ID: 1105225108

View in Genome Browser
Species Human (GRCh38)
Location 13:18424758-18424780
Sequence CTTTAGGTGTGGAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 3, 2: 7, 3: 36, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105225108_1105225118 20 Left 1105225108 13:18424758-18424780 CCCTTTTCCCTCCACACCTAAAG 0: 1
1: 3
2: 7
3: 36
4: 284
Right 1105225118 13:18424801-18424823 CCCTTAAAAGACATGCCACAAGG 0: 5
1: 4
2: 4
3: 18
4: 178
1105225108_1105225121 26 Left 1105225108 13:18424758-18424780 CCCTTTTCCCTCCACACCTAAAG 0: 1
1: 3
2: 7
3: 36
4: 284
Right 1105225121 13:18424807-18424829 AAAGACATGCCACAAGGAGGAGG 0: 5
1: 5
2: 3
3: 35
4: 262
1105225108_1105225120 23 Left 1105225108 13:18424758-18424780 CCCTTTTCCCTCCACACCTAAAG 0: 1
1: 3
2: 7
3: 36
4: 284
Right 1105225120 13:18424804-18424826 TTAAAAGACATGCCACAAGGAGG 0: 5
1: 5
2: 4
3: 38
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105225108 Original CRISPR CTTTAGGTGTGGAGGGAAAA GGG (reversed) Intergenic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901899043 1:12342275-12342297 CTTTAGGGATAGAGGGAGAATGG - Intronic
901946993 1:12712134-12712156 CCTTAGGTATGGAGGGAATTGGG + Intergenic
902338748 1:15768797-15768819 ATTTAGGTATAAAGGGAAAAAGG - Intronic
905002938 1:34687649-34687671 CTGTAGGTGGGAATGGAAAATGG - Intergenic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
907631281 1:56084756-56084778 CTTTAGGTGAGGACAGGAAAAGG - Intergenic
907923286 1:58932774-58932796 ATTTGGGCGTGGAGGGAAATGGG + Intergenic
908207666 1:61868013-61868035 CTATATTTGTGGAGGGCAAATGG + Intronic
908678770 1:66635383-66635405 GTCTATGTGTGGAGGGAAACTGG - Intronic
909099692 1:71334881-71334903 TTTGAGTTGTGGAAGGAAAATGG + Intergenic
909151287 1:72009305-72009327 CCTGAAGCGTGGAGGGAAAAGGG - Intronic
909210864 1:72821141-72821163 CTTGAGGTGTTGAGAGAAACAGG + Intergenic
911069773 1:93823465-93823487 CTTCAGGAGTGGAAGGGAAAAGG - Intronic
912761498 1:112371345-112371367 ACTTATGAGTGGAGGGAAAAGGG - Intergenic
913409770 1:118538286-118538308 CTTTAAGAGATGAGGGAAAAGGG - Intergenic
913717862 1:121556324-121556346 CTTTAGGTGTGCATATAAAAGGG + Intergenic
915008787 1:152665145-152665167 CTCTCAGTGTGAAGGGAAAAGGG + Intergenic
915346747 1:155201384-155201406 CTTCAGGCGTGGAAGGAAAAGGG - Intronic
915530731 1:156500823-156500845 CTTGAGGGGTGGGGGGAAAGGGG + Exonic
916808275 1:168281169-168281191 CTTCAGGCAGGGAGGGAAAAAGG + Exonic
917112483 1:171563171-171563193 CTACAGATGTGGAGAGAAAATGG - Intronic
920146082 1:203861950-203861972 CTTCAGGTGCGGAGTGAAAACGG + Intronic
921234040 1:213106384-213106406 GTTTAGGTGTGAAAGGGAAAAGG + Intronic
923185680 1:231570948-231570970 CTTCATGTATGGAGGTAAAATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924642822 1:245850049-245850071 CTTGGGGTTTGGGGGGAAAAAGG + Intronic
924947439 1:248855891-248855913 CTTTAGGTGTGCAGGTGACAGGG + Exonic
1063872862 10:10438386-10438408 CTTAAGGTGTGGAGGGGAAGAGG - Intergenic
1063940179 10:11120551-11120573 CTTCTGGTGGGGAGGGGAAAGGG - Intronic
1064106996 10:12508702-12508724 GTTTAGTTGGGGAGGGAGAAAGG - Intronic
1064286798 10:13998671-13998693 GATTGGGTGTGGAGGGAGAAAGG - Intronic
1064601341 10:16996885-16996907 CTTTAGGAATGAAGGGATAAGGG - Intronic
1065930456 10:30474113-30474135 CCTTTGGTGTGGCAGGAAAAAGG + Intergenic
1066119285 10:32268221-32268243 TTTTTGGTGTGGAAGGAAATGGG + Intronic
1068737710 10:60432953-60432975 CTTTGGCTGAGGATGGAAAAAGG - Intronic
1068924252 10:62518348-62518370 GTTTACTCGTGGAGGGAAAAAGG - Intronic
1068955459 10:62816128-62816150 TTTTAAGTGTGGAGGGCAAAAGG - Exonic
1069302583 10:66927027-66927049 CTGTAGGTGTGAAGGCAAAATGG + Exonic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070268216 10:74925411-74925433 CTTCACTTGTGGGGGGAAAAAGG - Intronic
1071283566 10:84124623-84124645 CTTTAGGTTGGGAGGGGAACAGG + Intergenic
1071368137 10:84922370-84922392 CTGTATCTGTGGAGGGACAATGG + Intergenic
1071868917 10:89770035-89770057 CTTTGGGTGCAGAGGCAAAATGG - Intronic
1072723862 10:97799581-97799603 TTTTAGGTGTGGGAGGAGAAAGG + Intergenic
1073509507 10:104034476-104034498 ATTTTGGTGTGGAAGGAAACCGG + Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076097393 10:127742983-127743005 CTTTAGGTATGGAGGGTAGGGGG - Intergenic
1077745838 11:4904088-4904110 CTTGATGTCTGGAAGGAAAATGG + Intronic
1078378551 11:10818160-10818182 CTTTATGTGTGGGGTGAAAGAGG + Intronic
1078553887 11:12302131-12302153 CTTTTAATGTGGAGAGAAAAGGG + Intronic
1079440144 11:20505255-20505277 ATTAAAGTGTGGAGGGAAAAAGG - Intronic
1080875624 11:36271774-36271796 CTTTCGGTGTGGCAGGAAGATGG + Intergenic
1081042147 11:38225668-38225690 CCTTAGAGGTGGAGGGGAAAGGG + Intergenic
1081207172 11:40289937-40289959 CATTAAGTGTGGAGGGCACAGGG + Intronic
1083145815 11:60757626-60757648 CTTTAAGGGTGGAGGAAAAGAGG - Intronic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1087466411 11:98512250-98512272 CTATTGGTGAGGAGGTAAAATGG - Intergenic
1088107529 11:106223609-106223631 CCTTAGGGGTGGAAGGGAAAGGG - Intergenic
1088980087 11:114854697-114854719 CTTTAGGTCCAGTGGGAAAATGG - Intergenic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1090617715 11:128530985-128531007 ACTGAGGTGTGGAGGTAAAAAGG + Intronic
1096240610 12:49958024-49958046 CTCCAGGGGTGGAGGGAAATTGG + Exonic
1097915408 12:65015774-65015796 TTTTATGTGTGGATAGAAAAAGG + Intergenic
1100616136 12:96233155-96233177 CATGAGGTGGAGAGGGAAAAAGG + Intronic
1104070872 12:125344407-125344429 CTTTTGGGCTAGAGGGAAAAGGG + Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1109344442 13:61098468-61098490 CTTCAAGTGAGAAGGGAAAATGG - Intergenic
1110903689 13:80858070-80858092 CTTAAGCTGTGTAAGGAAAAAGG + Intergenic
1112310738 13:98315509-98315531 CTTTAGGAGTGGAGACAAACGGG - Intronic
1112741338 13:102476457-102476479 CTGTAGGTGTAGAGCAAAAACGG - Intergenic
1113119939 13:106915447-106915469 CTTACAATGTGGAGGGAAAAAGG + Intergenic
1113255967 13:108505256-108505278 CTTTTAGTGGGGAGGTAAAATGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114009216 14:18349126-18349148 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1115568930 14:34649037-34649059 CTTTAGGTTTGGAGGGAATTGGG + Intergenic
1117431357 14:55666169-55666191 CTTTTTGTGTGTATGGAAAATGG + Intronic
1119613135 14:76080485-76080507 CTAAAGTTGTGGAGGGAAAGGGG + Intronic
1119741695 14:77017913-77017935 CTTTAGCTGTGGAGGAGAGATGG + Intergenic
1119761457 14:77154914-77154936 CCCTAGGTGTGGAGGGGGAATGG + Intronic
1120303756 14:82741044-82741066 CTTTAGGGGTGGGAGGAAAGGGG - Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1123392409 15:19889729-19889751 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1125709522 15:41773781-41773803 CTTTAGGTGAGGAAGCACAATGG + Intergenic
1126418676 15:48447325-48447347 TTTTATGGGTGTAGGGAAAAAGG - Intronic
1126421761 15:48481434-48481456 CTTGACCTGTGGGGGGAAAAAGG - Intronic
1127417650 15:58772266-58772288 CTTTTGGGGTGGAGGAAAACGGG + Intronic
1128665392 15:69533782-69533804 ATTTAAGTATGGAAGGAAAAGGG - Intergenic
1130559229 15:84945469-84945491 GTTTGGATGTGGAGGGGAAACGG - Exonic
1130976925 15:88783519-88783541 CTTCAGGTGTGGTGTGAAATTGG + Intergenic
1131792822 15:95983519-95983541 CTTTGGATGTGGAGGCAAATGGG + Intergenic
1132378857 15:101351746-101351768 CTTCATGGGTGGTGGGAAAATGG + Intronic
1133149153 16:3813914-3813936 CATTTGGTGTGGAAGGAAGATGG - Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136900665 16:34034296-34034318 CTTTACCGGTGGTGGGAAAATGG - Intergenic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1138565798 16:57831919-57831941 CTTTGGGGGTTGAGGGGAAAGGG + Intronic
1138753873 16:59458444-59458466 CTTTTGGAATGGAAGGAAAAAGG - Intergenic
1139484447 16:67247992-67248014 CTTTAGTTGTGGGAGGAAGAGGG + Intronic
1140118849 16:72066101-72066123 CCTTAGGTGTGGAAAGAAAAGGG - Intronic
1141171558 16:81694855-81694877 CCTCAGGCATGGAGGGAAAAAGG + Intronic
1143801370 17:9384929-9384951 TTTTTGGTATGGAGAGAAAAGGG - Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148688817 17:49515110-49515132 CTTTTGGTGTGGGGGAAAAGAGG - Intergenic
1148987261 17:51633820-51633842 CTTCATGTGTGGAGGTATAATGG - Intronic
1149960636 17:61105755-61105777 CTTTAAGTGTTGGGAGAAAATGG + Intronic
1151504525 17:74518336-74518358 CTATTGGTGGGGAGGTAAAATGG + Intergenic
1151923167 17:77173225-77173247 CTTTAGAAGTGGTGGGGAAAGGG + Intronic
1153373656 18:4351008-4351030 CTTTAGGAGTTTAGTGAAAATGG + Intronic
1154348762 18:13565755-13565777 CTTTGTGTGTGGAGGGGAATTGG + Intronic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1154929570 18:20978760-20978782 CTTGAGGTGGGGAGGAAAGAAGG + Intronic
1156111593 18:33733598-33733620 CATTCAGTGTGGAGGGAATATGG - Intronic
1157294050 18:46429340-46429362 CCTCTGGTGTGGAGGGCAAAGGG - Intronic
1157349253 18:46870194-46870216 CCTTAGAGGTGGAGGGGAAAAGG - Intronic
1158194977 18:54874864-54874886 GTTTAGGGGAAGAGGGAAAAAGG + Intronic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1163054237 19:14706360-14706382 GTTGAGGGGTGGAGGGAAGATGG - Intronic
1163113980 19:15178348-15178370 CTGGAGGTTTGAAGGGAAAAGGG - Intronic
1164639652 19:29814650-29814672 CTGTATGTGAGCAGGGAAAAAGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
927849745 2:26491360-26491382 GTGGAGGGGTGGAGGGAAAAAGG + Intronic
929510879 2:42565151-42565173 CTTTAGGTGAATAGGTAAAATGG - Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
931465601 2:62484077-62484099 CTTAAGCTTTGAAGGGAAAATGG - Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
933695929 2:85217181-85217203 CATTTGTTGTGGAGTGAAAATGG - Intronic
933788304 2:85862334-85862356 CTTTAAATATGGAGGGTAAATGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935047916 2:99498480-99498502 TCTTAGGTATGGAGGGAAATGGG - Intergenic
935114256 2:100121014-100121036 GTTTAGGTGTGAAGGTGAAAAGG + Intronic
937577801 2:123445177-123445199 CTTTAGGAGTGTAGAGACAATGG + Intergenic
937818703 2:126283501-126283523 CTTTAGCTGATTAGGGAAAAAGG + Intergenic
938166243 2:129029476-129029498 CTTTAGGTGTGGTAGGGAAAGGG - Intergenic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
940352216 2:152702978-152703000 CTTGAGTTGTAGAGGGGAAAGGG - Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941065047 2:160892438-160892460 CTTGAGGGGAGGAGGGAAAGAGG - Intergenic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
944477324 2:200120214-200120236 CTTTGGGTCTGGTGGGTAAAAGG + Intergenic
945169072 2:206977157-206977179 CTTCAGGTCTGCAGGGAAATTGG - Intergenic
945769402 2:214021943-214021965 CTTTAGGTGATGAGGGGAAAAGG - Intronic
946778061 2:223164665-223164687 ATATAAGTGTGGAGGGAGAAAGG - Intronic
947266508 2:228288207-228288229 AATTAGGTTAGGAGGGAAAAAGG - Intergenic
947301154 2:228689717-228689739 CTTTAGGTGTGAAGGAAGAATGG + Intergenic
947668065 2:231919464-231919486 CTTCAGGTCTGGATGTAAAAGGG + Intergenic
948738652 2:240027465-240027487 TTCTAGCTGGGGAGGGAAAACGG - Intergenic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1170930226 20:20762816-20762838 CTTTAGGTCTGGGGTGACAACGG + Intergenic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172987334 20:39002412-39002434 CTATTGGTTAGGAGGGAAAATGG + Intronic
1173975227 20:47181898-47181920 CTTGAGGTATGCAGGAAAAATGG - Intronic
1174045596 20:47730355-47730377 ATTCAGGTGTGGAAGGAGAAAGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1175773982 20:61641578-61641600 CTGTAGGTGTGGTGGGATCAGGG - Intronic
1176769160 21:13053776-13053798 CTTTAGGTGTGGACGGAAAAGGG - Intergenic
1176769380 21:13055356-13055378 CTTTTGGTGTGTGGGGTAAAGGG + Intergenic
1177098209 21:16866015-16866037 GTTTAGGTTTGGGGGGAAAAGGG + Intergenic
1177731540 21:25033719-25033741 CGTTTAGTGTGGAGGAAAAATGG - Intergenic
1178381991 21:32117869-32117891 GCTCAGGTGTGGAGGGAAATGGG - Intergenic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1180433717 22:15279936-15279958 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1180516273 22:16147845-16147867 TCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1181551280 22:23640200-23640222 CTTAAGGCTTGGAGGGCAAAGGG + Intergenic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1183512474 22:38244141-38244163 CTTTAGGTTTGGCAAGAAAATGG - Intronic
1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG + Intergenic
1184945694 22:47802252-47802274 CTTTAGTTGTGAAGGGAAACAGG - Intergenic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
950182219 3:10922562-10922584 CTTCAGGGGTGGTCGGAAAAGGG + Intronic
950704212 3:14769984-14770006 CTTGAGGAGTGCAGGGGAAAAGG - Intronic
950943459 3:16918667-16918689 CTTTATGTGTTGAAGGAAAAAGG + Intronic
951650984 3:24951235-24951257 CTTTAGGAGGGGAGGCAGAAAGG + Intergenic
952047584 3:29342184-29342206 CTTCAGGTGTGAACAGAAAATGG + Intronic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953593407 3:44283034-44283056 CATGAGATGTGGAAGGAAAAAGG + Intronic
955114541 3:55984387-55984409 CTTGAGGTGTGGGAGCAAAAGGG + Intronic
956223915 3:66934697-66934719 CTTAAGGAGTGAGGGGAAAATGG - Intergenic
956256260 3:67286205-67286227 GTTTATGTGGGGAGTGAAAAAGG - Intergenic
956531826 3:70229033-70229055 CTTTAGCTGTGGAGGCTAAGTGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
958957956 3:100481559-100481581 CTTTAGTTGTGGAAAGAAAGAGG + Intergenic
959681722 3:109104221-109104243 CTCTCTGTGGGGAGGGAAAAAGG + Intronic
959760072 3:109951484-109951506 CTAGAGGTTTGGAGGGAAATAGG + Intergenic
961582244 3:127892357-127892379 CCTTAGGTACGGAGGGAAATGGG - Intergenic
962644996 3:137429455-137429477 CTTTATTTGGGGTGGGAAAAAGG + Intergenic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
963432034 3:145219786-145219808 CATTAGGTGAAGAGGGAAATGGG - Intergenic
963498731 3:146098047-146098069 GTTGAGGGGTGGAGGGAAAGGGG + Intronic
964083135 3:152784871-152784893 TTTTATTTGGGGAGGGAAAAGGG - Intergenic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
965110967 3:164421660-164421682 TTTTGGGGGTGGAGGGTAAAGGG - Intergenic
967708017 3:192675048-192675070 CTTTAGGTGCAGAAAGAAAATGG + Intronic
967719979 3:192805848-192805870 GTTTATGTGTGGTAGGAAAAGGG - Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
970423165 4:15923872-15923894 TTTTAGGTATGGAGGCAACATGG - Intergenic
970955311 4:21803883-21803905 CTTTATGTTTGGAGGTAAAATGG - Intronic
971714255 4:30154867-30154889 CTTTAGGTTTTGAGGATAAAAGG + Intergenic
972083635 4:35184817-35184839 GTTGAGGGGTGGAGGGAAAGGGG + Intergenic
975258410 4:72267796-72267818 CTCTAGGTCTGGAAGGAATATGG + Intergenic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977977533 4:103284837-103284859 CTTTTGGTGGGGATGCAAAATGG + Intergenic
978010427 4:103675584-103675606 CTTCAGGTGTGAAGGGTGAAAGG + Intronic
978187312 4:105871863-105871885 CTTTGGGTGTAAAGGGACAATGG - Intronic
978313882 4:107414875-107414897 TCTTAGGTATGGAGGGAAATGGG - Intergenic
978475057 4:109117360-109117382 TTTAAAGTGTTGAGGGAAAAAGG + Intronic
978665045 4:111172434-111172456 TTATAGGTCTGGAGGTAAAAAGG - Intergenic
981815674 4:148828501-148828523 AATGAGGTGAGGAGGGAAAAGGG - Intergenic
984496609 4:180505999-180506021 CTTTATGTGTAGATGGAAAAGGG - Intergenic
984771819 4:183443400-183443422 CTTTTGGTATGGCAGGAAAATGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
987592607 5:19950355-19950377 CTTTAGGTATTCAGGGGAAAAGG + Intronic
987969360 5:24922321-24922343 CTTTAGGTGTGAAGCGAATTAGG + Intergenic
988029517 5:25745121-25745143 CCTTTGGTTAGGAGGGAAAAAGG + Intergenic
988721819 5:33886753-33886775 CCATAGGTGTGGATGGAAATCGG + Intronic
989960707 5:50411547-50411569 CTTTAGGTGTGCATATAAAAGGG - Intronic
990386578 5:55269835-55269857 GTTTGGGTGGGGAGGGAATAAGG + Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993289385 5:86045396-86045418 ATTTTGCTGTGGATGGAAAAAGG + Intergenic
994355003 5:98784908-98784930 GTTTCCTTGTGGAGGGAAAATGG - Intronic
994548149 5:101196036-101196058 CCTTATGTGGGGAGGAAAAATGG + Intergenic
995417772 5:111929080-111929102 CTTTAGTTGTAGAGGGGATAAGG - Intronic
995424290 5:112003039-112003061 CTTTAAGTGGGAAGGGATAAAGG + Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
1001093399 5:168758009-168758031 CTCCCGGTGTGGAAGGAAAATGG - Intronic
1001184124 5:169551198-169551220 CCTTAGGCATGGAGTGAAAAGGG - Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1002788371 6:420851-420873 CTTTAGGTGGGGAAAGAGAATGG + Intergenic
1006414620 6:33896097-33896119 CCTTACCTGTGCAGGGAAAATGG + Intergenic
1007236351 6:40393466-40393488 ATTTAGAGGTGGAGGGAAAGAGG + Intronic
1009239245 6:61163737-61163759 ATTTAGGTGTGGAGCCAAGATGG - Intergenic
1012385108 6:98671806-98671828 CTTGAGGTGTGGTGAGAAACTGG + Intergenic
1012579223 6:100844751-100844773 CTCAAGGTAGGGAGGGAAAAGGG + Intronic
1012817814 6:104046406-104046428 ATTTAGGTGTGGAAGAAAATAGG + Intergenic
1014090641 6:117400172-117400194 CATGAGGTGAGGAGAGAAAAGGG - Intronic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1017569316 6:155726111-155726133 CTTTACGTGTCGAGGGAAGGAGG + Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1018004093 6:159604203-159604225 CTTTAAGTGTGCAGAGAAGAAGG - Intergenic
1018542527 6:164898035-164898057 CTTTGGGGGTGGGGGAAAAAAGG - Intergenic
1018596614 6:165487860-165487882 CTGCAAGTGTGCAGGGAAAAGGG - Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019692680 7:2425423-2425445 TTTTGGGGGTGGAGGGTAAAAGG - Intronic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1021273758 7:18624331-18624353 TTTTAGGTGAGAAGAGAAAAAGG + Intronic
1021426599 7:20506933-20506955 TTTTAGGAGAGGACGGAAAAAGG + Intergenic
1021579898 7:22141632-22141654 CATGAGGTGTGGAGGCAACACGG - Intronic
1022190487 7:28012927-28012949 CTTAGGTTGTGGTGGGAAAAAGG - Intronic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023870347 7:44260045-44260067 CTTGAGGACTGGAGGGAATAAGG - Intronic
1025248843 7:57338158-57338180 CTATAGGGGTGGCGGGAGAAGGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026289096 7:68989871-68989893 CTTAAGGTATGGAGAGAAACAGG - Intergenic
1026601727 7:71783104-71783126 AATCAGGTGTGGAGGGAAGATGG + Exonic
1027192542 7:76005404-76005426 CCTGAAGTGTGGAGGGAGAAAGG + Exonic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1028614357 7:92748823-92748845 CTATAGGTGTGGATGGGGAATGG - Intronic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1030352336 7:108503938-108503960 CATGAGGTGTGGAAGGCAAAAGG + Intronic
1031362283 7:120860887-120860909 CTAAAGTTGTGGAGAGAAAAAGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1036105017 8:5829424-5829446 CTTTAGGTGCAGAGGGAAATGGG + Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037172280 8:15907276-15907298 ATTCAGGTGTTGGGGGAAAAAGG + Intergenic
1039271647 8:35887828-35887850 CTTTTGGTGTTAAGGGAAAAAGG + Intergenic
1039608687 8:38902151-38902173 CTTTAGGACTGGAGGAGAAAAGG - Intronic
1039689767 8:39851220-39851242 CCTTAGATGTGGAGGGAAATGGG + Intergenic
1040799252 8:51322949-51322971 CTTTAGGTGAGCAGTGAGAATGG + Intronic
1040879008 8:52183974-52183996 CTTTGTGTGTGCATGGAAAATGG + Intronic
1041622948 8:59994583-59994605 CATTAGCTGTGGTGGGAAATAGG - Intergenic
1042978469 8:74498542-74498564 CTTTAAGTGATGAGGCAAAAGGG + Intergenic
1043660429 8:82734597-82734619 ATTTAGGTATTTAGGGAAAATGG - Intergenic
1043817448 8:84819064-84819086 CTCTATGTCTGCAGGGAAAAAGG + Intronic
1044020248 8:87096819-87096841 CTAAAGGTGTGGAGAGGAAAAGG - Intronic
1044931863 8:97259301-97259323 CTGTAGGTGGGGAGGGCAAGGGG - Intergenic
1044987982 8:97771861-97771883 ATTCTGGTGGGGAGGGAAAAAGG + Intergenic
1046031667 8:108789299-108789321 CTTGAAGTGTGGATGGAATAGGG - Intergenic
1050268944 9:3920997-3921019 CTTTAAGTTTGGTGGTAAAAAGG - Intronic
1050713982 9:8499699-8499721 CATTATGTGAGGATGGAAAATGG - Exonic
1050847703 9:10243812-10243834 CTTTAGGTTTGGGAGGATAAAGG - Intronic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1052182266 9:25544239-25544261 CTTTATGTGTGGCTGAAAAAAGG - Intergenic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1053706047 9:40753516-40753538 CCTTATGTGTGGAGAGAAAAGGG + Intergenic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1054416123 9:64877120-64877142 CCTTATGTGTGGAGAGAAAAGGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054859241 9:69932291-69932313 CCTTAGATGTAGAGGGAAATGGG + Intergenic
1056268622 9:84924771-84924793 CCATAGGAGTGGAGGGAGAAAGG - Intronic
1056551270 9:87654868-87654890 ATTTAGGTATGGAGTGAAACTGG - Intronic
1056600373 9:88042401-88042423 TCTTAGGTGTGGAGAGAAATGGG + Intergenic
1056884296 9:90425815-90425837 GTTTAAGTATAGAGGGAAAATGG - Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056994752 9:91445492-91445514 CTTTAGCTGTGGAGCCTAAAAGG + Intergenic
1057938949 9:99263834-99263856 GATTAGGTGTTGATGGAAAAGGG - Intergenic
1059368745 9:113807886-113807908 CTCTAGGTGTGGAGGTCCAATGG - Intergenic
1059795131 9:117686215-117686237 TTTTATGTGTTGAGGAAAAAGGG + Intergenic
1060889695 9:127180091-127180113 CATTACATGTGGAGGGAAAATGG - Intronic
1061506695 9:131035740-131035762 CAATAGGTGTGGAAGGCAAAGGG - Intronic
1185498527 X:578771-578793 CTTTAGGTGGGGAGGGCGACCGG - Intergenic
1187353031 X:18539923-18539945 TTTTAAGTGGGGAGGGCAAAAGG - Intronic
1187445217 X:19355196-19355218 CTTTGGGTGGTGAGGGAAAGCGG - Intronic
1188990405 X:36812042-36812064 ATGTAGGTGTGGAGTGGAAAGGG - Intergenic
1189545477 X:42037964-42037986 GTCTAGGTATGGAGTGAAAAGGG + Intergenic
1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG + Intronic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1191806326 X:65138236-65138258 GGTTAGGGGTGGAGGGGAAAGGG - Intergenic
1193494201 X:82190120-82190142 CACAAGGTGTGGAGGGAAAGTGG + Intergenic
1194923719 X:99797422-99797444 CTTTAATTCAGGAGGGAAAATGG - Intergenic
1195378443 X:104249836-104249858 GGGGAGGTGTGGAGGGAAAATGG + Intergenic
1195769176 X:108330707-108330729 GTATAGCTGTGGAGTGAAAACGG - Intronic
1195852303 X:109296247-109296269 CTTAAGGTGTGGATGGCAACTGG - Intergenic
1195938720 X:110148936-110148958 GCTTAGGTGTGAAGGGAAGAGGG - Intronic
1196069397 X:111503434-111503456 CTTTAGTAGTGGGGGGAAAAAGG - Intergenic
1197850228 X:130850866-130850888 ATTTAAGTTTGGGGGGAAAAAGG - Intronic
1199277583 X:145964343-145964365 CTTAATGGGAGGAGGGAAAAGGG + Intergenic
1200424637 Y:3007673-3007695 CCTTAAGTGTTGAGGGGAAAGGG - Intergenic
1201234156 Y:11893982-11894004 ATTAAGGTGGGGAGGTAAAAGGG + Intergenic