCTAAGAATGCAATCAGTTTGG - Intergenic
939426850 2:142050240-142050262 CTTTAAAATTGTAATAAATGTGG + Intronic
940525787 2:154811590-154811612 CTCTAAGAAAGTGATAGATTGGG - Intronic
940687742 2:156875012-156875034 CTTTCAGAATGTAGAAAATTGGG + Intergenic
941703795 2:168635655-168635677 TTTTAAAAATGTAATAAAATAGG - Intronic
941859225 2:170261803-170261825 GTCTAAGAATGACATAGATTAGG + Intronic
943085642 2:183307610-183307632 CTCTGAGAATGGAATATAGTGGG + Intergenic
944068355 2:195643107-195643129 CTCAAGGAATTTGATAAATTTGG - Intronic
944487057 2:200218038-200218060 CTATAAGAATGTAGAAAAATGGG + Intergenic
946979647 2:225195343-225195365 CTCTAATAATGTAATGAAGTAGG + Intergenic
947570742 2:231232322-231232344 CTCTTAGAATGTGATAAATTTGG - Intronic
1169164629 20:3411717-3411739 TTCTAAGAGTTTAATAATTTTGG + Intergenic
1169301821 20:4449128-4449150 CTCTAAGAATAAAAGAAAATAGG + Intergenic
1170075934 20:12419043-12419065 CTCTATGAATCTAATAACTCAGG + Intergenic
1170378016 20:15723506-15723528 TTCTAAGAATGTCATATAGTTGG + Intronic
1171536490 20:25897181-25897203 CTCTACTAATGTAATTCATTTGG - Intergenic
1171566152 20:26190908-26190930 CTCTAAGAACTTAATAAATTTGG + Intergenic
1171804617 20:29663977-29663999 CTCTACTAATGTAATTAATTTGG + Intergenic
1172053251 20:32135845-32135867 CTCTCACAATGTATTGAATTTGG + Intronic
1173885679 20:46457054-46457076 CACTATGAATGTAATGAATTTGG - Intergenic
1174714792 20:52746266-52746288 CTCTAAGAATGTAAGATATGTGG - Intergenic
1176582574 21:8545104-8545126 CTCTACAAATGTAATTCATTTGG + Intergenic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1176945406 21:14974445-14974467 GTCTAAAAATGAAATATATTGGG - Intronic
1177207931 21:18031761-18031783 CTCTAATAGTGTAATTTATTGGG - Intronic
1177350361 21:19931689-19931711 CTCTGTGAATGTAATTCATTTGG + Intergenic
1177515005 21:22138172-22138194 CTGGAAGCATTTAATAAATTAGG + Intergenic
1180265405 22:10522152-10522174 CTCTACAAATGTAATTCATTTGG + Intergenic
1180330909 22:11479007-11479029 CCCTATGAATGTAATGAATGTGG + Intergenic
1180433275 22:15275137-15275159 CCCTAAGAACTTAATAAATTTGG + Intergenic
1180515842 22:16143055-16143077 CTCTAAGAACTTAACAAATTTGG + Intergenic
1183076138 22:35428320-35428342 CTCTAAAAAAATAATAAAATAGG - Intergenic
1183134511 22:35873601-35873623 CTCACAGGATGTAAAAAATTGGG - Intronic
1184215005 22:43060762-43060784 TCCTAACAATGTAATACATTTGG - Intronic
949601162 3:5599347-5599369 CTCTAAGATTGAAATAAAAAAGG - Intergenic
949945282 3:9185057-9185079 CTCTAAAACTATAAAAAATTAGG + Intronic
950512244 3:13437772-13437794 TTCTAAAAATGTAATAAAAAAGG + Intergenic
950596545 3:13988776-13988798 CTCTAAGAACTTTATAAATCTGG + Intronic
951658835 3:25039684-25039706 CTCTTTTATTGTAATAAATTTGG + Intergenic
951974482 3:28489104-28489126 TTCTAACAAGGCAATAAATTGGG - Intronic
952051318 3:29387904-29387926 CTGTTAGAATGCAGTAAATTAGG - Intronic
952068535 3:29603254-29603276 CTGTATGATTTTAATAAATTAGG - Intronic
952251106 3:31655550-31655572 CTCTGAGAATGTCTTAATTTTGG - Intergenic
952260526 3:31735608-31735630 CTCTAAGACTGTCATGAACTTGG - Intronic
953633669 3:44643075-44643097 CCCTATGAATGTAATGAATGTGG + Exonic
955038903 3:55295487-55295509 CTTAAAGAATGAAATAGATTTGG - Intergenic
955720647 3:61876868-61876890 TTCTAAAAATGTAATATTTTAGG - Intronic
956170447 3:66429494-66429516 TTCTCAGAATGTCATACATTTGG - Intronic
956675461 3:71728319-71728341 TTCTTAGAAGATAATAAATTGGG + Intronic
957091761 3:75737498-75737520 CCCTATGAATGTAATGAATGTGG - Intronic
957091787 3:75737749-75737771 CCCTATGAATGTAATGAATGTGG - Intronic
957091802 3:75737917-75737939 CCCTATGAATGTAATGAATGTGG - Intronic
957707435 3:83807000-83807022 ATATTAGAATATAATAAATTAGG - Intergenic
958881414 3:99675328-99675350 CTCTAACAATTTTATAAGTTAGG + Intronic
959983696 3:112548341-112548363 CTCAAAAAAAGAAATAAATTTGG + Intronic
960804155 3:121566768-121566790 CACAAAGATTGTAAGAAATTAGG + Intergenic
962551839 3:136501445-136501467 CCTTAAGAAGGGAATAAATTTGG + Intronic
962796520 3:138854117-138854139 CTCTAAGATTTTAGTTAATTTGG + Intergenic
962872414 3:139509118-139509140 CTCTGAGAAGTTAATAAAATTGG - Intergenic
963376817 3:144477929-144477951 CTCTAAGAATGCTGTCAATTAGG - Intergenic
963907488 3:150784763-150784785 CTCTAGGCCTGAAATAAATTAGG + Intergenic
965653544 3:170959651-170959673 CTGTAAGAATCTCATAAATCAGG - Intergenic
966025466 3:175274821-175274843 CTCTAAATATGTAAAAAATATGG - Intronic
966644956 3:182235251-182235273 CTCTAACAATATAATTTATTTGG - Intergenic
967515094 3:190358957-190358979 CTTTAAAAAAATAATAAATTAGG - Intronic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
969408585 4:7012448-7012470 TTCTAAGAAAGTCATAAATGTGG + Intronic
970052707 4:11933317-11933339 CTCTTAGAATGTAGTAAAGAAGG + Intergenic
970413539 4:15834474-15834496 CTCTAAGAATGTTCTAAAATTGG - Intronic
970808190 4:20060649-20060671 CTCTAAGAATGGCATTGATTAGG - Intergenic
971715693 4:30173016-30173038 CTTTAAGAATGAAATGAATCTGG + Intergenic
971915882 4:32869205-32869227 CTCTAGGAATGTCATCATTTTGG + Intergenic
972132559 4:35856596-35856618 CTCAATGAATGTAGTAAACTAGG - Intergenic
972840167 4:42921406-42921428 CTCTAAGAGTCTTCTAAATTTGG + Intronic
973191157 4:47387680-47387702 CTCCAAGAATGTCATGACTTGGG + Intronic
973797421 4:54442293-54442315 CTCTATCAATGTAATGAGTTAGG + Intergenic
974195433 4:58568422-58568444 TTCTAAATATGTAATAAATTGGG - Intergenic
974606002 4:64150839-64150861 CTCTAATAATGTAGTTATTTGGG - Intergenic
975357321 4:73423423-73423445 CTCAAAGAGTGTAAGAAGTTTGG + Intergenic
977974129 4:103244221-103244243 CTATAAAAATTAAATAAATTGGG - Intergenic
978972415 4:114825604-114825626 CTCTGAGATTATAATAAATCAGG - Intergenic
981675761 4:147341115-147341137 CCCTGAGAATGGAATAAATTAGG + Intergenic
981774329 4:148347720-148347742 CTCAAAGAGTGCAAGAAATTTGG - Intronic
983252006 4:165355857-165355879 CTCTAAGACTGTAATACAGAAGG + Intergenic
983307377 4:166008644-166008666 TTTAAAGAATGCAATAAATTTGG + Intronic
983709598 4:170696915-170696937 CTGTAAGAATTTAAAAAAATTGG + Intergenic
983752322 4:171290248-171290270 CTTTAAAAAAATAATAAATTTGG + Intergenic
984049277 4:174843654-174843676 CTCTAGAAAACTAATAAATTCGG + Intronic
984174884 4:176404954-176404976 CTCTAAAAATGTAATTATCTAGG - Intergenic
984909176 4:184655948-184655970 CTATAAGAAAAAAATAAATTTGG - Intronic
985625043 5:981425-981447 ATGTAAGTTTGTAATAAATTGGG - Intergenic
986757325 5:10850363-10850385 GACTAACAATGTAATATATTGGG - Intergenic
986939140 5:12928584-12928606 CTATAAGAAAATAATAATTTAGG + Intergenic
987090440 5:14504669-14504691 CTCTAAGAAGGATAGAAATTGGG + Intronic
987154871 5:15078928-15078950 CTTGGAGAATGTAATAAATAAGG - Intergenic
987869353 5:23593352-23593374 CTTTAAAAATGTAATAATCTTGG + Intergenic
988059391 5:26148293-26148315 CCATAAAAATGTAAAAAATTGGG + Intergenic
988347083 5:30051355-30051377 TTCTAAGAATTTAAGGAATTGGG + Intergenic
988976367 5:36520628-36520650 CACTAAGAATGGGAAAAATTGGG - Intergenic
989352907 5:40507927-40507949 CTATAATCATGGAATAAATTGGG + Intergenic
990054683 5:51557818-51557840 ATCTAAGCATGTGATAAAATGGG + Intergenic
990204294 5:53412615-53412637 CTTTAAGAATGTAATCTATTTGG - Intergenic
990766953 5:59194727-59194749 CTCTAAGAAGGTAGGACATTGGG + Intronic
990852090 5:60217178-60217200 CTCTAAGTATGTAATATAAGAGG - Intronic
991546675 5:67789845-67789867 CTTTAAGATTCTTATAAATTAGG + Intergenic
993163675 5:84322121-84322143 ATCTAATTATGTAGTAAATTTGG - Intronic
993474336 5:88345861-88345883 CTCTAAGAATGGAATATATGAGG + Intergenic
993521021 5:88900655-88900677 CTCTAACAAGGTATTAAATTTGG + Intronic
993650585 5:90516584-90516606 TTCTAAGCATTTAATACATTTGG - Exonic
993697009 5:91073385-91073407 CTCTAAGACTGTCATTCATTTGG - Intronic
994066758 5:95552389-95552411 GTCTAAGAATTTATTGAATTGGG - Intronic
994121778 5:96121935-96121957 CTGAAAGAATGAACTAAATTTGG - Intergenic
994364271 5:98894100-98894122 CTCAAAGAATTTAATGAACTTGG - Intronic
994924993 5:106104112-106104134 CTTAAAGAATGTTAAAAATTAGG + Intergenic
995026962 5:107434915-107434937 ATTTCAGAATGTAATACATTAGG - Intronic
996206672 5:120746388-120746410 CTTTAAAAAAGTAAGAAATTTGG + Intergenic
996792967 5:127313036-127313058 ATCTAAGAATTTAATGACTTGGG + Intronic
996940850 5:129003668-129003690 CTCTACAAAAGTAAAAAATTAGG + Intronic
998085138 5:139315065-139315087 CTCTAAAAATGTAAAAGATACGG + Intronic
999220287 5:149970614-149970636 CCCTAAGAATGGAATCAACTTGG + Intronic
999405684 5:151304641-151304663 CCCTAAAAATGAAATAAAATAGG + Intergenic
1000127815 5:158264135-158264157 CTTTAAGAATGATATAATTTGGG + Intergenic
1000386289 5:160677498-160677520 CTCTAATAATATAACAAAATGGG - Intronic
1000654163 5:163855761-163855783 CTCTATGCATGTAAGAAATGTGG - Intergenic
1002366057 5:178712127-178712149 CCCTATGAATGTAATACATGTGG - Exonic
1002393187 5:178932034-178932056 CCCTATGAATGTAATGAATGTGG + Exonic
1002397041 5:178965887-178965909 CCCTATAAATGTAATAAATGTGG + Exonic
1002543327 5:179920895-179920917 GTCTAAGACTGAAAAAAATTCGG - Intronic
1003469332 6:6414490-6414512 TTCTAAAAATTTAATAGATTTGG - Intergenic
1004631852 6:17428898-17428920 CTCCAAGACTGTAATTAAATAGG + Intronic
1004933724 6:20487180-20487202 CTCTCAAAATGTTATAAGTTAGG - Intronic
1005593843 6:27358367-27358389 CCCTATGAATGTAATGAATGTGG - Intergenic
1007919883 6:45597237-45597259 CTCTCAGAATATTATAAACTGGG + Intronic
1009810215 6:68652678-68652700 CTTTATAAATGTAATACATTTGG + Intronic
1009973340 6:70647819-70647841 CTTTGACAATCTAATAAATTTGG + Intergenic
1010025414 6:71210160-71210182 CTCTAACAATAGAATGAATTTGG + Intergenic
1010068705 6:71717089-71717111 CTCTATTATTGTAATCAATTTGG + Intergenic
1010565733 6:77410559-77410581 CTATAAGAATGTAATAAATATGG - Intergenic
1012306911 6:97669760-97669782 CTGTAAGAATGTGAAATATTCGG - Intergenic
1012322660 6:97869539-97869561 CTCAAATAATATAATAACTTAGG - Intergenic
1012855543 6:104497084-104497106 TTCTAAGAATGAAACAAATCTGG + Intergenic
1012995973 6:105975174-105975196 CTCTGAGAATGAAATACGTTAGG - Intergenic
1013578927 6:111512963-111512985 CTCTAAGAAGGGACTAAATTTGG + Intergenic
1015158056 6:130120162-130120184 CCCTGAGAATGGAATACATTAGG + Intronic
1015532077 6:134230711-134230733 CTCTACAAATAAAATAAATTAGG + Intronic
1015743491 6:136484487-136484509 GTCTAAGAGTTTAATAATTTAGG - Intronic
1015979075 6:138820725-138820747 GTCTAAGTATTTAATTAATTTGG + Intronic
1018406608 6:163490672-163490694 CTTTCAAAATGAAATAAATTTGG - Intronic
1020048678 7:5064822-5064844 CCCTATGAATGTAATGAATGTGG + Exonic
1020048689 7:5064984-5065006 CCCTATGAATGTAATGAATGTGG + Exonic
1020048720 7:5065320-5065342 CCCTATGAATGTAGTAAATGTGG + Exonic
1020048728 7:5065404-5065426 CCCTATGAATGTAATGAATGTGG + Exonic
1020285448 7:6676079-6676101 CCCCATGAATGTAATAAATGTGG + Intergenic
1020287063 7:6691530-6691552 CCCTATGAATGTAATGAATGTGG - Exonic
1020287097 7:6691950-6691972 CCCTATGAATGTAATGAATGTGG - Exonic
1025241083 7:57275410-57275432 CTCTATGGATGTAATTAATGTGG + Intergenic
1025287959 7:57683892-57683914 CTCTACTAATGTAATTCATTTGG - Intergenic
1025817497 7:64929464-64929486 CCCTATGAGTGTAATGAATTTGG + Intronic
1025960248 7:66214310-66214332 CTCTAAAAATGAAATAAAGGAGG - Intronic
1027642174 7:80749696-80749718 CTCAACGAAAGTATTAAATTAGG + Intronic
1027955376 7:84872594-84872616 CTCTAAGAATGTGATAAGGATGG - Intergenic
1028637443 7:93005335-93005357 TTCTAAGAATGCAATACATCTGG + Intergenic
1028849635 7:95523477-95523499 CTCTAATAATCAAATGAATTCGG + Intronic
1028866191 7:95716451-95716473 CTCCAAGTATGTAATAGATAAGG - Intergenic
1029358583 7:100071447-100071469 CCCTATGAATGTAATGAATGTGG - Exonic
1029850911 7:103461050-103461072 CTTTAAGAATGTTGAAAATTGGG + Intergenic
1030695398 7:112579963-112579985 CTCTAAGAAGGTAATAAGCCAGG + Intergenic
1030865513 7:114697961-114697983 CCCTAAGAATGGAATAATTTTGG - Intergenic
1031006759 7:116482343-116482365 CTCTAGGACTGTAAGAAAATAGG - Intronic
1031235522 7:119170596-119170618 CTCTGAGAATGTACTAAAAAAGG + Intergenic
1031373686 7:120998261-120998283 CTCTAGGAAACTAATAAATTTGG + Intronic
1031764050 7:125753150-125753172 CTTTAAAAATGTGATAGATTTGG - Intergenic
1032220653 7:129991598-129991620 CTCTAAAAAAGGAAAAAATTAGG - Intergenic
1033136579 7:138789668-138789690 CTTTAAGAATGTATTAACTTAGG + Intronic
1033160954 7:138996261-138996283 CCCTAAGAATTCAATAAAATTGG + Intergenic
1033919775 7:146376285-146376307 CTCTAAGAGAGTAAGGAATTCGG - Intronic
1034370534 7:150592383-150592405 CTCTAAGAACTTTATGAATTTGG + Intergenic
1035319353 7:158018658-158018680 CTTTAAGAATATAAGAAAGTAGG + Intronic
1038206114 8:25467119-25467141 CTCTTAGATTGTAATTCATTTGG + Intronic
1038289489 8:26236053-26236075 CTCTAAAAAAGCAAAAAATTAGG - Intergenic
1038382398 8:27108502-27108524 CTCTGAGAATGAATTGAATTGGG - Intergenic
1038680402 8:29662156-29662178 CTCTAATGATGTGATAAACTAGG - Intergenic
1038898886 8:31819237-31819259 CTCTAAAAATAAAATAAATTCGG + Intronic
1039626625 8:39060958-39060980 CTCAAACAATGAAATACATTTGG + Intronic
1040838581 8:51759243-51759265 TTCTAAGACAGGAATAAATTTGG - Intronic
1042304873 8:67321075-67321097 TTTTAAGAATGTCATAAATGTGG - Intronic
1043053664 8:75410437-75410459 CTTTAAAAATATAATAAAATGGG + Intronic
1043104926 8:76096327-76096349 ATCTAAGAATGTGGTAACTTTGG + Intergenic
1043172222 8:76979720-76979742 CTGTCAGAATGTCCTAAATTAGG - Intergenic
1045615768 8:103908423-103908445 ATCTGAGAATGTATTAAATATGG - Intronic
1045636906 8:104201474-104201496 ATCGAGGAATGTAAAAAATTCGG + Intronic
1047162528 8:122396662-122396684 TTCTAAGGAGGAAATAAATTAGG - Intergenic
1047544259 8:125800147-125800169 CTCTAAGAGTGTTAAAAATTAGG + Intergenic
1050432580 9:5576758-5576780 CTCTAAGAATTAAATAGATGTGG - Intergenic
1050451097 9:5781954-5781976 CTCTAAGAACTTTATAAATCTGG - Intronic
1050948492 9:11558082-11558104 CTCTAAAAATGTAAGAACATTGG + Intergenic
1051311032 9:15772531-15772553 CTTTAAGATTGTGATATATTGGG + Intronic
1052282361 9:26747873-26747895 TAATAAAAATGTAATAAATTAGG - Intergenic
1052520569 9:29543186-29543208 TTCTCAGAATGTCATATATTTGG + Intergenic
1052544020 9:29849762-29849784 CTGTAAGGGTATAATAAATTTGG - Intergenic
1053085975 9:35222385-35222407 TTCTAAGAATTTAATATTTTGGG + Intronic
1053517584 9:38744189-38744211 CCCTAAGGATGAAAGAAATTAGG - Intergenic
1053584773 9:39445435-39445457 CTCTATGAATGTAGTGAATGTGG - Intergenic
1053584800 9:39445687-39445709 CCCTATGAATGTAATGAATGTGG - Intergenic
1053584861 9:39446341-39446363 CTTTATGAATGTAATGAATGTGG - Intergenic
1053706477 9:40758394-40758416 CTCTAAGAACTTAATAAATTTGG - Intergenic
1054581455 9:66918881-66918903 CTTTATGAATGTAATGAATGTGG + Exonic
1054581517 9:66919535-66919557 CCCTATGAATGTAATGAATGTGG + Exonic
1054581544 9:66919787-66919809 CTCTATGAATGTAGTGAATGTGG + Exonic
1057153891 9:92822126-92822148 CTTTAAGAATTTAATATGTTTGG + Intergenic
1057548661 9:96036260-96036282 CTCTATGTATGTAATATAATTGG + Intergenic
1057640701 9:96818152-96818174 CCCTATGAATGTAATGAATGTGG - Exonic
1057811672 9:98261949-98261971 ATTTAAGTATGTAATGAATTTGG + Intergenic
1058141411 9:101360021-101360043 ATCTAATAATGAAACAAATTTGG + Intergenic
1058858412 9:109089566-109089588 CACTAAGGACTTAATAAATTTGG + Intronic
1059266933 9:113042798-113042820 CCCTATGAATGTAATGAATGTGG - Exonic
1059267012 9:113043722-113043744 CCCTATGAATGTAATCAATGTGG - Exonic
1203485895 Un_GL000224v1:54323-54345 CCCTATGAATGTAATGAATGTGG + Intergenic
1203485909 Un_GL000224v1:54498-54520 CCCTATGAATGTAATGAATGTGG + Intergenic
1203485935 Un_GL000224v1:54749-54771 CTCTATGAATGTAATGAATGTGG + Intergenic
1203612592 Un_KI270749v1:23116-23138 CTCTACAAATGTAATTCATTTGG + Intergenic
1187508157 X:19894080-19894102 GTCTAAGAAAATAGTAAATTGGG + Intergenic
1187510735 X:19915953-19915975 TGCTAAGCAGGTAATAAATTTGG - Exonic
1187539741 X:20180642-20180664 CTGTAAGAATGTGATTATTTGGG - Intronic
1188211275 X:27428127-27428149 CTGTAAGAATCTATTAAAGTAGG + Intergenic
1188695039 X:33179791-33179813 TTCTAAGATTGTAATAGTTTTGG - Intronic
1189103705 X:38216082-38216104 CTCTAAGAATGTTTTGAAATTGG - Intronic
1189714188 X:43848041-43848063 TTCTAAGTATTTAAAAAATTTGG - Intronic
1189977159 X:46473497-46473519 CCTTATGAATGTAATAAATGTGG + Exonic
1190092063 X:47447596-47447618 CACTATGAATGTAGTAAATGTGG - Exonic
1190243065 X:48672779-48672801 TTCTAAAAATATAAAAAATTAGG + Intergenic
1192318749 X:70071798-70071820 GTATAAGAATGTAATATATATGG - Intergenic
1193919912 X:87412586-87412608 CTCTTAGAATGAAAGAAATATGG + Intergenic
1194198559 X:90927186-90927208 CTCTAAGAAGCTGATATATTTGG + Intergenic
1194270066 X:91801752-91801774 CTCTCAGAATGTATTAAAAATGG + Intronic
1194735294 X:97505865-97505887 CTCTTAGAATCTGATAAATAGGG - Intronic
1195118140 X:101720495-101720517 ATCTACAAATGTAATAAATGTGG - Intergenic
1195118150 X:101720660-101720682 CCCTACAAATGTAATAATTTTGG - Intergenic
1196136402 X:112214213-112214235 CTCTATGAATGTAACTATTTTGG + Intergenic
1196887256 X:120260033-120260055 GTTTAAAAATGTTATAAATTAGG - Exonic
1197434170 X:126405042-126405064 TTTTAATAATGTAATTAATTTGG + Intergenic
1197964589 X:132045188-132045210 CTCTAACACTGTAATGAAGTGGG - Intergenic
1199808080 X:151321506-151321528 GTCTAAGAATCTTATAATTTTGG + Intergenic
1200543181 Y:4485642-4485664 CTCTAAGAAGCTGATATATTTGG - Intergenic
1200791163 Y:7300442-7300464 TTCTAATAATGCAATAAATATGG - Intergenic
1201501991 Y:14654967-14654989 TTCTAAGAATTAAATAGATTTGG + Intronic
1201582959 Y:15530571-15530593 CTCTAAGAATGTTGAATATTGGG + Intergenic