ID: 1105234792

View in Genome Browser
Species Human (GRCh38)
Location 13:18539563-18539585
Sequence GTTTCTATGCAGAAATTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 889
Summary {0: 4, 1: 1, 2: 1, 3: 20, 4: 863}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105234792 Original CRISPR GTTTCTATGCAGAAATTGCA TGG Intergenic
901901761 1:12370326-12370348 GTTTCTGTGCTGAAATAACAGGG + Intronic
908781299 1:67692985-67693007 ATTTCTCTGCAAAAATTGCAGGG + Intergenic
908993328 1:70121700-70121722 GTTTCTATTCATAAAATTCACGG - Intronic
909046953 1:70721855-70721877 ATTTCAATGAAGAAATTCCATGG - Intergenic
909440712 1:75692504-75692526 GATTCTATGCAGAAGTAGAAGGG + Intergenic
910103405 1:83603069-83603091 GTTTCCTTCCAGGAATTGCATGG - Intergenic
912247176 1:107971631-107971653 GTTGGTATGAAGAAATTGCCAGG + Intergenic
912311418 1:108625034-108625056 GCTGCTTTGCAGAAGTTGCAGGG - Intronic
915862480 1:159460583-159460605 TTGTCTATGTAGAAATTCCAAGG - Intergenic
917691287 1:177472070-177472092 GTTTATATGCAGGAGCTGCAGGG - Intergenic
918295879 1:183156512-183156534 GTTAATATTCAGAAATTACAAGG - Intergenic
919531799 1:198730264-198730286 GTCTCTATGCAGAAACTTTAGGG + Intronic
919608921 1:199720887-199720909 TTTTCTAGCCAGAAATAGCATGG - Intergenic
924004099 1:239588077-239588099 GTTTTTATGCAGTATTTGCATGG - Intronic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
1068402633 10:56550130-56550152 GTTTACAAGCAGAAATTACAGGG - Intergenic
1069152372 10:64979848-64979870 ATTTCCTTGCAGAAATTACAAGG - Intergenic
1069795483 10:71049270-71049292 GTCTGTAGGCAGAAATTGCCCGG + Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1070896451 10:79986499-79986521 GTTTCTATGGTGAAATAGGAAGG + Intergenic
1070969534 10:80552137-80552159 GTTTCAATGTATGAATTGCAGGG + Intronic
1071403139 10:85298169-85298191 ATTTCTATGGAGCAATGGCAAGG - Intergenic
1073651917 10:105370109-105370131 ATTTTGATGTAGAAATTGCAAGG - Intergenic
1076577493 10:131479317-131479339 GTCTCTATGCTGAAATAGCCAGG - Intergenic
1078918844 11:15807927-15807949 GTTTCTATGCTGCAAATGAATGG + Intergenic
1079275977 11:19038097-19038119 CTTTCCATGGAGAGATTGCAGGG - Intergenic
1081119787 11:39252910-39252932 GTTTCTATGTAAAAATTCCCTGG - Intergenic
1081436293 11:43030990-43031012 GTTTCTGTTCTGAAATTGCAGGG + Intergenic
1082600302 11:55142255-55142277 GTCTTTATGAAGAAACTGCAAGG - Intergenic
1082617073 11:55373719-55373741 GAAACTATGTAGAAATTGCATGG + Intergenic
1082986284 11:59173111-59173133 CTTTCTATGTAGAAATTCTAGGG + Intronic
1087977530 11:104568069-104568091 GTTTCTTTGCTGAAATGGCAAGG - Intergenic
1088021735 11:105128228-105128250 GTGTCAATGAAGAAATTACAAGG + Intergenic
1088933575 11:114377058-114377080 GTATTTATGCACAAATTGTATGG - Intergenic
1090102434 11:123813830-123813852 GTTTCTATGCACTTATTTCATGG + Intergenic
1091610870 12:2007516-2007538 GTGTCTGTGCTGAAATTACATGG + Intronic
1092667861 12:10825105-10825127 GTTTGTAGGAAGAAGTTGCAGGG + Intronic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1099077265 12:78125578-78125600 GTTTCTAGGCAGAAATGTCAAGG - Intronic
1101013746 12:100477788-100477810 GTTGCCATCCAGAATTTGCAGGG + Intronic
1102625761 12:114234369-114234391 GGTTCAAGGCTGAAATTGCAAGG - Intergenic
1105234792 13:18539563-18539585 GTTTCTATGCAGAAATTGCATGG + Intergenic
1108166466 13:47698506-47698528 GTCTAGATGCAGAAATTGTATGG + Intergenic
1109747255 13:66641397-66641419 ATTTGTATGGAGAAAGTGCATGG + Intronic
1111548261 13:89773288-89773310 GTGTCTATGCAGACATTCAAAGG - Intergenic
1112609166 13:100938991-100939013 ATTTTTATGCAATAATTGCAGGG - Intergenic
1116660846 14:47708728-47708750 TTCTCCATGCAAAAATTGCAAGG + Intergenic
1120109372 14:80535305-80535327 GTCTGAATGCAGAAATGGCAAGG + Intronic
1120468228 14:84888626-84888648 GTTTCTATGGTGAAATTTGATGG + Intergenic
1123218996 14:106839462-106839484 CTAGCTATGCAGAAAGTGCATGG - Intergenic
1125221516 15:37342044-37342066 GGTTCTTTGGAGAAATAGCATGG + Intergenic
1127979030 15:64020825-64020847 GTTTCTATGGAGTAATGGAAAGG + Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1129090957 15:73150105-73150127 GTTTCAAAGCAGAATTTACATGG + Intronic
1132413171 15:101600897-101600919 GCTTCTGAGGAGAAATTGCAGGG + Intergenic
1135106868 16:19657419-19657441 GTTTATCTGCAGAAATGGGAAGG - Intronic
1137531008 16:49279073-49279095 GTTTCTTTAAATAAATTGCAGGG + Exonic
1139159062 16:64481085-64481107 GTTTGCATGTATAAATTGCATGG + Intergenic
1140666803 16:77235439-77235461 GTTTCCATGCATAAATAACATGG + Intergenic
1144018075 17:11215666-11215688 CTGCCTAAGCAGAAATTGCAAGG - Intergenic
1147948338 17:44092969-44092991 GTCTCTAAGGAGAGATTGCAGGG + Intronic
1149276051 17:55038652-55038674 GGTTATATGCAGAAAGGGCAAGG + Intronic
1151709323 17:75792661-75792683 GTATCTGTGGAGAAAGTGCATGG + Intronic
1153149509 18:2074982-2075004 GATACTATGAAGAAATTGAATGG - Intergenic
1154514747 18:15150299-15150321 GTTTCTACGCAGAAATTGCATGG - Intergenic
1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG + Intergenic
1156676426 18:39531913-39531935 GTTTCCATGCAGAGAATGGACGG + Intergenic
1156783575 18:40881627-40881649 GTCTCTATGAAGTAATAGCATGG - Intergenic
1157959234 18:52133986-52134008 GTTTCTATGGATAATTTGCCAGG + Intergenic
1158520114 18:58164903-58164925 GTGTCTATGAAGCAATTGGATGG - Intronic
1163567763 19:18061618-18061640 GATCCTATGCAGAAATTTCTAGG - Intronic
1164381496 19:27740303-27740325 GTCTCTATGCATAGATTGCCTGG + Intergenic
1165421844 19:35725977-35725999 ATTTATATTCAGAATTTGCATGG + Intronic
925925416 2:8666572-8666594 GTTTCTAAGCAGAGAGTCCAAGG - Intergenic
926978323 2:18537126-18537148 GTTTTTATACAGAAATAGTAAGG - Intergenic
927304148 2:21550967-21550989 GTTTCTAAGAAGAAATTGAGAGG + Intergenic
928697902 2:33868967-33868989 ATTTCTATGCATGAATTGCCAGG + Intergenic
930217638 2:48713290-48713312 TTTATTATGCACAAATTGCAGGG + Intronic
932258237 2:70305111-70305133 GTTTCTATACACAAATTGAATGG + Intergenic
932280315 2:70485667-70485689 GTCCCTAAGCTGAAATTGCAGGG - Intronic
933537257 2:83591790-83591812 GTTTCTTGGAAGAATTTGCAAGG - Intergenic
935930920 2:108124537-108124559 GTTTCTATTCAGAAAAATCAAGG - Intergenic
935940109 2:108229157-108229179 GGTTCTAAGCAGAAGCTGCAAGG + Intergenic
936000702 2:108826760-108826782 GTTTCTTTGCAGAAATTGAAAGG - Intronic
936121206 2:109746881-109746903 GTTGGCATGCAGAAATCGCATGG - Intergenic
936223490 2:110624590-110624612 GTTGGCATGCAGAAATCGCATGG + Intergenic
938514998 2:131995062-131995084 GTTTCTATGCAGAAATTGCATGG - Intergenic
938712252 2:133985265-133985287 GTTACAATGGAGAAATTACAGGG + Intergenic
939413476 2:141862239-141862261 GTTTCTGTGGAGAAATTAGAGGG - Intronic
939974192 2:148697321-148697343 TTTTCAATGGATAAATTGCAGGG + Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941416646 2:165229603-165229625 GTTTCTATCCACAAATTCCAAGG - Intergenic
941701782 2:168611287-168611309 GTTTCTATGCTGATAATGCTGGG - Intronic
942158553 2:173157676-173157698 CTCTCTATGCAAAAATTACATGG - Intronic
944003163 2:194867061-194867083 TTTTCTTTGTAAAAATTGCATGG + Intergenic
944270347 2:197777230-197777252 GTTTCTATGCTGCACTAGCATGG + Intronic
944531408 2:200671216-200671238 GTTACTATCAAGAAATTGAAAGG + Exonic
946222629 2:218241460-218241482 GTTTTTATGCAGAATTGACAGGG + Intronic
946783200 2:223214440-223214462 GTTTCTATTTAGGAATTGCTGGG - Intergenic
947379380 2:229530503-229530525 TTTTCTGCCCAGAAATTGCATGG + Intronic
947635293 2:231677620-231677642 TTTTTTTTGCAGAAATTGCGGGG + Intergenic
1173854819 20:46243369-46243391 GATTCTCAGCAGAAATTGCGGGG + Intronic
1176778784 21:13167851-13167873 GTTTCTATGCAGAAATTGCATGG + Intergenic
1177128367 21:17225346-17225368 GTTTTTATGCATCAATTGAAAGG - Intergenic
1177554339 21:22670565-22670587 GATTCTCTTCAGAAATTGAATGG + Intergenic
1177976423 21:27856978-27857000 GTTTCTATGCAGAAATTGCATGG + Intergenic
1178851017 21:36212405-36212427 GTTGCTATGGAGAAGTTCCATGG + Intronic
1179140896 21:38724027-38724049 GTTTGTAAGCAGAATTTGGAGGG + Intergenic
951342039 3:21500281-21500303 GTTTCTATGAAGATCTTGCTAGG - Intronic
952886381 3:38014193-38014215 GCTTCTTTGCAGAAATTGACAGG + Intronic
953206535 3:40834956-40834978 ATTTTTGTGTAGAAATTGCAAGG - Intergenic
953488258 3:43323869-43323891 ATTTCTAGGCAAAACTTGCAAGG + Intronic
953762928 3:45706614-45706636 CTTTCTATTCATAAATTGTAAGG + Intronic
954850893 3:53599378-53599400 GCTTCAATGCAGCAATTTCAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
958274092 3:91551087-91551109 GTCTCTTTGTAGAATTTGCAAGG - Intergenic
958274438 3:91556905-91556927 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958274615 3:91559793-91559815 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958274784 3:91562350-91562372 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958275139 3:91568139-91568161 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958275297 3:91570690-91570712 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958275826 3:91579360-91579382 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958276006 3:91582252-91582274 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958276178 3:91585145-91585167 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958276356 3:91588037-91588059 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958276663 3:91592971-91592993 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958276855 3:91596201-91596223 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958277030 3:91599092-91599114 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958277385 3:91604877-91604899 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958277734 3:91610659-91610681 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958278070 3:91616103-91616125 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958278419 3:91621886-91621908 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958278591 3:91624779-91624801 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958278765 3:91627671-91627693 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958278943 3:91630559-91630581 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958279118 3:91633450-91633472 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958279291 3:91636341-91636363 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958279549 3:91640590-91640612 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958279726 3:91643483-91643505 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958279905 3:91646375-91646397 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958280082 3:91649264-91649286 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958280257 3:91652162-91652184 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958280436 3:91655055-91655077 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958280612 3:91657948-91657970 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958280766 3:91660505-91660527 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958280938 3:91663399-91663421 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958281117 3:91666290-91666312 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958281291 3:91669181-91669203 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958281463 3:91672074-91672096 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958281641 3:91674966-91674988 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958281816 3:91677858-91677880 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958281997 3:91680745-91680767 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958282175 3:91683637-91683659 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958282348 3:91686528-91686550 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958282525 3:91689420-91689442 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958282699 3:91692311-91692333 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958282872 3:91695202-91695224 GTCTCTTTGTAGAAATTGCAAGG + Intergenic
958282965 3:91696739-91696761 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958283138 3:91699630-91699652 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958283290 3:91702182-91702204 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958283424 3:91704397-91704419 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958283601 3:91707289-91707311 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958283950 3:91713075-91713097 GTCTCTTTGTAGAAATTGCAAGG + Intergenic
958284133 3:91715965-91715987 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958284317 3:91718855-91718877 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958284508 3:91721749-91721771 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958284682 3:91724641-91724663 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958284858 3:91727532-91727554 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958285034 3:91730425-91730447 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958285208 3:91733317-91733339 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958285382 3:91736210-91736232 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958285556 3:91739104-91739126 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958285743 3:91741994-91742016 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958285904 3:91744546-91744568 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958286077 3:91747438-91747460 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958286254 3:91750328-91750350 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958286425 3:91753220-91753242 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958286601 3:91756111-91756133 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958286776 3:91759006-91759028 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958286945 3:91761896-91761918 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958287131 3:91764786-91764808 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958287312 3:91767677-91767699 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958287489 3:91770572-91770594 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958287665 3:91773463-91773485 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958287840 3:91776355-91776377 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958288020 3:91779248-91779270 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958288191 3:91782141-91782163 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958288364 3:91785032-91785054 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958288538 3:91787923-91787945 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958288889 3:91793705-91793727 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958289065 3:91796596-91796618 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958289259 3:91799827-91799849 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958289437 3:91802718-91802740 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958289610 3:91805605-91805627 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958289788 3:91808497-91808519 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958289965 3:91811389-91811411 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958290140 3:91814280-91814302 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958290317 3:91817173-91817195 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958290491 3:91820064-91820086 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958290666 3:91822955-91822977 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958290838 3:91825848-91825870 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958290999 3:91828401-91828423 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958291173 3:91831293-91831315 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958291351 3:91834184-91834206 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958291507 3:91836737-91836759 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958291684 3:91839630-91839652 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958291868 3:91842522-91842544 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958292045 3:91845416-91845438 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958292204 3:91847967-91847989 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958292397 3:91851200-91851222 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958292573 3:91854092-91854114 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958292927 3:91859880-91859902 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958293102 3:91862770-91862792 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958293279 3:91865659-91865681 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958293527 3:91869744-91869766 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958293722 3:91872633-91872655 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958294148 3:91879424-91879446 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958294304 3:91881977-91881999 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958294479 3:91884870-91884892 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958294658 3:91887761-91887783 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958294834 3:91890652-91890674 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958295083 3:91893965-91893987 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958295254 3:91896859-91896881 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958295425 3:91899750-91899772 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958295556 3:91901960-91901982 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958295732 3:91904851-91904873 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958295913 3:91907744-91907766 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958296134 3:91911497-91911519 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958296308 3:91914389-91914411 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958296483 3:91917282-91917304 GTCTCTTTGTAGAAATTGCAAGG + Intergenic
958296658 3:91920173-91920195 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958296768 3:91922048-91922070 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958296943 3:91924939-91924961 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958297118 3:91927832-91927854 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958297290 3:91930723-91930745 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958297478 3:91933614-91933636 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958297655 3:91936508-91936530 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958297839 3:91939395-91939417 GTCTCTTTGTAGAAATTGCAAGG + Intergenic
958298013 3:91942287-91942309 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958298189 3:91945179-91945201 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958298531 3:91950965-91950987 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958298702 3:91953855-91953877 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958298881 3:91956747-91956769 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958299068 3:91959636-91959658 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958299257 3:91962529-91962551 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958299435 3:91965421-91965443 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958299608 3:91968314-91968336 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958299784 3:91971204-91971226 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958299960 3:91974095-91974117 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958300135 3:91976988-91977010 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958300308 3:91979882-91979904 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958300484 3:91982773-91982795 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958300653 3:91985664-91985686 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958300842 3:91988555-91988577 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958301035 3:91991785-91991807 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958301214 3:91994676-91994698 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958301388 3:91997568-91997590 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958301556 3:92000461-92000483 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958301736 3:92003351-92003373 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958301920 3:92006245-92006267 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958302051 3:92008457-92008479 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958302225 3:92011348-92011370 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958302400 3:92014239-92014261 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958302751 3:92020025-92020047 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958302926 3:92022919-92022941 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958303271 3:92028702-92028724 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958303449 3:92031598-92031620 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958303621 3:92034489-92034511 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958303736 3:92036365-92036387 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958303911 3:92039256-92039278 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958304083 3:92042147-92042169 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958304259 3:92045037-92045059 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958304419 3:92047590-92047612 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958304595 3:92050482-92050504 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958304770 3:92053374-92053396 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958304942 3:92056264-92056286 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958305119 3:92059157-92059179 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958305302 3:92062047-92062069 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958305461 3:92064605-92064627 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958305636 3:92067497-92067519 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958305818 3:92070390-92070412 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958305997 3:92073283-92073305 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958306169 3:92076174-92076196 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958306302 3:92078391-92078413 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958306475 3:92081288-92081310 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958306650 3:92084181-92084203 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958306827 3:92087072-92087094 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958307008 3:92089962-92089984 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958307184 3:92092853-92092875 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958307297 3:92094727-92094749 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958307470 3:92097618-92097640 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958307646 3:92100510-92100532 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958307802 3:92103064-92103086 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958307981 3:92105955-92105977 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958308151 3:92108842-92108864 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958308325 3:92111733-92111755 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958308500 3:92114626-92114648 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958308949 3:92122109-92122131 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958309127 3:92125000-92125022 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958309302 3:92127894-92127916 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958309476 3:92130785-92130807 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958309634 3:92133338-92133360 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958309809 3:92136231-92136253 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958309980 3:92139122-92139144 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958310155 3:92142012-92142034 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958310348 3:92145246-92145268 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958310523 3:92148138-92148160 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958310699 3:92151031-92151053 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958310875 3:92153929-92153951 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958311061 3:92156817-92156839 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958311415 3:92162599-92162621 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958311587 3:92165490-92165512 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958311763 3:92168384-92168406 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958312305 3:92177064-92177086 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958312480 3:92179955-92179977 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958312654 3:92182845-92182867 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958312936 3:92187434-92187456 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958313115 3:92190327-92190349 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958313275 3:92192881-92192903 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958313467 3:92196112-92196134 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958313651 3:92199005-92199027 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958313848 3:92202237-92202259 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958314023 3:92205132-92205154 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958314207 3:92208022-92208044 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958314384 3:92210915-92210937 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958314544 3:92213468-92213490 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958314719 3:92216362-92216384 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958314896 3:92219252-92219274 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958315070 3:92222144-92222166 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958315244 3:92225038-92225060 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958315404 3:92227593-92227615 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958315581 3:92230486-92230508 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958315780 3:92233377-92233399 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958315959 3:92236272-92236294 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958316132 3:92239166-92239188 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958316306 3:92242058-92242080 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958316482 3:92244949-92244971 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958316659 3:92247844-92247866 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958316833 3:92250739-92250761 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958317009 3:92253630-92253652 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958317277 3:92257884-92257906 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958317454 3:92260775-92260797 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958317627 3:92263667-92263689 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958317802 3:92266559-92266581 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958317980 3:92269451-92269473 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958318157 3:92272343-92272365 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958318333 3:92275237-92275259 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958318503 3:92278128-92278150 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958318616 3:92280001-92280023 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958318777 3:92282555-92282577 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958318949 3:92285448-92285470 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958319143 3:92288681-92288703 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958319321 3:92291574-92291596 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958319496 3:92294468-92294490 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958319668 3:92297359-92297381 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958319843 3:92300250-92300272 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958319934 3:92301779-92301801 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958320110 3:92304671-92304693 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958320269 3:92307224-92307246 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958320446 3:92310121-92310143 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958320619 3:92313012-92313034 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958320792 3:92315905-92315927 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958320967 3:92318797-92318819 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958321145 3:92321690-92321712 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958321325 3:92324585-92324607 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958321449 3:92326800-92326822 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958321560 3:92328676-92328698 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958321720 3:92331231-92331253 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958322070 3:92337013-92337035 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958322244 3:92339907-92339929 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958322420 3:92342800-92342822 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958322595 3:92345692-92345714 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958322769 3:92348589-92348611 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958323122 3:92354371-92354393 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958323296 3:92357262-92357284 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958323470 3:92360154-92360176 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958323647 3:92363047-92363069 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958323805 3:92365601-92365623 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958323917 3:92367476-92367498 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958324033 3:92369353-92369375 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958324207 3:92372245-92372267 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958324381 3:92375136-92375158 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958324562 3:92378030-92378052 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958324745 3:92380920-92380942 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958324921 3:92383811-92383833 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958325094 3:92386702-92386724 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958325267 3:92389594-92389616 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958325605 3:92395040-92395062 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958325781 3:92397933-92397955 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958325960 3:92400825-92400847 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958326135 3:92403719-92403741 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958326309 3:92406613-92406635 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958326486 3:92409505-92409527 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958326662 3:92412397-92412419 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958326832 3:92415287-92415309 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958327004 3:92418180-92418202 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958327368 3:92423966-92423988 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958327543 3:92426857-92426879 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958327720 3:92429748-92429770 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958327897 3:92432639-92432661 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958328071 3:92435536-92435558 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958328244 3:92438427-92438449 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958328419 3:92441319-92441341 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958328597 3:92444210-92444232 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958328768 3:92447101-92447123 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958328947 3:92449994-92450016 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958329121 3:92452885-92452907 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958329300 3:92455776-92455798 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958329474 3:92458666-92458688 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958329635 3:92461220-92461242 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958329810 3:92464115-92464137 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958329987 3:92467005-92467027 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958330158 3:92469896-92469918 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958330334 3:92472787-92472809 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958330494 3:92475340-92475362 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958330666 3:92478232-92478254 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958330845 3:92481126-92481148 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958331022 3:92484018-92484040 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958331200 3:92486910-92486932 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958331386 3:92489799-92489821 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958331573 3:92492689-92492711 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958331755 3:92495579-92495601 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958331930 3:92498471-92498493 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958332103 3:92501361-92501383 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958332280 3:92504253-92504275 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958332458 3:92507146-92507168 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958332635 3:92510038-92510060 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958332805 3:92512929-92512951 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958333337 3:92521607-92521629 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958333514 3:92524499-92524521 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958333691 3:92527386-92527408 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958333869 3:92530280-92530302 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958334046 3:92533170-92533192 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958334221 3:92536064-92536086 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958334331 3:92537942-92537964 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958334508 3:92540833-92540855 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958334685 3:92543725-92543747 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958334859 3:92546619-92546641 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958335033 3:92549512-92549534 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958335205 3:92552403-92552425 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958335381 3:92555296-92555318 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958335557 3:92558191-92558213 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958335730 3:92561081-92561103 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958335844 3:92562956-92562978 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958335959 3:92564830-92564852 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958336135 3:92567722-92567744 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958336309 3:92570614-92570636 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958336485 3:92573505-92573527 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958336660 3:92576397-92576419 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958336834 3:92579288-92579310 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958337008 3:92582180-92582202 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958337179 3:92585072-92585094 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958337365 3:92587962-92587984 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958337542 3:92590856-92590878 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958337717 3:92593750-92593772 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958337889 3:92596643-92596665 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958338061 3:92599536-92599558 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958338236 3:92602427-92602449 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958338389 3:92604983-92605005 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958338564 3:92607878-92607900 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958338743 3:92610773-92610795 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958338924 3:92613663-92613685 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958339100 3:92616554-92616576 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958339251 3:92619109-92619131 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958339426 3:92622002-92622024 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958339598 3:92624895-92624917 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958339775 3:92627789-92627811 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958339953 3:92630681-92630703 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958340138 3:92633574-92633596 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958340313 3:92636465-92636487 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958340490 3:92639356-92639378 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958340663 3:92642248-92642270 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958340841 3:92645140-92645162 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958340959 3:92647013-92647035 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958341132 3:92649902-92649924 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958341292 3:92652455-92652477 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958341449 3:92655008-92655030 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958341624 3:92657902-92657924 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958341798 3:92660793-92660815 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958341957 3:92663346-92663368 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958342137 3:92666241-92666263 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958342320 3:92669133-92669155 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958342499 3:92672025-92672047 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958342679 3:92674916-92674938 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958342853 3:92677809-92677831 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958343031 3:92680701-92680723 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958343382 3:92686483-92686505 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958343557 3:92689376-92689398 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958343729 3:92692270-92692292 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958343906 3:92695162-92695184 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958344086 3:92698054-92698076 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958344260 3:92700947-92700969 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958344419 3:92703504-92703526 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958344599 3:92706395-92706417 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958344771 3:92709286-92709308 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958344930 3:92711840-92711862 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958345109 3:92714732-92714754 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958345450 3:92720176-92720198 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958345624 3:92723067-92723089 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958345795 3:92725957-92725979 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958345978 3:92728849-92728871 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958346168 3:92731741-92731763 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958346343 3:92734631-92734653 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958346612 3:92738880-92738902 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958346788 3:92741775-92741797 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958346962 3:92744666-92744688 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958347137 3:92747558-92747580 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958347313 3:92750451-92750473 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958347486 3:92753345-92753367 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958347660 3:92756236-92756258 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958347819 3:92758789-92758811 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958347998 3:92761683-92761705 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958348172 3:92764573-92764595 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958348297 3:92766788-92766810 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958348474 3:92769679-92769701 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958348653 3:92772572-92772594 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958348826 3:92775465-92775487 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958349241 3:92782261-92782283 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958349415 3:92785152-92785174 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958349766 3:92790932-92790954 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958349945 3:92793823-92793845 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958350127 3:92796722-92796744 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958350303 3:92799615-92799637 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958350416 3:92801491-92801513 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958350576 3:92804044-92804066 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958350751 3:92806933-92806955 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958350990 3:92810839-92810861 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958351174 3:92813731-92813753 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958351345 3:92816621-92816643 GTCTCTTTGTAGAAATTGCAAGG + Intergenic
958351517 3:92819516-92819538 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958351696 3:92822408-92822430 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958352176 3:92830403-92830425 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958352356 3:92833294-92833316 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958352533 3:92836185-92836207 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958352711 3:92839079-92839101 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958352883 3:92841968-92841990 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958353054 3:92844861-92844883 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958353229 3:92847752-92847774 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958353408 3:92850646-92850668 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958353584 3:92853539-92853561 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958353763 3:92856429-92856451 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958353935 3:92859320-92859342 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958354110 3:92862212-92862234 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958354284 3:92865104-92865126 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958354453 3:92867996-92868018 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958354629 3:92870887-92870909 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958354800 3:92873778-92873800 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958354978 3:92876671-92876693 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958355155 3:92879562-92879584 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958355330 3:92882454-92882476 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958355502 3:92885345-92885367 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958355680 3:92888239-92888261 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958355979 3:92893339-92893361 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958356151 3:92896227-92896249 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958356326 3:92899117-92899139 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958356505 3:92902009-92902031 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958356677 3:92904901-92904923 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958356858 3:92907791-92907813 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958357035 3:92910686-92910708 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958357208 3:92913579-92913601 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958357387 3:92916474-92916496 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958357567 3:92919366-92919388 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958357722 3:92921920-92921942 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958357897 3:92924817-92924839 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958358077 3:92927713-92927735 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958358250 3:92930605-92930627 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958358425 3:92933497-92933519 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958358601 3:92936388-92936410 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958358777 3:92939281-92939303 GTCTCTTTGTAGAAATTGCAAGG + Intergenic
958358951 3:92942172-92942194 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958359124 3:92945065-92945087 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958359299 3:92947957-92947979 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958359458 3:92950510-92950532 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958359646 3:92953740-92953762 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958359822 3:92956631-92956653 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958359997 3:92959522-92959544 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958360172 3:92962414-92962436 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958360350 3:92965307-92965329 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958360532 3:92968197-92968219 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958360782 3:92972100-92972122 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958360958 3:92974993-92975015 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958361051 3:92976522-92976544 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958361226 3:92979413-92979435 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958361397 3:92982300-92982322 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958361615 3:92985870-92985892 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958361789 3:92988760-92988782 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958361965 3:92991652-92991674 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958362320 3:92997437-92997459 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958362498 3:93000330-93000352 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958362677 3:93003223-93003245 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958362852 3:93006115-93006137 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958363009 3:93008668-93008690 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958363193 3:93011558-93011580 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958363370 3:93014450-93014472 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958363544 3:93017342-93017364 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958363719 3:93020233-93020255 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958363876 3:93022785-93022807 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958364051 3:93025672-93025694 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958364239 3:93028563-93028585 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958364415 3:93031455-93031477 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958364589 3:93034347-93034369 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958364770 3:93037236-93037258 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958364948 3:93040131-93040153 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958365131 3:93043023-93043045 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958365320 3:93045914-93045936 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958365496 3:93048811-93048833 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958365855 3:93054594-93054616 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958366030 3:93057487-93057509 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958366377 3:93063268-93063290 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958366536 3:93065824-93065846 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958366716 3:93068715-93068737 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958366892 3:93071607-93071629 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958367247 3:93077391-93077413 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958367424 3:93080285-93080307 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958367608 3:93083178-93083200 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958367779 3:93086070-93086092 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958368133 3:93091851-93091873 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958368245 3:93093728-93093750 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958368418 3:93096619-93096641 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958368592 3:93099511-93099533 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958368764 3:93102400-93102422 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958369124 3:93108183-93108205 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958369298 3:93111075-93111097 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958369456 3:93113628-93113650 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958369633 3:93116515-93116537 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958369758 3:93118733-93118755 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958369935 3:93121624-93121646 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958370119 3:93124516-93124538 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958370277 3:93127071-93127093 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958370435 3:93129625-93129647 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958370608 3:93132515-93132537 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958370782 3:93135407-93135429 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958370956 3:93138298-93138320 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958371136 3:93141191-93141213 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958371307 3:93144079-93144101 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958371478 3:93146969-93146991 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958371656 3:93149863-93149885 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958371832 3:93152758-93152780 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958372007 3:93155649-93155671 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958372185 3:93158541-93158563 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958372371 3:93161431-93161453 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958372550 3:93164323-93164345 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958372729 3:93167214-93167236 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958372903 3:93170106-93170128 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958373078 3:93172994-93173016 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958373251 3:93175885-93175907 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958373427 3:93178777-93178799 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958373780 3:93184561-93184583 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958373954 3:93187452-93187474 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958374126 3:93190346-93190368 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958374288 3:93192899-93192921 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958374466 3:93195792-93195814 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958374642 3:93198684-93198706 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958374816 3:93201573-93201595 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958374993 3:93204465-93204487 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958375167 3:93207358-93207380 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958375298 3:93209573-93209595 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958375474 3:93212467-93212489 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958375643 3:93215359-93215381 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958375816 3:93218250-93218272 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958375990 3:93221140-93221162 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958376166 3:93224032-93224054 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958376349 3:93226924-93226946 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958376531 3:93229815-93229837 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958376718 3:93232706-93232728 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958376882 3:93235261-93235283 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958377058 3:93238156-93238178 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958377231 3:93241046-93241068 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958377411 3:93243943-93243965 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958377568 3:93246500-93246522 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958377753 3:93249390-93249412 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958377928 3:93252282-93252304 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958378101 3:93255172-93255194 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958378266 3:93257725-93257747 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958378446 3:93260616-93260638 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958378623 3:93263505-93263527 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958378799 3:93266398-93266420 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958378984 3:93269289-93269311 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958379161 3:93272181-93272203 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958379335 3:93275071-93275093 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958379514 3:93277965-93277987 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958379844 3:93283415-93283437 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958380020 3:93286308-93286330 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958380195 3:93289200-93289222 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958380379 3:93292094-93292116 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958380555 3:93294987-93295009 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958380665 3:93296862-93296884 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958380836 3:93299733-93299755 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958380994 3:93302286-93302308 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958381176 3:93305178-93305200 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958381353 3:93308072-93308094 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958381528 3:93310964-93310986 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958381708 3:93313857-93313879 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958381891 3:93316749-93316771 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958382065 3:93319644-93319666 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958382178 3:93321517-93321539 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958382377 3:93324748-93324770 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958382555 3:93327637-93327659 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958382729 3:93330530-93330552 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958382898 3:93333418-93333440 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958383330 3:93340394-93340416 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958383621 3:93345165-93345187 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958383795 3:93348056-93348078 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958383971 3:93350947-93350969 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958384147 3:93353839-93353861 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958384322 3:93356728-93356750 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958384499 3:93359620-93359642 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958384674 3:93362511-93362533 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958384858 3:93365403-93365425 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958385032 3:93368290-93368312 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958385207 3:93371182-93371204 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958385384 3:93374073-93374095 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958385561 3:93376965-93376987 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958385736 3:93379854-93379876 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958385913 3:93382747-93382769 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958386084 3:93385638-93385660 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958386257 3:93388525-93388547 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958386437 3:93391418-93391440 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958386771 3:93396861-93396883 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958386944 3:93399750-93399772 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958387101 3:93402304-93402326 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958387277 3:93405195-93405217 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958387628 3:93410981-93411003 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958387808 3:93413871-93413893 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958388349 3:93422545-93422567 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958388633 3:93427140-93427162 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958388804 3:93430032-93430054 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958388961 3:93432586-93432608 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958389146 3:93435479-93435501 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958389319 3:93438372-93438394 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958389476 3:93440924-93440946 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958389649 3:93443815-93443837 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958389825 3:93446708-93446730 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958390002 3:93449600-93449622 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958390180 3:93452489-93452511 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958390351 3:93455374-93455396 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958390527 3:93458266-93458288 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958390705 3:93461158-93461180 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958391060 3:93466940-93466962 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958391238 3:93469832-93469854 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958391431 3:93473149-93473171 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958391609 3:93476040-93476062 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958391966 3:93481822-93481844 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958392146 3:93484715-93484737 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958392324 3:93487606-93487628 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958392504 3:93490496-93490518 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958392854 3:93496278-93496300 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958393025 3:93499170-93499192 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958393208 3:93502062-93502084 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958393384 3:93504947-93504969 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958393556 3:93507836-93507858 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958393731 3:93510727-93510749 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958393903 3:93513618-93513640 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958394261 3:93519400-93519422 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958394442 3:93522294-93522316 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958394614 3:93525185-93525207 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958394977 3:93530967-93530989 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958395151 3:93533858-93533880 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958395327 3:93536750-93536772 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958395499 3:93539646-93539668 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958395679 3:93542541-93542563 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958395857 3:93545432-93545454 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958396036 3:93548325-93548347 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958396213 3:93551219-93551241 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958396391 3:93554111-93554133 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958396567 3:93557003-93557025 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958396750 3:93559893-93559915 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958396923 3:93562784-93562806 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958397096 3:93565673-93565695 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958397272 3:93568563-93568585 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958397442 3:93571456-93571478 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958397612 3:93574349-93574371 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958397969 3:93580134-93580156 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958398147 3:93583026-93583048 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958398316 3:93585914-93585936 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958398492 3:93588806-93588828 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958398671 3:93591698-93591720 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958398845 3:93594591-93594613 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958399020 3:93597482-93597504 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958399192 3:93600375-93600397 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958399370 3:93603266-93603288 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958399558 3:93606152-93606174 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958399735 3:93609044-93609066 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958399910 3:93611937-93611959 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958400088 3:93614832-93614854 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958400263 3:93617717-93617739 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958400433 3:93620609-93620631 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958400610 3:93623503-93623525 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958400787 3:93626394-93626416 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958400959 3:93629286-93629308 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958401134 3:93632178-93632200 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958401314 3:93635069-93635091 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958401493 3:93637961-93637983 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958401669 3:93640853-93640875 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958401842 3:93643747-93643769 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958402018 3:93646638-93646660 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958402199 3:93649530-93649552 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958402387 3:93652424-93652446 GTCTCTTTGTAGAATTTGCAAGG + Intergenic
958402567 3:93655317-93655339 GTCTCTTTGTAGAATTTGCAGGG + Intergenic
958402750 3:93708096-93708118 GTCTCTTTGTAGAATTTGCAAGG - Intergenic
958402928 3:93710981-93711003 GTCTCTTTGTAGAATTTGCAAGG - Intergenic
958943751 3:100341344-100341366 GTTCCTTTGCAGAAATTGACAGG - Intronic
964044710 3:152309058-152309080 GTTTCTCGACAGCAATTGCAGGG + Intronic
964376879 3:156056622-156056644 GTTTCTAGGCAGTACTGGCATGG + Intronic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
966026551 3:175290560-175290582 GTTTCAAGGCATAAATTTCAAGG - Intronic
969343069 4:6554376-6554398 GTTTCTATGGAGGAATTAGAGGG - Intronic
970732979 4:19130166-19130188 GCTTCTTTGCAGAAATTGACAGG + Intergenic
971724560 4:30293809-30293831 GTTTTTATTTAGAAAATGCAAGG - Intergenic
973696367 4:53494701-53494723 GGTTAGATGCAGAAATTGGAGGG - Intronic
973922410 4:55701431-55701453 ATATATATGCAGAAATGGCATGG - Intergenic
975440893 4:74409247-74409269 GTTTATATGCAGACATGGCTGGG + Intergenic
975723936 4:77274132-77274154 ATTTCTGTGCAGAAGTTCCAGGG - Intronic
976054297 4:81045609-81045631 GTTTCTTTCCAAAAATTTCATGG + Intronic
976216128 4:82717189-82717211 ATTACTAGGCAGACATTGCAAGG + Intronic
976326868 4:83781713-83781735 ATTCCAATGCAGAAGTTGCAAGG + Intergenic
981030854 4:140124256-140124278 CTTTCTATGCACAGATTTCAAGG - Intronic
982120517 4:152138795-152138817 ATTTCTATGGACAACTTGCAGGG - Intergenic
983599570 4:169510937-169510959 GTTTCTATAAAGAAATGGTATGG - Intronic
987636593 5:20550741-20550763 GTTGCTATGAAGAAATTCCTAGG + Intronic
990812025 5:59737390-59737412 ATTTCTAGGCAAAAATTTCAGGG - Intronic
991189410 5:63852128-63852150 GTTTACATGTAGAAATTTCAAGG - Intergenic
995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG + Intergenic
995649413 5:114352055-114352077 CTTTCTATGAAGAAATGGCCAGG - Intergenic
995949307 5:117690411-117690433 ATTTCTAAACAGAAATTTCAGGG + Intergenic
996276389 5:121671784-121671806 GTTTGTTTGCAAAGATTGCAAGG - Intergenic
997111263 5:131077193-131077215 GTTTCTATCCAGATGTTTCAAGG + Intergenic
998189209 5:140008174-140008196 GAGTCTATGCAGAAGATGCATGG + Intronic
1001017548 5:168154982-168155004 GTTTCTAGGCACAAATGGCGTGG - Intronic
1002107134 5:176885320-176885342 TTTGCTGTGCAGAATTTGCAGGG - Intronic
1003770724 6:9296646-9296668 ATTTTGTTGCAGAAATTGCAAGG - Intergenic
1005055849 6:21728164-21728186 CTTTCTTTTCTGAAATTGCAGGG + Intergenic
1007117024 6:39350047-39350069 GTTTCTCAGCTGAAATGGCAAGG + Intronic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1011370057 6:86627326-86627348 GTTTCTTTGCAGGAAATACAGGG + Intergenic
1015297610 6:131615864-131615886 GATTCTATGCAGAATTTACTAGG + Intronic
1017743131 6:157424789-157424811 ATTTCTATGGAGAAATTCCCAGG - Intronic
1019909527 7:4091086-4091108 GTTTATATGCAAAAATTTTAAGG - Intronic
1021074571 7:16286427-16286449 GTTTCTCTGTAGAACTTACACGG + Intronic
1021125439 7:16846807-16846829 GTTTCCCTGCAGAACTTGAAAGG - Intergenic
1021689484 7:23218141-23218163 CTTCCTATGCAAAAACTGCAGGG - Intergenic
1022045925 7:26622386-26622408 GTTTCCAGGCAGACATTTCATGG + Intergenic
1022649013 7:32258034-32258056 GTTTCTCTGCAGAGTTTCCAGGG + Intronic
1023573826 7:41603271-41603293 CCTTCTCTCCAGAAATTGCATGG + Intergenic
1028185916 7:87785201-87785223 CTTTCTGTGCTGAAATTGCGGGG + Intronic
1028711238 7:93911255-93911277 TTTTCTACCCAGAAATTGTATGG + Exonic
1031345113 7:120655529-120655551 GTTTATATGCAGTAGTTGAAGGG + Intronic
1034288388 7:149906985-149907007 GCTTCTGTGCAGAATTTGCTTGG - Intergenic
1034662744 7:152785995-152786017 GCTTCTGTGCAGAATTTGCTTGG + Intronic
1038069775 8:24001319-24001341 CTTTCAAAGCAGCAATTGCAGGG - Intergenic
1038195901 8:25367347-25367369 CTTTCTCTGCTGAAATGGCAGGG - Intronic
1038406157 8:27324531-27324553 GTTTCTTTTCAGAAATGGGAAGG + Intronic
1038856072 8:31334740-31334762 GTCTCTGTGTAGAAATGGCAGGG + Intergenic
1038863324 8:31411430-31411452 GTTTCTAGGGAAAAATTTCAAGG - Intergenic
1038905365 8:31896282-31896304 CTTTCTGTGCAGAAATTTCAAGG + Intronic
1038935632 8:32247413-32247435 GTTACTATTTACAAATTGCACGG - Intronic
1039141559 8:34394925-34394947 TTTTCTTTGCACAATTTGCAAGG + Intergenic
1041921024 8:63181084-63181106 ATTTATATGCACAAATTACATGG - Intronic
1042767517 8:72341514-72341536 ATTTATATGAAAAAATTGCAAGG + Intergenic
1043399069 8:79866080-79866102 TTTTCCAAGCAGAAATTACAAGG + Intergenic
1043774701 8:84251293-84251315 GTATCTTTGCAGAAATAGAATGG - Intronic
1045000048 8:97870600-97870622 TTGTCTTTGCAGAAATAGCAAGG + Intronic
1046212676 8:111098973-111098995 TATTCTATCAAGAAATTGCATGG - Intergenic
1046954164 8:120046210-120046232 GTTTACATGGATAAATTGCATGG - Intronic
1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG + Intergenic
1051040410 9:12802617-12802639 GTTGCTATAAAGAAATTCCAGGG - Intronic
1051403181 9:16705486-16705508 GTGGCTCTGCAGAAATTCCAGGG - Intronic
1052106926 9:24530221-24530243 GTTTCCTTGAAGAAAATGCAAGG - Intergenic
1054822163 9:69533624-69533646 GTCTCTGTTCACAAATTGCAGGG + Intronic
1055866797 9:80824140-80824162 GTTTCTTTATAGAAATTGAAAGG + Intergenic
1059088178 9:111327520-111327542 GATGCTATGAAGAAATTGCTGGG - Exonic
1059263975 9:113008785-113008807 GTTACTATGGAGAAATGGCCTGG - Intergenic
1061075096 9:128336376-128336398 GTTTCTAGGCAGAAGTTGGTAGG - Intergenic
1203359507 Un_KI270442v1:202021-202043 GTTTTTTTGTAGAAACTGCAAGG - Intergenic
1186759477 X:12708624-12708646 GTTTCTATGAAGAAAAGGCACGG + Intronic
1186844161 X:13514524-13514546 GTTTATCTGCATAAATTCCAGGG + Intergenic
1186924033 X:14312440-14312462 TTTTAGATTCAGAAATTGCATGG - Intergenic
1187087434 X:16055867-16055889 GAGTCTATTCAGAAATAGCAAGG + Intergenic
1187092621 X:16113115-16113137 ATTCTTATTCAGAAATTGCATGG + Intergenic
1187539765 X:20180891-20180913 GTTTCTATGAATAAACAGCAGGG + Intronic
1188461994 X:30438584-30438606 GTTTTGATGCAGAAAATGGAAGG - Intergenic
1188905496 X:35786577-35786599 GTTTCTTTTCAGACATTGAAAGG + Intergenic
1189048255 X:37616488-37616510 CTTTCTCTGCAGAAATGTCAGGG + Intronic
1189439356 X:41020498-41020520 TTTTCAATGAATAAATTGCAAGG - Intergenic
1194829707 X:98607272-98607294 GTTTCCCAGAAGAAATTGCAGGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1199038539 X:143082188-143082210 GTTTCGATGGAGGAATTGAAAGG - Intergenic
1199482740 X:148315361-148315383 ATTTCTGTGCAGAAATCACATGG + Intergenic
1201483299 Y:14464328-14464350 GTTTCTTTCCAGAAATATCAAGG + Intergenic