ID: 1105225435

View in Genome Browser
Species Human (GRCh38)
Location 13:18427198-18427220
Sequence CTCAACCATCTGCAGTTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 7, 1: 1, 2: 11, 3: 2, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105225435 Original CRISPR CTCAACCATCTGCAGTTCGA GGG Intergenic
901946697 1:12710073-12710095 CTTAACCATCTGCAGTTTGAGGG - Intergenic
907288094 1:53395040-53395062 CTAAACCATCTGCAGGGAGAAGG - Intergenic
907883766 1:58575195-58575217 CTCACCCTCCTGCAGTTTGAAGG + Intergenic
908121208 1:60987806-60987828 CTCTACCATTTGCAGTTACAAGG + Intronic
909601851 1:77469199-77469221 CTCACACATCTGCAGTGGGATGG + Intronic
912390664 1:109300417-109300439 CTCAACCCTTTGCAGTTCTTGGG - Intronic
912948723 1:114105953-114105975 CTAGACCATCTGCATGTCGAGGG - Intronic
917513012 1:175683665-175683687 CTCAAACACCTGCAGTGGGAGGG + Intronic
919291404 1:195637787-195637809 CTCAGCCATCTGCTGTAGGATGG + Intergenic
1064756215 10:18573684-18573706 CTTAACCATCTGCAGTTTGAGGG + Intronic
1065133303 10:22643951-22643973 CCCCACCATCTGCAGTGCAATGG + Intronic
1069769840 10:70891251-70891273 CTCCACCATCTGCAGCCTGATGG + Intergenic
1070359067 10:75669632-75669654 CTCAGTCAACTGCAGTTTGAAGG + Intronic
1071301320 10:84257990-84258012 CTGTACCATCTGCAGTTTGGGGG - Exonic
1075450681 10:122549941-122549963 CTTAACCATTTGCTGTTCGTAGG - Intergenic
1079764506 11:24374671-24374693 CTCCACCATCTGAAGTTTCAAGG + Intergenic
1079869223 11:25775489-25775511 CTCCATCATCTGCAGTGCTATGG - Intergenic
1081155050 11:39680054-39680076 CTCCACCCTCTGCAGATGGAAGG - Intergenic
1083375705 11:62218664-62218686 CTTGACCATCTGGAGTTCAAGGG + Intergenic
1086606550 11:88702851-88702873 GTCAACCATCTGTAGGTCAATGG + Intronic
1088107812 11:106225697-106225719 CTTAACCATCTTCAGTTTGAGGG + Intergenic
1090323969 11:125869116-125869138 CTTAACCATCTGCAGTTCAAGGG - Intergenic
1091184886 11:133638200-133638222 CTCAAGCATCTGCAGTAGAAAGG + Intergenic
1098219398 12:68252639-68252661 CTCACTCATCTGCAGGTGGAAGG + Exonic
1099368082 12:81795091-81795113 CTCAACCATCAGCAGTAGAAAGG + Intergenic
1102606066 12:114068196-114068218 CTTAACCATCTGCAGTTTGAGGG + Intergenic
1105225435 13:18427198-18427220 CTCAACCATCTGCAGTTCGAGGG + Intergenic
1105673765 13:22648276-22648298 TTCAACCACCTGCATATCGAGGG - Intergenic
1107633676 13:42369971-42369993 CTCAACTATCTGCTTTTCCATGG + Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1113525199 13:110969134-110969156 CTTAACCATCTGCAGTTTGAGGG + Intergenic
1121214254 14:92235081-92235103 CAAAACCATCTGCACTTTGAGGG - Intergenic
1125690003 15:41588299-41588321 CTTAGCTATCTGCAGTTTGAGGG + Intergenic
1126496302 15:49294346-49294368 CTCAACTATCTGTAGTTCCCTGG - Intronic
1137019371 16:35408409-35408431 CTAAGCCTTCTACAGTTCGAGGG - Intergenic
1139467693 16:67162961-67162983 CAGAACCATCAGCAGCTCGATGG - Exonic
1140119125 16:72068202-72068224 TTTGACCATCTACAGTTCGAGGG + Intronic
1140687575 16:77448400-77448422 CTCAACCTTCTGCACTTCACAGG + Intergenic
1151530592 17:74702257-74702279 CCCAACCATCTGCAGTCAGCTGG - Intronic
1154527936 18:15312325-15312347 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1160429539 18:78801944-78801966 CACAAACATCTGCAATTGGAGGG - Intergenic
1163862974 19:19751926-19751948 CTCCACCTCCTGCAGGTCGAGGG - Intergenic
927212958 2:20649916-20649938 CTCAGCCATGTGCAGATGGATGG - Intronic
933389780 2:81654814-81654836 CTTAACCATCTGCAGTTTGAGGG - Intergenic
937315519 2:120929823-120929845 CTCAGCCACCTGCAGGTGGAGGG - Intronic
938527036 2:132143782-132143804 CTCAACCATCTGCAGTTCGAGGG - Intergenic
938599903 2:132826884-132826906 TGCAAGCATCTGCAGTGCGATGG + Intronic
940352497 2:152705011-152705033 CTTAACCATTTGCAGTTCAAGGG + Intronic
941485838 2:166081161-166081183 CTCCTCCATCTGCACTTTGAGGG - Intronic
942064934 2:172261781-172261803 GTGTACCATCTGCAGTTGGATGG + Intergenic
943040792 2:182802582-182802604 CTCAAACATCAGCAGCTCCAAGG - Intergenic
947200585 2:227611528-227611550 CTGAAGCCTCTGCAGTTGGATGG + Exonic
1168823866 20:795603-795625 CTTAACCATCTGCAGTTTGAGGG + Intergenic
1170215023 20:13882608-13882630 CTCATGCATCTGCAGTTAGCTGG - Intronic
1170941400 20:20851187-20851209 CTCATCCATCTGAAGGTTGATGG - Intergenic
1174744020 20:53043894-53043916 CTCAAACATCTGTACTTCGCTGG + Intronic
1175126294 20:56754432-56754454 CTCAAGCATCTGCAGTCATAAGG + Intergenic
1176769488 21:13056221-13056243 CTCAACCATCTGCAGTTCGAGGG + Intergenic
1177440887 21:21122595-21122617 CTCAGCCATCTCCAGTTAGTTGG + Intronic
1180056690 21:45362553-45362575 CTCAAGCATCAGCTGCTCGATGG + Intergenic
1180516590 22:16150165-16150187 CTCAACCATCTGCAGTTCGAGGG + Intergenic
1184064705 22:42111429-42111451 CTTAACCATCTGGAGTTCGAGGG - Intergenic
950846457 3:16020490-16020512 CTTAACCATCTGCAGTTTGAGGG - Intergenic
951232577 3:20196883-20196905 CACAATCATCTGCATTTCTATGG - Intergenic
952198160 3:31097712-31097734 AACAACCATCTGGAGTTCAATGG - Intergenic
953567581 3:44046083-44046105 CTCAACCATCTGCACCTGGCAGG - Intergenic
954293271 3:49660894-49660916 CTCAACCAGCTGCGGCTCCAGGG + Exonic
955634197 3:61008107-61008129 CACACCCATCTCCAGTTCTAGGG + Intronic
957461252 3:80523467-80523489 CTCAACCATTTGCAAATTGAGGG - Intergenic
962249985 3:133830144-133830166 CTCTGCCAGCTGCAGTTCTATGG + Intronic
963327146 3:143875462-143875484 CTCATCCAGCTGCAGTTTGGGGG + Intergenic
963713788 3:148779619-148779641 CTCTACCATCTTCAGTTCTTGGG - Intergenic
972610361 4:40650554-40650576 TTCCACCATCTGCAGTGTGATGG + Intergenic
975627824 4:76367447-76367469 CTCTGTCATCTGCAGTTTGAGGG + Exonic
980549880 4:134320864-134320886 CTCATGCATCTGCAGTTAAATGG - Intergenic
986065429 5:4229880-4229902 CTCTACCCTCTGCCGTTCCATGG + Intergenic
988385799 5:30563524-30563546 CTCACCCATCTGCAATTAGCTGG + Intergenic
989613851 5:43320137-43320159 CTTAACCATCTGCAGTTTGAGGG - Intergenic
996796408 5:127353025-127353047 CTCAACTGTCTGCAGTTTGCAGG + Intronic
1000071696 5:157745782-157745804 CTCAACTGTCTGCAGTGCCATGG - Intronic
1000793805 5:165639720-165639742 AACAACAATATGCAGTTCGATGG - Intergenic
1006283794 6:33077967-33077989 CTCACCCCTCTGCAGTTCCCAGG - Intronic
1011104902 6:83768717-83768739 CTGAACCACCTGCAGTCCCAGGG + Intergenic
1013967512 6:115972398-115972420 CTCCACCCTCTGCAGTTGGGAGG - Intronic
1016890831 6:149005309-149005331 CTCAACCCTCTCCAATTCTATGG - Intronic
1020745126 7:12070475-12070497 CTTAACCATCTGCAGTTCGAAGG + Intergenic
1028018371 7:85742436-85742458 CTTAACCATCTGGAGTTCGAGGG - Intergenic
1030787833 7:113684460-113684482 TTCCACCATCTGCATTCCGATGG + Intergenic
1033097845 7:138446534-138446556 CCTAAACATCTGCAGTTTGAAGG - Intergenic
1041490704 8:58429492-58429514 CTCCACCTTCTGCAGTTTGTGGG + Intronic
1041867815 8:62596790-62596812 CTCAAACCTATGCTGTTCGAGGG - Intronic
1050188658 9:3001825-3001847 GTTAACCATCTGCAGATCCAGGG + Intergenic
1053705731 9:40751133-40751155 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1054415808 9:64874740-64874762 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1054858948 9:69930211-69930233 CTTAACCATCTGGAATTTGAGGG - Intergenic
1189753280 X:44245028-44245050 CTCAACCATCTTCATTTCATAGG + Intronic
1193873256 X:86828386-86828408 CTCCACCATCAACAGTTCAAAGG - Intronic
1194767114 X:97854562-97854584 CTAAATCAACTGCAGTTTGAAGG - Intergenic