ID: 1105237341

View in Genome Browser
Species Human (GRCh38)
Location 13:18569607-18569629
Sequence TTACACACATTGAAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 3, 1: 0, 2: 7, 3: 25, 4: 424}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105237341 Original CRISPR TTACACACATTGAAAAAAAC AGG (reversed) Intergenic
900953088 1:5869848-5869870 TTACAAACATGGAAAAAAACAGG + Intronic
901043942 1:6384173-6384195 TTACACCAATTGGAAAATACAGG + Intronic
901392525 1:8956331-8956353 CTACACAAAAAGAAAAAAACGGG - Intronic
901701868 1:11049048-11049070 TTACACATATTTAAAAACACTGG + Intergenic
904856290 1:33500400-33500422 AAACACACACTGAAAAGAACTGG - Intergenic
905495482 1:38381994-38382016 TTACACACACACAAAAAAACTGG + Intergenic
906113884 1:43342722-43342744 GTAAATACATAGAAAAAAACTGG - Intronic
907835888 1:58107930-58107952 TTAAACACAGGGAAAAAAATGGG + Intronic
908489753 1:64631767-64631789 TTGCCAACATTGAAAAAAAGGGG - Intronic
908594215 1:65668618-65668640 TTATATACATTGAGAAAAAATGG - Intergenic
908871577 1:68619290-68619312 TAACACACATTTTAAAAGACTGG + Intergenic
909905911 1:81194401-81194423 TTAAGCACATTGAAAATTACAGG - Intergenic
910198091 1:84667056-84667078 TTTTACACATTCAAAAAAAAAGG - Intronic
911086917 1:93986357-93986379 TTAAACCCATTGAATAAAATAGG + Intergenic
911406757 1:97450724-97450746 TAACACACATTCTAATAAACTGG + Intronic
912652377 1:111450720-111450742 TAACTCAAATTGAAAAAAAATGG + Intronic
912860939 1:113213364-113213386 AAACATACATTGAAAAGAACAGG - Intergenic
913559784 1:120005877-120005899 GTACACACATGAAAAAAAGCTGG - Intronic
914280371 1:146165299-146165321 GTACACACATGAAAAAAAGCTGG - Intronic
914541415 1:148616239-148616261 GTACACACATGAAAAAAAGCTGG - Intronic
914625225 1:149455007-149455029 GTACACACATGAAAAAAAGCTGG + Intergenic
914700378 1:150127016-150127038 TCACACACTTTGAGGAAAACTGG + Intronic
914821149 1:151104427-151104449 TTACACCCATTCAGAAAAATAGG - Intronic
916493174 1:165320107-165320129 TTACAAACACTTAAGAAAACTGG + Intronic
916824919 1:168434009-168434031 TTACAAATAATTAAAAAAACAGG - Intergenic
917228803 1:172813944-172813966 ATACACACATTCAAAAAAATTGG + Intergenic
918773761 1:188600940-188600962 TTACTTACATTTTAAAAAACTGG + Intergenic
919314758 1:195957191-195957213 CTAAACACAATGAAAAATACAGG + Intergenic
919504434 1:198380660-198380682 TTGCACATATTAAAAAAATCAGG - Intergenic
920959026 1:210647794-210647816 TTACACAGATTAAAGGAAACTGG - Intronic
921707742 1:218343771-218343793 TATCACACATTGAAAAACTCTGG - Intergenic
921743619 1:218713157-218713179 TTACAAACATTGAATATAAATGG + Intergenic
921764217 1:218951728-218951750 TAACCCAAATTGAAAAAAATAGG - Intergenic
921772995 1:219065210-219065232 TGAAAAATATTGAAAAAAACTGG - Intergenic
921881605 1:220261060-220261082 TTACATACTTTAAAAAAAAGGGG + Intronic
922941872 1:229473921-229473943 TCACACACATACAAAAAAAGAGG + Intronic
923220702 1:231890128-231890150 TTGCACACCTTGAAAAATCCAGG - Intronic
923625347 1:235609131-235609153 TTACACTAAGTGAAAAAAGCTGG - Intronic
924170990 1:241340884-241340906 TTACACACAAAGAAAACAAAAGG + Intronic
924887928 1:248239899-248239921 CAACACTCATTCAAAAAAACTGG + Intergenic
1062765354 10:58636-58658 TTACACACTTTTAAATAACCAGG + Intergenic
1064000091 10:11656594-11656616 TTTAACACACTGAATAAAACAGG - Intergenic
1064432237 10:15281090-15281112 CTACACACCTTGAAACAACCAGG - Intronic
1064700446 10:18013669-18013691 ATATACACATTCAAAAGAACAGG - Intronic
1064917976 10:20483731-20483753 TTAAACACAATGAAAACAATAGG + Intergenic
1064972611 10:21081403-21081425 GTAAACACATAGAAAAAACCAGG + Intronic
1065202088 10:23322850-23322872 ATACACACATTAAATAAAAATGG + Intronic
1066223836 10:33362048-33362070 CTACACACATTTAAACAACCAGG - Intergenic
1067214313 10:44288335-44288357 TCAGACACATGGATAAAAACAGG - Intergenic
1067669363 10:48305793-48305815 ATATACACATAGAAAAAACCTGG - Intergenic
1068378774 10:56219872-56219894 CTCAACACATTTAAAAAAACGGG + Intergenic
1068461345 10:57333613-57333635 CTACACACTTTTAAAACAACCGG - Intergenic
1068645470 10:59461744-59461766 TAACAGCCATTGAAAAAAAATGG + Intergenic
1068708654 10:60106593-60106615 TTTCACAAATTGAAAAACACAGG - Intronic
1068814338 10:61292781-61292803 TTAAAAAGATTGAAAAACACTGG - Intergenic
1069091351 10:64203075-64203097 TTATACAAATTAAAAAAACCTGG + Intergenic
1069142080 10:64839534-64839556 ATACACTCATAGAAAAAAATAGG - Intergenic
1070013030 10:72495846-72495868 ATACATACATAGAAAATAACTGG + Intronic
1072330541 10:94345398-94345420 TTACATACAATGCATAAAACTGG + Intronic
1072527457 10:96286058-96286080 TCACACAGAGTGAAAAAAAATGG - Intergenic
1073856737 10:107684496-107684518 TTACAGACCTTGAAAATATCCGG + Intergenic
1073898259 10:108187867-108187889 TTACAAACAGTGAAAAAAACAGG + Intergenic
1074048666 10:109862648-109862670 TAACACACATTAACAAAAAAGGG + Intergenic
1075187074 10:120272289-120272311 TTTCCCACATTGAAAAGACCTGG - Intergenic
1078134673 11:8641817-8641839 TTACACACTTTAAAGAAATCAGG - Intronic
1078979102 11:16511858-16511880 TTCCACACATTAAAAACAAAAGG + Intronic
1079405590 11:20142560-20142582 TTACACATATTTAAGAAAGCAGG - Intergenic
1080886776 11:36375280-36375302 TCACACACAATGAAAGAGACTGG - Intronic
1080992640 11:37557916-37557938 TTTCACAGCTTGAAAAAAAGGGG - Intergenic
1083485896 11:62982827-62982849 TTGCAAACATGAAAAAAAACTGG + Intronic
1084358598 11:68655138-68655160 GTACACACATTCGAAAATACCGG - Intergenic
1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG + Intergenic
1085976478 11:81661301-81661323 TTACACACTTTTAAACAACCAGG + Intergenic
1087890738 11:103535226-103535248 TTATACTGATTGAAAAAAGCTGG + Intergenic
1088300667 11:108355027-108355049 TTTCACACATCCAAAAATACTGG + Exonic
1089194048 11:116681553-116681575 TAACACAGGTTGAAAAAAAATGG + Intergenic
1090289796 11:125532715-125532737 TTTCCAACATTGAAAAAATCAGG + Intergenic
1091117156 11:133024141-133024163 TTACAGACATGCATAAAAACAGG + Intronic
1091145663 11:133277742-133277764 TTACAGACCTTGACAATAACAGG + Intronic
1091363138 11:134994035-134994057 GTACACACAGTGACAAAAAAAGG + Intergenic
1092356421 12:7799277-7799299 TTAAATACATGGAACAAAACAGG + Intergenic
1092495249 12:8986877-8986899 TTACACACTTTTAAACAACCAGG - Intronic
1093415011 12:18909640-18909662 TTACACAGAATGAAGAAAACAGG - Intergenic
1093856713 12:24112905-24112927 TTCCACATATTGAAAAAAAATGG - Intergenic
1094094365 12:26687383-26687405 TTACACATATTTATTAAAACAGG + Intronic
1094105805 12:26810356-26810378 TTTCAAACATTGAATAAAGCAGG - Intronic
1095306741 12:40647391-40647413 TTAAACTCATTGATTAAAACTGG + Intergenic
1095643995 12:44520986-44521008 TCACACAAATAGAAAGAAACTGG + Intronic
1097252331 12:57642755-57642777 TTACATAGAGTGCAAAAAACTGG - Intergenic
1098006400 12:66001078-66001100 TTAGATACCTAGAAAAAAACTGG - Intergenic
1098717203 12:73845468-73845490 GTAGACACATGGGAAAAAACTGG + Intergenic
1099120924 12:78688347-78688369 GCACACACATTTAGAAAAACTGG + Intergenic
1099453161 12:82832369-82832391 TTACACACATAATTAAAAACAGG - Intronic
1100235735 12:92658913-92658935 TTACCCACATAAAAAACAACAGG - Intergenic
1100403734 12:94254398-94254420 TTACAAACATTCAAAAACAATGG + Intronic
1101470225 12:104989249-104989271 TTAAACACATTTAAAAAATCAGG + Intronic
1102660699 12:114525420-114525442 TTAAACAAATGGAAAAAAAGAGG - Intergenic
1103420439 12:120777129-120777151 TTACATGCACTGAAAAAATCTGG + Intronic
1103424929 12:120825114-120825136 TTAAACTCATTTAAAAAAAAAGG + Intronic
1103672614 12:122630474-122630496 TTACAGGCATTAAAAAAATCAGG - Intergenic
1104009842 12:124922309-124922331 TTACATAAAGTGAAATAAACCGG - Intergenic
1104392615 12:128403852-128403874 TTACATACATAGGAAGAAACAGG - Intronic
1104518312 12:129448649-129448671 TTATATACTTTGAAAAAAATTGG - Intronic
1105237341 13:18569607-18569629 TTACACACATTGAAAAAAACAGG - Intergenic
1105694535 13:22874750-22874772 ATACACACCTTAAAAAAAAGTGG + Intergenic
1106226135 13:27788727-27788749 TTACACACCATGAAAAGATCTGG + Intergenic
1106441009 13:29770192-29770214 TTATTCACATTGAAGAACACAGG + Intronic
1107025020 13:35792585-35792607 TTACACACTCTGAAAAAAAGAGG + Intronic
1107703983 13:43080793-43080815 TGACAGACATGGAAAGAAACAGG - Intronic
1108830307 13:54469524-54469546 TTACACACATTTAATATAAATGG - Intergenic
1109142718 13:58735294-58735316 TTAAAAATATTGAAAAAAAGAGG - Intergenic
1109559868 13:64032473-64032495 TTACACACACAGAAAAAAAATGG + Intergenic
1109580743 13:64329868-64329890 CTAGACACATTAAAAAAAAATGG - Intergenic
1110540244 13:76699792-76699814 TTACACGAATAGAAAAAAAGGGG - Intergenic
1110863812 13:80372837-80372859 TTACACACACTTAACAAGACTGG - Intergenic
1111412386 13:87894176-87894198 TCACCCACTTTGAAAAAAAAAGG - Intergenic
1111559127 13:89921183-89921205 TGACAAACATTGAAATAAACTGG + Intergenic
1112248979 13:97761187-97761209 TTTCAAAAATTGAAAAAAAATGG + Intergenic
1112732712 13:102384055-102384077 AAACAAACATTGAAAAACACTGG - Intronic
1113206141 13:107918678-107918700 TTTTACACATTGTAAAAAACTGG - Intergenic
1113267029 13:108631254-108631276 TTAGACACATTGAACACACCTGG + Intronic
1113446526 13:110372547-110372569 TAACACACATTAAAAAAGAAAGG - Intronic
1114390719 14:22305060-22305082 CTCCACACATTGAGATAAACAGG - Intergenic
1114485708 14:23060284-23060306 TTACACACATTGACAGGTACTGG + Intronic
1115528460 14:34304343-34304365 TTAGACACACAGAAAGAAACAGG + Intronic
1115595732 14:34907233-34907255 TTTCACAAGTTGAAATAAACGGG + Intergenic
1116388564 14:44362729-44362751 CTACAAAAATTGAAGAAAACTGG + Intergenic
1116473597 14:45314009-45314031 CTTCACACACTCAAAAAAACAGG - Intergenic
1116501149 14:45623840-45623862 TTTCACTCATTTAAAAAAAAAGG - Intergenic
1116634252 14:47375076-47375098 TTAAAAAAATTAAAAAAAACAGG - Intronic
1116815093 14:49576401-49576423 TGACAAAAATTGAAAAAAAGAGG - Exonic
1117025138 14:51611394-51611416 TTGAACACATTGAAATAACCAGG + Intronic
1117078093 14:52124442-52124464 TTACATATCTAGAAAAAAACTGG + Intergenic
1117539968 14:56737444-56737466 TTATAAACATTGATAAAAATGGG + Intergenic
1117974512 14:61283884-61283906 TTCCACACATTTCTAAAAACAGG - Intronic
1119271703 14:73311412-73311434 TTACAAACATTGTAAAAGAGGGG - Intronic
1120435954 14:84482872-84482894 TTACACAGATTCAAAAGAATTGG - Intergenic
1121083008 14:91123876-91123898 GTTAAAACATTGAAAAAAACAGG - Intronic
1121198221 14:92094624-92094646 TCAGACAGATTGAAATAAACAGG - Intronic
1121404077 14:93708083-93708105 TAACAAACATTAAAAAAAAAAGG - Intergenic
1121709688 14:96028295-96028317 TTAAAAACATTGAAAAGAAATGG + Intergenic
1122064698 14:99164414-99164436 TTACACACATCGAAAATGAGGGG - Intergenic
1122106126 14:99456689-99456711 TTAAACAAATTGACAAAAAATGG + Intronic
1123796311 15:23774580-23774602 TTACAGAAATAGAAAAAAAAGGG - Intergenic
1123909630 15:24954724-24954746 TTTTACACATTTTAAAAAACAGG + Intronic
1124516693 15:30372393-30372415 GTATACACATTGAAATAAACAGG - Intronic
1124726225 15:32158338-32158360 GTATACACATTGAAATAAACAGG + Intronic
1124989486 15:34657449-34657471 GTCCACACACTGAAAAACACTGG + Intergenic
1125068255 15:35518519-35518541 TTTCACACATTGCTAAATACTGG + Intronic
1125180150 15:36873243-36873265 TTACGAACATTAAATAAAACTGG + Intergenic
1125253065 15:37728668-37728690 TAACATAAATTGAGAAAAACTGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126751066 15:51877226-51877248 TTACAAACATGCAAAGAAACAGG - Intronic
1126831047 15:52605773-52605795 TTTCACAAATTGAAATAATCAGG - Intronic
1127718597 15:61676834-61676856 TTTCACACAATAAAAATAACAGG + Intergenic
1128393686 15:67201512-67201534 TTACACAGCATGAAAGAAACAGG - Exonic
1131578955 15:93621483-93621505 TTTCTCTCATTTAAAAAAACTGG - Intergenic
1132251548 15:100339432-100339454 TTAAACACTTTGGCAAAAACAGG + Intronic
1132261583 15:100429786-100429808 TTACACATATTGTACAATACGGG - Intronic
1133544683 16:6794375-6794397 CTACACTCTTTGAAAAAAAATGG + Intronic
1133551636 16:6861664-6861686 TTATACACAGTGAAAAATAGAGG - Intronic
1135612795 16:23883148-23883170 GTAAGCAAATTGAAAAAAACAGG + Intronic
1137234371 16:46602309-46602331 TTACACACATAAAATAAAAAAGG + Intronic
1137286905 16:47023934-47023956 ATACACACATTTAGAATAACAGG + Intergenic
1137294617 16:47078864-47078886 TTACATACATTTAAAGAAAAGGG + Exonic
1137385786 16:48041389-48041411 TTCCAAACCTTGAAAAGAACGGG + Intergenic
1140239311 16:73186726-73186748 TTACACAAGTTAAAAAAAATAGG + Intergenic
1140939195 16:79705312-79705334 TTACACACATTCAACAATAGAGG - Intergenic
1140961859 16:79921334-79921356 TTCCACACATACAAAGAAACAGG + Intergenic
1141544170 16:84752720-84752742 TTCCTCGCAGTGAAAAAAACAGG - Intronic
1142650182 17:1344670-1344692 TTACACATACTGAACAAAAGAGG + Exonic
1142735992 17:1900041-1900063 TTTCACTTATTCAAAAAAACTGG + Intronic
1146982580 17:37178836-37178858 TTTCACACATAGACAAAAACAGG + Intronic
1149545562 17:57501024-57501046 TTACACACATGGAAACACATAGG - Intronic
1150240888 17:63631664-63631686 TCTCATACATTGAAAACAACTGG - Intronic
1150786462 17:68167087-68167109 GTACACAAATTGATATAAACTGG + Intergenic
1150844573 17:68642113-68642135 TTACATAAAGTTAAAAAAACAGG - Intergenic
1151100591 17:71551519-71551541 ATACACACAATGAAATAAAGTGG - Intergenic
1151809038 17:76425173-76425195 TTAAAAACATTAAAAGAAACAGG - Intronic
1152160823 17:78667506-78667528 CTACACACACACAAAAAAACGGG - Intergenic
1203172359 17_GL000205v2_random:160302-160324 ATACATACATTGAACAAAATTGG + Intergenic
1152958266 18:58990-59012 TTACACACTTTTAAATAACCAGG + Intronic
1153737544 18:8086995-8087017 TGACACAGATTGAAGAAAATGGG + Intronic
1154197787 18:12279053-12279075 TTTCACACTGCGAAAAAAACAGG + Intergenic
1154985795 18:21549623-21549645 ATACATACATTGAAACCAACCGG - Intronic
1155049936 18:22138092-22138114 TTATACAAATTAAAAAAAAGGGG - Intergenic
1155195194 18:23467745-23467767 ATATACGCATTGAAAAAAACTGG - Intronic
1156764712 18:40638177-40638199 TTATACAGAATGAAAAAAAATGG + Intergenic
1157699055 18:49748280-49748302 TTCCACAAATGGAACAAAACAGG + Intergenic
1159608726 18:70502409-70502431 CTATAGACATAGAAAAAAACTGG - Intergenic
1159658944 18:71069659-71069681 TTACACAGAGGGAAGAAAACTGG + Intergenic
1160068050 18:75595984-75596006 TTCCAAACTTAGAAAAAAACTGG - Intergenic
1160205900 18:76831461-76831483 TTACTCATATTGCTAAAAACTGG - Intronic
1160208076 18:76853409-76853431 GTAAAGACATTGATAAAAACAGG - Intronic
1165085396 19:33342602-33342624 TTACAAACATTAAAAAGAAGAGG - Intergenic
1165913314 19:39243262-39243284 TTACACTCACTGAAAAAATGAGG + Intergenic
1165917805 19:39271480-39271502 TTACACTCACTGAAAAAATGAGG - Intergenic
1166121267 19:40688555-40688577 ATACACACAGAGACAAAAACAGG + Intronic
1166213008 19:41319434-41319456 ATGCACACATTCAAAAACACAGG - Intronic
1166923021 19:46244460-46244482 TTGCACAAATTTAAAAAAAAAGG + Intergenic
925573205 2:5333217-5333239 TTACACAGTTTGCAAAACACTGG - Intergenic
926459658 2:13112926-13112948 TTACACAGTTTTAAAAAAAGGGG + Intergenic
926477284 2:13340002-13340024 ATAGAAACATTGAAATAAACTGG + Intergenic
927121953 2:19973804-19973826 TTCCACATTTTTAAAAAAACAGG + Intronic
927298865 2:21487032-21487054 TTTCACATATTGAAAAATGCAGG - Intergenic
927689813 2:25200576-25200598 TTATATACTTTGAAAAAAATTGG + Intergenic
930155300 2:48100954-48100976 CTACATACATTGAAGAACACAGG - Intergenic
930305378 2:49668780-49668802 TTCCACAGTTTGAACAAAACTGG + Intergenic
930447510 2:51492996-51493018 CTAGACACATTGAAACAAAATGG + Intergenic
930527523 2:52548505-52548527 TCACACAGATTGAAAATAAATGG - Intergenic
931478803 2:62618942-62618964 TTCCAAACATTGGAAAAAAAAGG - Intergenic
931506720 2:62936147-62936169 TTACACAAATTATAGAAAACTGG - Intronic
931551122 2:63447816-63447838 ATACACACATTTAAAAATAATGG - Intronic
931584906 2:63815037-63815059 TTATAGACATTGCAAAAGACTGG + Intronic
932329559 2:70890184-70890206 CTACACACATTTACAAACACAGG + Intergenic
932878134 2:75474425-75474447 GAACACACATTGAAAATAAGGGG - Intronic
933937058 2:87215040-87215062 TTACACAATTGGGAAAAAACAGG - Intergenic
935092321 2:99907289-99907311 TTACACACAGTGAACAGAATTGG - Intronic
935733604 2:106087581-106087603 TTCAACACATTTAAAAGAACTGG - Intergenic
936356083 2:111750784-111750806 TTACACAATTGGGAAAAAACAGG + Intergenic
936434769 2:112494874-112494896 TTACACACAGTAAAAAGAATGGG - Intronic
936686030 2:114827396-114827418 ATAGATCCATTGAAAAAAACTGG + Intronic
937900311 2:127014723-127014745 TTGCACACAATGACATAAACAGG - Intergenic
938512436 2:131964896-131964918 TTACACACATTGAAAAAAACAGG + Intergenic
938745065 2:134269937-134269959 TTAAACACTTTTTAAAAAACTGG + Intronic
938907882 2:135856071-135856093 TCAGTCACCTTGAAAAAAACTGG - Intronic
938935524 2:136124280-136124302 AGACACACATGGACAAAAACTGG + Intergenic
939235395 2:139485672-139485694 TTACCCACATTCAAGAAAAGAGG - Intergenic
939377782 2:141392139-141392161 TTAAACACATTGAACAAAGAGGG - Intronic
939722028 2:145665670-145665692 TTTCACATATTGAAAAAATCTGG - Intergenic
940043471 2:149385222-149385244 TTACACACAGTGAATACATCAGG - Intronic
940388040 2:153096728-153096750 ATACACAGATTGAAAATAAAGGG - Intergenic
940389168 2:153111419-153111441 GTAAATACAGTGAAAAAAACTGG - Intergenic
940513756 2:154652564-154652586 TCACACACTTTGTAAAGAACAGG + Intergenic
940793930 2:158057018-158057040 TCAGACACATTCCAAAAAACGGG - Intronic
941821140 2:169844447-169844469 TTACAGACATTGAGAAAATAAGG - Intronic
943180081 2:184530064-184530086 TTAGGGACTTTGAAAAAAACAGG + Intergenic
943472127 2:188307240-188307262 TTATACACAATGATAAATACAGG + Intronic
945163462 2:206917952-206917974 TTCCACACCTTTAAAAAAAGTGG + Intergenic
946040544 2:216779762-216779784 TTAATCACATTAAAAAAAATGGG - Intergenic
946782143 2:223202980-223203002 TTATTCAGATTGAAAAAGACAGG - Intergenic
946856555 2:223956157-223956179 TTACATACATTGAAACAAGAAGG + Intergenic
947577762 2:231290027-231290049 TTACAAACAGTGAAAAGCACAGG + Intronic
948248819 2:236508494-236508516 ATACACACACTGAAAAGAAGGGG + Intergenic
948326434 2:237125568-237125590 TTAAAGACATTGAAAACAATGGG - Intergenic
1169184046 20:3597573-3597595 TTAAACACATGAAAAAAACCTGG + Intronic
1169385814 20:5148530-5148552 TTAAGCCCATGGAAAAAAACTGG - Intronic
1171313614 20:24166740-24166762 TTACAAACAAACAAAAAAACAGG + Intergenic
1172892794 20:38278739-38278761 CTATACAGATTGAGAAAAACTGG + Intronic
1172911172 20:38410210-38410232 ATACACATAAAGAAAAAAACAGG - Intergenic
1173316761 20:41951463-41951485 TTTCACACATTGATAATAACTGG + Intergenic
1173830500 20:46082779-46082801 TTACATACAAGGAAAAGAACTGG + Intronic
1174899014 20:54478940-54478962 TTTCATCCATTGAAAAAATCTGG - Intronic
1175867406 20:62186901-62186923 TTTCACACACTGAAATAAAGGGG - Intronic
1175979949 20:62733614-62733636 ATACACACATGGAGAAAAAGAGG + Intronic
1176781328 21:13197890-13197912 TTACACACATTGAAAAAAACAGG - Intergenic
1177301818 21:19256518-19256540 TTACTCACATTAAAAAAAAATGG - Intergenic
1177725524 21:24962214-24962236 CTACACACATTTCAAAAACCAGG + Intergenic
1177725607 21:24963143-24963165 CTACACACATTTCAAAAACCAGG - Intergenic
1177979021 21:27887036-27887058 TTATACGCATTGAAAAAAACAGG - Intergenic
1179963101 21:44782204-44782226 ATACACACATAGAGAAAAGCTGG - Intronic
949144584 3:682363-682385 CTACACACAAGGAAAAAAAAAGG + Intergenic
949205720 3:1437227-1437249 TTACACTCAGTGAATAAATCTGG - Intergenic
950951030 3:16998933-16998955 TTATCCACATTGCAAATAACAGG + Intronic
951160601 3:19415859-19415881 TTTTACAAATTGAAAAACACTGG - Intronic
951298019 3:20963110-20963132 TAACACATATTGAAAAACATAGG - Intergenic
951298170 3:20965026-20965048 TAACACAAATTGAAAAACATAGG - Intergenic
951354571 3:21648572-21648594 TTATAAACATTGATAACAACTGG + Intronic
952004246 3:28823912-28823934 TTACAGAAATTCAAAAAGACAGG - Intergenic
952214469 3:31263406-31263428 TTTTACACATTGAGAAAGACAGG - Intergenic
952359215 3:32613096-32613118 ATACACAGAATGAAAAAATCTGG - Intergenic
952478177 3:33732647-33732669 CTACACACTTTTATAAAAACCGG + Intergenic
953052314 3:39356052-39356074 TTACATACATTGAAACATTCTGG - Intergenic
953236187 3:41109705-41109727 TTACACATAATGAAAAATTCTGG + Intergenic
953567672 3:44047039-44047061 AAATACACAGTGAAAAAAACTGG - Intergenic
954255930 3:49406085-49406107 TTCCACACACACAAAAAAACAGG + Intronic
956452455 3:69387750-69387772 TTACAGTCACTGAAAACAACAGG - Intronic
957037553 3:75308933-75308955 TTTCACCCATTTAAAAAAAAAGG - Intergenic
957442397 3:80266505-80266527 GTACATCCATTGATAAAAACTGG + Intergenic
958023112 3:88019923-88019945 ATACACATATTGAATGAAACTGG + Intergenic
958027135 3:88060836-88060858 TTACAAGCATTGAAAGAAAAAGG + Intronic
958597636 3:96249609-96249631 TTAAAAACATTAAAAAAAACTGG - Intergenic
959129440 3:102335460-102335482 TTACACACATACAAATATACAGG - Intronic
959265180 3:104128268-104128290 TTTCACAGATTTAAAAAAAGAGG - Intergenic
959517317 3:107283563-107283585 TAACAAACATTTACAAAAACAGG + Intergenic
961498014 3:127308587-127308609 TTACACATTTTTAAAGAAACTGG + Intergenic
961675475 3:128562697-128562719 CTAAACACATTAAATAAAACTGG - Intergenic
961920572 3:130421117-130421139 TTTGAGAAATTGAAAAAAACTGG + Intronic
961931853 3:130542402-130542424 GTTCACAAATTTAAAAAAACAGG - Intergenic
963356152 3:144210837-144210859 TTACAGTCATTGAGAAATACAGG - Intergenic
964434631 3:156638631-156638653 TTACACAGAAGGAAAAAGACAGG - Intergenic
964562914 3:158018333-158018355 TTCCACACACAGAAAAAAAAAGG - Intergenic
964832802 3:160904376-160904398 TTATATGCATTGAAAAAGACTGG + Intronic
965693947 3:171387399-171387421 TTACACACACTGGCAAACACTGG - Intronic
966018512 3:175176074-175176096 ATGCACACATTCAAATAAACCGG - Intronic
966457139 3:180130004-180130026 TTATACATAATGCAAAAAACTGG - Intergenic
967249645 3:187523735-187523757 TTACAGATATTGATAAAAATTGG - Intergenic
967373883 3:188779647-188779669 TTACACTTATTTAAAAAAAATGG - Intronic
969566638 4:7982606-7982628 TTACACCCATCTAAAATAACCGG - Intronic
969835996 4:9842084-9842106 TTACACAGATTGAAAAAAAATGG - Intronic
970266875 4:14298007-14298029 TTACAAATATTGAAAAAACAGGG + Intergenic
970323733 4:14901266-14901288 TAACACACACTGAAAAACTCAGG - Intergenic
970501725 4:16684322-16684344 TTGCACACATTAAAAACAAAAGG - Intronic
971784893 4:31087666-31087688 TTGCACACATTGAGAAAACATGG + Intronic
972091052 4:35284199-35284221 ATAATCACATTGAAAAAAAATGG - Intergenic
972995606 4:44875294-44875316 TTACCCACATCTACAAAAACTGG - Intergenic
973047859 4:45557138-45557160 TGACAAATATTGAAAAACACTGG + Intergenic
974122718 4:57659073-57659095 TTACATATATTGAAGAAAATGGG - Intergenic
974183458 4:58414154-58414176 ATACACACACAGTAAAAAACAGG + Intergenic
974341993 4:60626001-60626023 TTTCCCACATTTGAAAAAACTGG - Intergenic
974732914 4:65893106-65893128 TTACACACATGAAAAAAAGTGGG - Intergenic
975155150 4:71063552-71063574 TTACACATATTAAAAATACCAGG - Intergenic
976353687 4:84089536-84089558 TTTCAAACATTCAAATAAACCGG - Intergenic
976627914 4:87206988-87207010 TTTCCCCCAATGAAAAAAACTGG + Intronic
976966739 4:91052128-91052150 TTACATACATTGAATAGAACAGG + Intronic
977377899 4:96231250-96231272 TTACACACATTAGAAAATAGTGG + Intergenic
977587742 4:98793318-98793340 ACACACACATTGAGAAAAATGGG + Intergenic
978774748 4:112494243-112494265 TTACACTCATTAAATAAAAATGG - Intergenic
978962875 4:114705541-114705563 GTAAACACATTCAAAAAGACAGG + Intergenic
980713379 4:136599946-136599968 TTATTTTCATTGAAAAAAACAGG + Intergenic
981113401 4:140960724-140960746 TGACACACTTTGAAACAAAATGG - Intronic
981719210 4:147781443-147781465 ATATACACATTTAAAAATACGGG + Intronic
981983043 4:150819388-150819410 TTACATACAATGAAAGACACAGG - Intronic
982657636 4:158169949-158169971 TTAAATCCATTGAAAAAAAAAGG + Intronic
984239618 4:177201915-177201937 TTAAACATTTTGTAAAAAACTGG - Intergenic
984915441 4:184719055-184719077 CTACACATAAAGAAAAAAACAGG + Intronic
985246450 4:187984251-187984273 TAAGACACAGTGAAAAAAATTGG + Intergenic
986742301 5:10714790-10714812 TTACACACTTTTAAACAACCAGG - Intronic
986811474 5:11364551-11364573 TTACAGACATTGATAGAAGCAGG + Intronic
987038310 5:14039233-14039255 TTTCCGACATGGAAAAAAACGGG - Intergenic
987598133 5:20028370-20028392 TTACACAGATTAGAAAATACTGG - Intronic
988956543 5:36325406-36325428 TTACTCTCAGTAAAAAAAACTGG + Intergenic
989065458 5:37456791-37456813 TAACACACATTGAAAGCAATGGG + Intronic
989526233 5:42456513-42456535 TTACCAACATAGAAAAAAAAAGG + Intronic
990322010 5:54639260-54639282 TGATACACCTTCAAAAAAACTGG - Intergenic
990494503 5:56334276-56334298 TTACACACTTTTAAACAACCAGG + Intergenic
991552076 5:67849570-67849592 TTATACTCATTGGAAAAAATTGG + Intergenic
991596251 5:68309606-68309628 ATACACACATTGAATAAAATGGG - Intergenic
991613754 5:68474989-68475011 TCACAGAGATTGAAAAGAACAGG - Intergenic
993770703 5:91922033-91922055 CTACACACATTAAAATCAACTGG + Intergenic
993847671 5:92965699-92965721 TTACACACATTAATAAAAACTGG - Intergenic
994718205 5:103348972-103348994 TTACACTCAGTGAAATAAAATGG + Intergenic
995213339 5:109566398-109566420 TTACTCACACTAAAAAAAAATGG - Intergenic
995484493 5:112626431-112626453 TCACACTCATTTAAAAGAACTGG - Intergenic
995566591 5:113437331-113437353 TTACACACAGTCATAAACACTGG + Intronic
996067506 5:119095857-119095879 TTTCACAAAGTGAAAAGAACTGG - Intronic
997267928 5:132508220-132508242 TAAAAAACAGTGAAAAAAACTGG + Intergenic
997637258 5:135421723-135421745 TTAAACAGATTTCAAAAAACTGG - Intergenic
997668225 5:135649270-135649292 TAACACAAATTGAAAAAAAATGG + Intergenic
998265954 5:140668033-140668055 TAACATATATTGAAAAAAGCAGG + Intronic
1002148390 5:177205511-177205533 TTTAACACAATAAAAAAAACTGG - Intronic
1005612376 6:27538845-27538867 TAACACTCAGTGAAAAAATCTGG - Intergenic
1005742573 6:28805913-28805935 GTAGTCACATTAAAAAAAACAGG - Intergenic
1006649674 6:35540871-35540893 TTTCACACATATAAAAAAGCAGG + Intergenic
1007137835 6:39539963-39539985 TTACAGACAATGAGAAATACTGG + Intronic
1007361677 6:41361181-41361203 CTACACACTTTTAAACAAACAGG - Intergenic
1008976310 6:57431164-57431186 TTGGACACATTAAAAAAAAGAGG - Intronic
1009164833 6:60328314-60328336 TTGTACACATTAAAAAAAAGAGG - Intergenic
1009561706 6:65254236-65254258 GTGCACACATAGAAAACAACTGG + Intronic
1009718136 6:67427443-67427465 TTTCACAAATTGACAAAAGCAGG - Intergenic
1010128110 6:72458194-72458216 TTAAAAACAAAGAAAAAAACTGG - Intergenic
1011031151 6:82924648-82924670 TTGCACAAATTGAAAAATAAAGG + Intronic
1011892755 6:92187348-92187370 GGACAAACATTGAAAAAATCTGG - Intergenic
1012045682 6:94270104-94270126 TGACACACACTGAAGTAAACAGG - Intergenic
1012218417 6:96617531-96617553 ATATTCACATTGAAAAATACAGG + Intergenic
1012365615 6:98436031-98436053 TTACAGAAATAGAAAAAAAATGG + Intergenic
1012506637 6:99954249-99954271 TTACACCCATTTAAGAAAAGAGG - Intronic
1013469834 6:110453162-110453184 TTAAAAATATTGATAAAAACTGG - Intronic
1013682933 6:112544964-112544986 TTGCAAACAATGAAAAAAAAGGG + Intergenic
1015019022 6:128449162-128449184 TTAAACACATTTTATAAAACTGG - Intronic
1015868562 6:137752616-137752638 TTTCCCACATTAAAAAAAAATGG - Intergenic
1016216133 6:141606126-141606148 TCACATACATTTAAAAAAAAGGG - Intergenic
1016435788 6:144035783-144035805 TTACACATATTAAAAAAATGAGG - Intronic
1016826708 6:148394942-148394964 TGACAAACATAGAAAGAAACTGG - Intronic
1017083846 6:150695102-150695124 TTACAAACTTTTGAAAAAACAGG - Intronic
1018589209 6:165398793-165398815 TTAAACACATAGAAAACAAATGG + Intronic
1019806302 7:3128678-3128700 TGACACAGATTGCAAAACACTGG - Intergenic
1019933789 7:4241266-4241288 TCACACTCATTTAACAAAACAGG - Intronic
1021853957 7:24834995-24835017 ATACACACTTAGAATAAAACTGG + Intronic
1023155384 7:37245914-37245936 TTAAACCCACTGAATAAAACAGG + Intronic
1027482050 7:78710188-78710210 TTACACACATTCTACTAAACAGG + Intronic
1027486046 7:78762858-78762880 TTCCAGACAGTGAAAAAAATGGG + Intronic
1027820291 7:83033772-83033794 TTAAAAATATTGAAAAATACAGG - Intronic
1027958676 7:84916111-84916133 TTTCATACATTCAAAAAATCAGG + Intergenic
1028034908 7:85970144-85970166 TTAGACACATCCAACAAAACTGG + Intergenic
1028796555 7:94908783-94908805 TTACAAAAAAAGAAAAAAACAGG + Intronic
1029491226 7:100871340-100871362 TTAAACACTATGAGAAAAACAGG - Intronic
1030444423 7:109631507-109631529 TTACATACCTTGAAAAATAATGG + Intergenic
1030509120 7:110461412-110461434 TAACACTAATTGAAAAAAGCTGG + Intergenic
1030885079 7:114926808-114926830 TTATATACATTGAAATAAACTGG - Intronic
1031610035 7:123815048-123815070 TCACTCACATTTAAAAAAAATGG + Intergenic
1031740866 7:125428780-125428802 TTAAACACATAGAAATAAAGAGG - Intergenic
1031803803 7:126281642-126281664 TTAAACAAATTAAAAAAAGCAGG - Intergenic
1034492968 7:151404186-151404208 ATACAAATATTGAAGAAAACAGG + Intronic
1037148572 8:15606015-15606037 TTAAACAGAATGAAAAATACAGG - Intronic
1038076794 8:24084941-24084963 TGACAGACTTTGAAAAAGACAGG - Intergenic
1038349390 8:26762537-26762559 TTACAAACAGTGAAAGAAGCTGG - Intronic
1038374566 8:27026054-27026076 TAACACACAATGAAAAGTACAGG - Intergenic
1038898022 8:31809650-31809672 TTACAGCCATTAAGAAAAACTGG - Intronic
1039356640 8:36824723-36824745 TTATACACATTTAAAAAAACAGG - Intronic
1040703434 8:50095572-50095594 TTGCACACAGAAAAAAAAACAGG - Intronic
1040815745 8:51506925-51506947 TTAGACACTATGAAAAAAATCGG - Intronic
1040855193 8:51942029-51942051 TAACACTCAGTGAAGAAAACTGG + Intergenic
1041565714 8:59275921-59275943 ATACACACATGGAAAAAATGTGG - Intergenic
1041953833 8:63535473-63535495 TTGCACACATGGCAAAAAAGTGG + Intergenic
1042712150 8:71730059-71730081 TTGCATACAATGAAAGAAACGGG - Intergenic
1042953207 8:74221921-74221943 TCACACACATTGGAAGAAAGAGG - Intergenic
1043511153 8:80951390-80951412 TTAAACACATAAAAAGAAACAGG + Intergenic
1043807141 8:84685658-84685680 TTACACAATTTAAAAAACACAGG + Intronic
1044266054 8:90182696-90182718 TTAGACAAATGGAAAAAAAAAGG + Intergenic
1044304455 8:90621733-90621755 TTAAAGATATAGAAAAAAACTGG + Intergenic
1044430030 8:92097045-92097067 TAACACAAAGTGAAAAAAGCTGG + Intronic
1044460618 8:92440111-92440133 GTACACAAATTAAAAAAAAAAGG + Intergenic
1045134374 8:99198028-99198050 TTACACACTTTGAAAAAATGAGG + Intronic
1045936094 8:107681143-107681165 TTACACACATAGACACACACAGG + Intergenic
1046004571 8:108463841-108463863 ATACACATATTCACAAAAACTGG + Intronic
1046445828 8:114317800-114317822 TAACAGACATTGAACAAAATAGG + Intergenic
1046467033 8:114618347-114618369 ATACACTAATTGAAAAAAAAAGG - Intergenic
1046851280 8:118976050-118976072 TTTCAAACATTTAAAGAAACTGG - Intergenic
1047867822 8:129047732-129047754 ATAAATACATTGGAAAAAACTGG + Intergenic
1048026343 8:130590446-130590468 TGAGCCACATTGAACAAAACTGG - Intergenic
1048229603 8:132625292-132625314 TTAGACACATGGAAAAACAACGG - Exonic
1048246672 8:132810372-132810394 TGACATACATAGAAGAAAACTGG + Intronic
1048916776 8:139191746-139191768 ATGCACTCACTGAAAAAAACAGG + Intergenic
1051083668 9:13322543-13322565 TTAAACACTTTAAAAAAAAAAGG - Intergenic
1051257062 9:15224779-15224801 TTACACACACAGTAAAAAAAAGG + Intronic
1051529942 9:18090759-18090781 TTAAACACAATAAAAATAACTGG + Intergenic
1052676125 9:31627267-31627289 TTACAGACACTGAAATCAACTGG + Intergenic
1054743134 9:68828455-68828477 TAAAACAAAGTGAAAAAAACTGG - Intronic
1055562270 9:77532831-77532853 CTACACACAGTGAAGACAACAGG + Intronic
1058498496 9:105586683-105586705 TTAGACCCATTTAAAGAAACTGG - Intronic
1059135303 9:111800808-111800830 TTACACACATTGAAAAATTCAGG + Intergenic
1059718213 9:116933193-116933215 TTACAGACATTCAAAAAGAAAGG + Intronic
1062156936 9:135055200-135055222 TTAGCCAGATTGAAAAATACGGG + Intergenic
1062739894 9:138165618-138165640 TTACACACTTTTAAATAACCAGG - Intergenic
1185528531 X:798820-798842 TAAAACAGATTGAAAAAAATTGG - Intergenic
1186253600 X:7696002-7696024 TGAAACACATGGACAAAAACGGG - Intergenic
1186286875 X:8053979-8054001 TGATACACATTGAATAAAAATGG - Intergenic
1187425696 X:19175647-19175669 TTACACAAATCCAAAATAACTGG + Intergenic
1188414754 X:29918759-29918781 GTAAACACATTGAACAAAAAAGG - Intronic
1191222776 X:58007816-58007838 GTACACCCATTATAAAAAACAGG + Intergenic
1191593876 X:62920839-62920861 ATACTCACATTAAAAAAAACAGG + Intergenic
1192350700 X:70354332-70354354 TTACAAACAGTGAGAAACACTGG - Intronic
1194419734 X:93658937-93658959 TGTCACACAGTGAAAACAACAGG + Intergenic
1194898717 X:99479641-99479663 TTAAACACAAAGAAAAAAGCTGG + Intergenic
1195666308 X:107434176-107434198 TCACAGTGATTGAAAAAAACTGG + Intergenic
1196132305 X:112170200-112170222 TTAAACACAATGAACAAAGCTGG - Intergenic
1196535806 X:116842199-116842221 TTAACAAGATTGAAAAAAACTGG - Intergenic
1196706112 X:118718681-118718703 TTAAACTCATTCACAAAAACCGG + Intergenic
1197139739 X:123104182-123104204 TTAAACAAATAGAACAAAACAGG + Intergenic
1197565486 X:128079356-128079378 TAATAAACATTGAAAAACACTGG + Intergenic
1197830253 X:130634322-130634344 TTACACACCTTGAATAGAATGGG + Intronic
1198399785 X:136257555-136257577 TTATACAGATTAAAAAAAATGGG + Intergenic
1200572963 Y:4855326-4855348 TTATAGACCTTGAAAGAAACAGG - Intergenic
1200965265 Y:9029571-9029593 TTGAACACATTAAAAGAAACAGG + Intergenic
1201523971 Y:14910481-14910503 TTACACATATTCAAAATAATTGG - Intergenic
1202244559 Y:22806163-22806185 TCACAGAAATGGAAAAAAACAGG + Intergenic
1202397548 Y:24439909-24439931 TCACAGAAATGGAAAAAAACAGG + Intergenic
1202473233 Y:25230178-25230200 TCACAGAAATGGAAAAAAACAGG - Intergenic