ID: 1105239187

View in Genome Browser
Species Human (GRCh38)
Location 13:18595380-18595402
Sequence AGCCCTCCTCAGAGACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 6, 1: 0, 2: 4, 3: 16, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105239187_1105239194 4 Left 1105239187 13:18595380-18595402 CCCCCGGGTCTCTGAGGAGGGCT 0: 6
1: 0
2: 4
3: 16
4: 139
Right 1105239194 13:18595407-18595429 CCTCCATCACAGAGAATATCAGG 0: 8
1: 4
2: 1
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105239187 Original CRISPR AGCCCTCCTCAGAGACCCGG GGG (reversed) Intergenic
900515839 1:3081875-3081897 AGCTCCCCTCACAGACCCAGAGG + Intronic
900555303 1:3277348-3277370 TGCCCACCTCAGAGGCCAGGAGG + Intronic
900625218 1:3604880-3604902 AGCCCTCCTCAGCCTCCCTGGGG + Intronic
901218219 1:7566656-7566678 AGCCCTCCACAGGCACCCAGAGG + Intronic
901455387 1:9360187-9360209 AGCCCTGCTTAGAGGCCAGGAGG + Intronic
901739995 1:11335492-11335514 AGCCGTCCTCACAGCCCAGGAGG - Intergenic
904337169 1:29805407-29805429 AGCCCACCTGAGACACCCAGTGG - Intergenic
904801112 1:33093499-33093521 GGCCCTACTCAGAGGCCCTGGGG - Intronic
912473875 1:109923794-109923816 TGCCCTGCTCAGAGACCCCCCGG + Exonic
912520344 1:110240635-110240657 GGCCAGCCTCAGAGGCCCGGAGG + Intronic
913090835 1:115475515-115475537 AGCCCTCCTCACAGACCAAGGGG - Intergenic
915493269 1:156263556-156263578 AGCCCTCCTCAGAGGCTGGGGGG + Exonic
917245761 1:172998577-172998599 AGCCCTCCTCATAGACACAGAGG - Intergenic
921761121 1:218916384-218916406 AGCCCTCCTCAAAGACCCTCTGG + Intergenic
1064310515 10:14208345-14208367 AGCCCTCCCCAGAGACCTGGGGG - Intronic
1064629725 10:17297327-17297349 AGCTCTCTTCTGAGACCTGGCGG + Intergenic
1065268536 10:24002474-24002496 AGGCCTCCTCAGATGCCCAGTGG + Intronic
1067285262 10:44903194-44903216 AGTCCTCCCCAGAGACCCAGGGG - Intergenic
1067580530 10:47442764-47442786 AGCCCTCACCACAGACCCTGAGG + Intergenic
1073509553 10:104034683-104034705 AGGGCTCCTGAGACACCCGGGGG + Exonic
1074457931 10:113611719-113611741 AGCCCTCCTCAGAAGGCGGGTGG + Intronic
1077575378 11:3379000-3379022 AGGCCTCCTGAGAGACAGGGAGG - Intronic
1078102276 11:8336925-8336947 AGGCCTCCTCTGAGCCACGGTGG - Intergenic
1080384041 11:31799985-31800007 AGCCCTTCTCACAGAACCTGGGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083180681 11:60982793-60982815 AGCCCTGCTCCAAGACCCTGGGG - Intronic
1084312457 11:68324964-68324986 AGCCCTGCTCAGAGACCACCAGG + Intronic
1084329681 11:68423151-68423173 AGGCCTCCTCAGCCACCCGCCGG - Intronic
1084980718 11:72827146-72827168 AACCCTCCTCTGAGGCCCTGGGG + Intronic
1085226166 11:74923129-74923151 AGCTGTCCTCAGAGACCAGTAGG + Intronic
1085533812 11:77206440-77206462 AGTCCTCCTCAGAGACAGGGAGG - Intronic
1089305115 11:117521693-117521715 CGCCCTCCTCAGTGAGCCAGAGG - Intronic
1094053796 12:26248056-26248078 AGCCTCCCTCTGAGACCCAGAGG + Intronic
1095922257 12:47543133-47543155 AGCCCTCCTCATGGCCACGGTGG + Intergenic
1102101212 12:110280743-110280765 AGCCCCCCTCAGAAACCAAGGGG - Intronic
1105024888 12:132841361-132841383 GACCCTCCCCAGAGCCCCGGGGG - Exonic
1105239187 13:18595380-18595402 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
1114064555 14:19050457-19050479 AGCCCTCCTCAGAGACATGGGGG - Intergenic
1114097706 14:19349545-19349567 AGCCCTCCTCAGAGACGTGGGGG + Intergenic
1116509499 14:45726428-45726450 AGACCTTCCCAGAGACCCAGTGG - Intergenic
1118806042 14:69237731-69237753 AGCCCTCCTCAGAGCCGATGGGG - Exonic
1119048731 14:71345047-71345069 AGCCTTCCCCAGACACCCAGGGG - Intronic
1120718504 14:87865803-87865825 AACCCTCCTCAGAGTCAGGGAGG - Intronic
1121635249 14:95449812-95449834 AGCTCTCCCCAGATATCCGGAGG + Intronic
1122081167 14:99268890-99268912 AGCCCTGCTCAGAGCCACGCTGG - Intronic
1122304671 14:100755195-100755217 AGCACTTCTCAGAGACCTGTGGG + Intergenic
1123492063 15:20788704-20788726 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1123548567 15:21357794-21357816 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1124651827 15:31479687-31479709 ACCCCTCCCCAGAGACAGGGCGG + Exonic
1125932812 15:43612316-43612338 AGCCATCCACACAGACCCAGGGG + Intronic
1125945911 15:43711778-43711800 AGCCATCCACACAGACCCAGGGG + Intergenic
1129162085 15:73752774-73752796 GCCCCTCCTCGGGGACCCGGTGG - Intergenic
1131965217 15:97834946-97834968 AGCCCTTCTCAGAGAAGCTGAGG - Intergenic
1202956901 15_KI270727v1_random:85025-85047 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1132556997 16:576927-576949 AGGCCTCCACAGAGGCCCGAGGG - Intronic
1132609881 16:810346-810368 AGCCCTCCTCAGGGAACCAGAGG - Intronic
1132859705 16:2064100-2064122 AGCGCGACTCAGAGACCCCGGGG - Intronic
1133658171 16:7887426-7887448 AACCCTGCTCAGAGCTCCGGAGG - Intergenic
1137530495 16:49276073-49276095 AGCTCTCCCCAGGGACCTGGAGG - Intergenic
1142292024 16:89197532-89197554 AGCCCCCCTGAGAAACCTGGAGG + Intronic
1142476632 17:192946-192968 AGCCTTCCTCAGAGGGCTGGGGG + Intergenic
1142851451 17:2706732-2706754 AGCCTTTCTCAGGGACCCTGTGG - Intronic
1143749839 17:9020708-9020730 AGCCCTCCCCAGATCCCCTGAGG - Intergenic
1145205271 17:20981489-20981511 AGCCCTGCTCACAGGCCCTGTGG - Intergenic
1146537293 17:33663885-33663907 AGCCCTCCTCAGAGTCCCTCAGG + Intronic
1148071454 17:44911210-44911232 AGCCCTCATCACAGCCCCTGGGG - Intronic
1148150669 17:45395043-45395065 AGGCCTTCACAGAGACCCTGTGG - Exonic
1150929166 17:69565636-69565658 AGCCCTGCTCTCAGACCTGGCGG - Intergenic
1151667803 17:75555714-75555736 AGCCCTCCTCAGTGGCATGGGGG - Intronic
1152229662 17:79108150-79108172 ACCCCTCCTCAGAGGCCATGTGG + Intronic
1152334891 17:79695167-79695189 AGCTCTTCTCAGAAACCAGGCGG - Intergenic
1154449605 18:14463260-14463282 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1158830699 18:61274708-61274730 ACCCTTCCTCAGAGACTGGGAGG - Intergenic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1162007230 19:7788515-7788537 AGTCCTCCCAAGTGACCCGGCGG + Intergenic
1164455449 19:28403067-28403089 AGCCCTCTTCAGGGGCTCGGTGG - Intergenic
1164582549 19:29443271-29443293 AGCCCTCTTCTGAGAGCCCGTGG - Intergenic
1164840437 19:31388972-31388994 TGGCCTCCTCCGAGACCCTGGGG + Intergenic
1166038972 19:40191185-40191207 AGCGCTCCTCACAGACCCTGTGG - Intergenic
1166373141 19:42313509-42313531 AGCCCTCCTCTGCGGCCCGCCGG + Intronic
926108903 2:10169805-10169827 AGACTTCCTCAGATCCCCGGGGG - Intronic
926452177 2:13018619-13018641 AGTCCTCATCAGAAACCCAGCGG - Intergenic
927591494 2:24361046-24361068 AACCCTTCTCAGGGACCTGGAGG + Intergenic
928607920 2:32961249-32961271 AGAGCTCGGCAGAGACCCGGAGG - Intronic
932436441 2:71704921-71704943 AGCCTCCCTCAGGGACCAGGAGG + Intergenic
933285482 2:80380418-80380440 AGGCCTCCTCAGAGCCCTTGCGG - Intronic
933989424 2:87623267-87623289 AGCCTTCCTCAGATATCTGGGGG - Intergenic
934038194 2:88106432-88106454 AGGCCTCCTCAAAGGCCTGGAGG - Exonic
935123061 2:100198841-100198863 AGCTCTCCTCTGAGAACCTGAGG - Intergenic
936026497 2:109034766-109034788 AGGCCTCCTCAAAAACCCTGGGG + Intergenic
936151198 2:110023290-110023312 ATATCTCCTCAGAGACCCTGAGG + Intergenic
936193477 2:110348079-110348101 ATATCTCCTCAGAGACCCTGAGG - Intergenic
936304418 2:111327559-111327581 AGCCTTCCTCAGATATCTGGGGG + Intergenic
937086931 2:119178010-119178032 TGGCATCCTCAGAGACCCAGTGG + Intergenic
937106336 2:119317987-119318009 AGCCTTGCTCAGATTCCCGGTGG - Intronic
937522536 2:122729618-122729640 AGCCCTCAACAGAGACCCATGGG + Intergenic
938481834 2:131669487-131669509 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
939041104 2:137190432-137190454 AACCCTCCTCAGAGACACCTCGG - Intronic
940801361 2:158136735-158136757 AGGCTTCCTCAGTGACCTGGAGG - Intergenic
946398556 2:219456089-219456111 TGCCCTCCTCACAGACCCTCAGG - Intronic
1169130875 20:3165913-3165935 CGCCCTCCCCAGAGCCCAGGTGG + Exonic
1169200493 20:3706848-3706870 AGCCCTTCTCAGTGCCCCAGGGG + Intronic
1174582108 20:51579411-51579433 AGCCATCCTCAGACAGCCTGGGG + Intergenic
1175189628 20:57202568-57202590 AGCCCTCCTCCGAGGCCCAGAGG + Exonic
1175964572 20:62654110-62654132 GACCCTCCTCAGAGCCCCAGGGG - Intronic
1176446562 21:6827129-6827151 AATCCTCCTCAGAGACCCAAGGG - Intergenic
1176824732 21:13692159-13692181 AATCCTCCTCAGAGACCCAAGGG - Intergenic
1178365108 21:31983631-31983653 ACCCTTCCTAAGAGACCCTGAGG - Intronic
1179817548 21:43917324-43917346 AGGGCTCAGCAGAGACCCGGAGG - Intronic
1179953215 21:44723525-44723547 AGCCGTCCCCAGGGCCCCGGGGG + Intergenic
1180483045 22:15773079-15773101 AGCCCTCCTCAGAGACGTGGGGG - Intergenic
1181924394 22:26346721-26346743 AGCCCTCCAGAGAGACCCATGGG - Intronic
1183709008 22:39491574-39491596 TGCCTTCCTCACAGACCTGGTGG + Exonic
1184570283 22:45319295-45319317 AGCCCTTCTCATAGACAGGGAGG + Intronic
950072730 3:10165227-10165249 AGACGTCCTCAGAGACCACGCGG - Intronic
950440489 3:13007453-13007475 AGCTTTCCTTAGAGACACGGAGG - Intronic
952831929 3:37572127-37572149 ATCCATCCTCAGAGACCCCTGGG - Intronic
953912323 3:46899287-46899309 AGCCCGCCTAAGAGACCAGCTGG - Exonic
955360994 3:58274843-58274865 TACCCTCCCCAGAGGCCCGGGGG + Intronic
965632257 3:170745226-170745248 AGCACTCCTAAGAGACCATGTGG + Intronic
968447839 4:661366-661388 AGCACTCCTCGGAGACCCCCTGG + Intronic
968451142 4:676634-676656 AGCCCTTCTCACATTCCCGGTGG + Intronic
970278833 4:14431876-14431898 AGCCCTGCTTAGAGAGCTGGAGG - Intergenic
976757365 4:88512905-88512927 ACCTCTCCTCAGAGACAGGGAGG - Intergenic
979386135 4:120067398-120067420 GGCCCTCCTCAGAGGCCAGAGGG + Intergenic
984639428 4:182145034-182145056 TGCCTTCCTCAGGGACCCCGGGG - Intronic
985661391 5:1158842-1158864 ACGCCTCCCCTGAGACCCGGAGG + Intergenic
992561743 5:77958884-77958906 AGCCACCCCCAGAGGCCCGGAGG + Intergenic
994916173 5:105982674-105982696 AGCCATCCTCAGAGCCCCCTTGG - Intergenic
995874709 5:116778270-116778292 GACCCTCCTCAGAGACCCACAGG + Intergenic
998154348 5:139776036-139776058 ACCCCTCCTCAGGGACCTTGGGG - Intergenic
998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG + Intronic
999471237 5:151857130-151857152 ACCCCACCTCAGTGACCTGGTGG + Intronic
999571643 5:152925897-152925919 AGCCCTCCACAGAGTCCCCATGG + Intergenic
1002896615 6:1383551-1383573 AGCCCTCCGCGGAACCCCGGCGG - Intergenic
1005887994 6:30111802-30111824 AGCTCTCCTAAGAGACCAGGAGG - Intronic
1007748740 6:44059010-44059032 AGCCCTCCCCAGGGAGGCGGGGG - Intergenic
1013170700 6:107634593-107634615 AGCCCTGCTTGGAGTCCCGGGGG - Exonic
1017470651 6:154734097-154734119 AACCCTCCTCCCGGACCCGGGGG - Intronic
1019359304 7:596499-596521 AGCCCTGCTGAGAGCCACGGTGG + Intronic
1020274170 7:6615089-6615111 AGCCCTCCTCCTAGACCCCGGGG - Intergenic
1021600151 7:22356746-22356768 CGCCCCCCTCAGCGGCCCGGGGG + Intronic
1027260667 7:76462221-76462243 ACCCCTCGTCAGGGAGCCGGTGG - Intronic
1027312046 7:76960334-76960356 ACCCCTCGTCAGGGAGCCGGTGG - Intergenic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1032781227 7:135166696-135166718 AGCCCTTCCCAGAGGCCGGGGGG - Exonic
1034437898 7:151071807-151071829 AGGCCTCCTCAAAGACCAGCAGG - Exonic
1035076138 7:156178886-156178908 AGTCCTCCTCAGGGCCACGGAGG + Intergenic
1037086503 8:14857210-14857232 AGGCCTGCTCAGAAACCCAGCGG + Intronic
1049601460 8:143509686-143509708 AGTCCTGCTCAGAGGCCAGGTGG + Intronic
1056367100 9:85916654-85916676 ATCCCTCCTGAGAAACCTGGGGG + Intergenic
1057197431 9:93122772-93122794 AGCTGTCCTCAGAGGCTCGGAGG - Intronic
1058982526 9:110183447-110183469 AGCCTTCCTCGGAGGCCAGGAGG + Intergenic
1061561377 9:131406084-131406106 AGCCCTCCCCGGGGGCCCGGGGG + Intronic
1062009014 9:134257152-134257174 AGAGCTCCACAGAGAGCCGGTGG - Intergenic
1062055449 9:134467518-134467540 AGACCTGCTCAGAGTCCCTGAGG - Intergenic
1062312145 9:135944639-135944661 GGCCCTGCCCAGAGACCGGGAGG - Intronic
1062614274 9:137388973-137388995 AGCTCCCCTCAGAGACCCCATGG + Intronic
1203522628 Un_GL000213v1:57402-57424 AATCCTCCTCAGAGACCCAAGGG + Intergenic
1185546850 X:953022-953044 AGCCCTCTTCAGAAACCAGGTGG - Intergenic
1186973438 X:14873711-14873733 AGCTCATCTCTGAGACCCGGAGG + Exonic
1189235560 X:39484305-39484327 AGCCCTCCCCAGACTCCCGGAGG - Intergenic
1189272156 X:39759381-39759403 CGCCCTCCTGAGACACCCTGGGG - Intergenic
1199601813 X:149545514-149545536 AGGCCACCTGAGAGACACGGGGG + Intronic
1199648568 X:149933969-149933991 AGGCCACCTGAGAGACACGGGGG - Intronic