ID: 1105242863

View in Genome Browser
Species Human (GRCh38)
Location 13:18622967-18622989
Sequence GGTGGTGGTTGTTCAGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 5, 1: 2, 2: 2, 3: 14, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105242854_1105242863 13 Left 1105242854 13:18622931-18622953 CCTGCAGAACCAAGGGTGTGGGG 0: 8
1: 0
2: 2
3: 20
4: 261
Right 1105242863 13:18622967-18622989 GGTGGTGGTTGTTCAGCAAAGGG 0: 5
1: 2
2: 2
3: 14
4: 161
1105242857_1105242863 4 Left 1105242857 13:18622940-18622962 CCAAGGGTGTGGGGGTCCTAGAA 0: 4
1: 4
2: 0
3: 10
4: 135
Right 1105242863 13:18622967-18622989 GGTGGTGGTTGTTCAGCAAAGGG 0: 5
1: 2
2: 2
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105242863 Original CRISPR GGTGGTGGTTGTTCAGCAAA GGG Intergenic
901254515 1:7810561-7810583 GGTGGTGGTGAGTCAGCGAATGG + Exonic
901315262 1:8303076-8303098 GGGGGTGGTTGTTTTGCAATGGG - Intergenic
902566272 1:17313716-17313738 GGGGGTGGTTGATCAGGAGATGG + Intronic
903809898 1:26029438-26029460 GGTTATGGTTGTTCTGCAGAGGG - Intronic
909388659 1:75091602-75091624 GGTGGTGCTAGTTCAATAAAAGG + Intergenic
911686055 1:100779099-100779121 GGTGGTGAATGGTCAGTAAAAGG - Intergenic
912248956 1:107991150-107991172 AGTGGTGCTTATTCAGGAAAAGG + Intergenic
912747640 1:112258743-112258765 GGTGGTGGTGGGTCAGTAAAAGG - Intergenic
915537710 1:156547291-156547313 GGTGGTGGTTAAACAGAAAAGGG - Intronic
921896603 1:220407829-220407851 GGTGGTGGTGGTAGAGGAAAAGG + Intergenic
1063215523 10:3922068-3922090 GGAGGAGGTTATTCAGAAAAAGG - Intergenic
1067377123 10:45737860-45737882 GGAAATGGTTATTCAGCAAAGGG - Intronic
1067884829 10:50078552-50078574 GGAAATGGTTATTCAGCAAAGGG - Intronic
1072462923 10:95637030-95637052 GGTGGTTGTTGTGGAACAAAGGG - Intronic
1073923667 10:108488019-108488041 GGTGGTGGTGGTGGAGAAAATGG + Intergenic
1075386524 10:122059334-122059356 GGAGGGGGGTGTTCAGGAAACGG - Intronic
1077636002 11:3841385-3841407 GGTGGTGGTGATTCAGCAGTGGG + Intergenic
1080782305 11:35440949-35440971 AGTGGTGTAAGTTCAGCAAAAGG - Intronic
1081014794 11:37863060-37863082 AATGAGGGTTGTTCAGCAAATGG + Intergenic
1081579038 11:44339439-44339461 TGTTGTGATAGTTCAGCAAAGGG - Intergenic
1081711214 11:45216954-45216976 GTTGGTGGTTGTTTAGAAACTGG + Intronic
1082960669 11:58916034-58916056 GGTGGTGGGTTTTCTGCTAAAGG - Intronic
1083890099 11:65591749-65591771 GGGGGTGGCAGTTCAGGAAAAGG - Intronic
1086233457 11:84598215-84598237 GTTGGTGGTTTCTGAGCAAAGGG - Intronic
1086964517 11:93014001-93014023 GGTGGTGGTTGTACAACATTGGG - Intergenic
1087976680 11:104557712-104557734 TGTAGTCGTTGTTCAGTAAATGG - Intergenic
1089726610 11:120486066-120486088 GGTGGGGGTTGCTAAGGAAAGGG + Exonic
1090231926 11:125113580-125113602 GGTGGAGGTGGTAAAGCAAATGG - Intergenic
1091637584 12:2209070-2209092 GGTGGTGTTTGTGCAGCACCTGG + Intronic
1092690491 12:11104021-11104043 GGTAGTGGTGGTACAGCAACAGG - Intronic
1093109448 12:15131860-15131882 AGTGGTGTTTGGTCTGCAAATGG - Intronic
1094179266 12:27574180-27574202 GGTGGGGGTGATTCAGCAAGGGG + Intronic
1095362365 12:41358226-41358248 GGTGGCTGCTGTTAAGCAAAGGG - Intronic
1095990621 12:48031842-48031864 GGTGGTGTTTGTAAAGCAAAGGG + Intergenic
1097859567 12:64505287-64505309 GGTGGTGGCTGTTCTGAAAGGGG - Intergenic
1097886461 12:64733833-64733855 GGTGGTAGAAGTTCTGCAAAAGG - Intronic
1098284530 12:68894084-68894106 GGTGGTGGTGGTGCAGCCAAGGG - Intronic
1098411352 12:70187477-70187499 CATGGTGGGTGTTCAGTAAATGG - Intergenic
1098851485 12:75601321-75601343 GGTGGTGGGTGGTCAGCACTGGG + Intergenic
1100162878 12:91881477-91881499 GGTGGTGGTGGTTCAAGAACTGG - Intergenic
1102494307 12:113308749-113308771 GGTGTTGAATTTTCAGCAAATGG - Intronic
1102974049 12:117193337-117193359 GGTGGTGGTTGCACAGCATTGGG + Intergenic
1103000248 12:117380107-117380129 GGTAGTAGTTGTTCATTAAATGG - Intronic
1105242863 13:18622967-18622989 GGTGGTGGTTGTTCAGCAAAGGG + Intergenic
1107801252 13:44109724-44109746 TGTGGTGCTTCTTCTGCAAATGG - Intergenic
1107825367 13:44324502-44324524 GGTTGTGGTTGTCCCCCAAATGG - Intergenic
1114210712 14:20611909-20611931 GGTGGTGGTTGGAGAGCAATTGG + Intergenic
1115785510 14:36821212-36821234 GGTGGTGATTTTTCAGAAAATGG - Intronic
1116897763 14:50333998-50334020 GGTGGTGATTGTTTTACAAAGGG - Exonic
1118104708 14:62644810-62644832 GGTGGTGGTGGTACAGCAACAGG - Intergenic
1118884172 14:69852852-69852874 GGTGGTGGTTGTTATGGAAAGGG + Intergenic
1119142663 14:72281787-72281809 GCTGGAGGTTGCTGAGCAAATGG + Intronic
1119740520 14:77011165-77011187 GGTGGAGGTTGTTAGGGAAAGGG - Intergenic
1120762594 14:88298940-88298962 GATGGAGGGTGTTCAGCAGAGGG - Intronic
1121412701 14:93758973-93758995 GGTAGTAGGTGTTCAGTAAATGG + Intronic
1121817557 14:96940210-96940232 GGGGGTGGTTGGTCAGCACCAGG - Intergenic
1122996790 14:105269468-105269490 GGTGGTGGTTGCTCAGCTCTGGG - Intronic
1123488437 15:20761637-20761659 GTTGGTGGTTGTTCAGCAAAGGG - Intergenic
1123544930 15:21330710-21330732 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1124039153 15:26084171-26084193 GGTTCTGATTGGTCAGCAAATGG + Intergenic
1124841364 15:33244962-33244984 TGTGGTGGAGGTTCAGAAAAAGG - Intergenic
1125010403 15:34866276-34866298 GGTGGTGGTTGTGCATAGAAGGG - Intronic
1129683340 15:77670897-77670919 GGTGGTGCTTGTCCATCAAAGGG - Intronic
1130902091 15:88214913-88214935 GGTGACAGGTGTTCAGCAAAGGG + Intronic
1132332278 15:101021099-101021121 GGTGGTTGTCGTTCAGGCAAAGG - Exonic
1202953279 15_KI270727v1_random:57981-58003 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1133550282 16:6847840-6847862 GGTGGTGGTTGTTGTTGAAATGG + Intronic
1135191643 16:20359366-20359388 GGTGGTGGTGGCTAAGCCAAAGG - Exonic
1136691499 16:32034590-32034612 GGTGCTGGTTCTTCAGTGAAAGG + Intergenic
1136792088 16:32978155-32978177 GGTGCTGGTTCTTCAGTGAAAGG + Intergenic
1136877729 16:33875753-33875775 GGTGCTGGTTCTTCAGTGAAAGG - Intergenic
1141847408 16:86620124-86620146 GGTGTTGGGTGGCCAGCAAATGG - Intergenic
1142249395 16:88984155-88984177 GGTGGTGTGTGTGCAGCAGAAGG + Intergenic
1203094297 16_KI270728v1_random:1239619-1239641 GGTGCTGGTTCTTCAGTGAAAGG + Intergenic
1143281833 17:5760290-5760312 GGTGGTGGTGGTACAGCAGGTGG - Intergenic
1143433960 17:6908943-6908965 GGTGGTGGCTGCTCAGGGAAGGG + Intronic
1144142199 17:12360549-12360571 GGTGGTTCTGTTTCAGCAAATGG + Intergenic
1145908362 17:28528603-28528625 GGAGGTGGTTTTACGGCAAAGGG - Intronic
1147129042 17:38395131-38395153 GGTGGTGGTGCTTCTGGAAATGG + Intronic
1147522834 17:41190641-41190663 GGTGGTGGGTCTGCAGCAAGTGG - Intronic
1148471377 17:47895952-47895974 GGTGGTTGATGTACAGCAACAGG - Intergenic
1149547152 17:57511974-57511996 GGAGGTGGTTTCTAAGCAAAGGG - Intronic
1152042844 17:77915762-77915784 GGTGGTGATTGGTCAGCACAGGG + Intergenic
1152719315 17:81915091-81915113 GGTTGAGGGTGTTCAGCAGAAGG + Intronic
1153828744 18:8900968-8900990 GGGGGTGGTTCTTGAGCCAATGG - Intergenic
1154446071 18:14436910-14436932 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1158391131 18:57046207-57046229 AGTGGTGGTTGTTATGCAAATGG + Intergenic
1159665254 18:71150916-71150938 GGTGATGTTTGCTCTGCAAATGG + Intergenic
1159789543 18:72760991-72761013 GGTGGTGGTAGTTCAAGAACAGG - Intronic
1160060313 18:75523986-75524008 GGTTGTGGTTCTGCAGCAAAGGG - Intergenic
1161935783 19:7371328-7371350 GGTGATGGTTGCACAGCAATGGG + Intronic
925293133 2:2761676-2761698 GGTGAGGGTTATTCAGCAACAGG - Intergenic
927463994 2:23323595-23323617 GCTGGGGGATGTTCAGCACAAGG + Intergenic
928414390 2:31079501-31079523 GGTGGAGGTTGTTAAGGGAAGGG + Intronic
931474783 2:62576532-62576554 GCTGGAGCTTTTTCAGCAAAAGG - Intergenic
932509623 2:72272437-72272459 GGAGTTGGGTGTTAAGCAAAGGG + Intronic
932701313 2:73993853-73993875 GGTGGTGGTTGTGCAGAGGAAGG + Intronic
934945273 2:98536723-98536745 GGTGGTCTTTTTTCAGAAAAAGG + Intronic
937067329 2:119027437-119027459 GGTGGTGGTTGTTTAACTGAGGG - Intergenic
939018465 2:136930008-136930030 GGTGGTTGTTGGCCTGCAAAGGG + Intronic
939843803 2:147220132-147220154 GGTGGTGGGTGCTAAGCAGAGGG - Intergenic
940534074 2:154916155-154916177 GCTGTTGGGTGTTCAGCTAAGGG + Intergenic
942377451 2:175352290-175352312 AGTGCTGGTTGTTCAGGAAGTGG - Intergenic
943498313 2:188652609-188652631 GGTGGTGGCTGTTCAGCTTATGG + Intergenic
946679673 2:222200421-222200443 GGTGTTGGTTGTCCAGCAAATGG + Exonic
948022392 2:234745648-234745670 GGGTCTGGTTGTTCAGCAAGTGG + Intergenic
1170197224 20:13701901-13701923 GGGGGTAGATGTTCATCAAATGG + Intergenic
1171035945 20:21713152-21713174 GGTGGAGGTTTCTCAGCCAAGGG - Intronic
1172328224 20:34054185-34054207 GGTGGGCGTTTTTCAGTAAATGG - Intronic
1172664402 20:36589190-36589212 GTTGGTGGTTATTCACCTAATGG + Intronic
1173903356 20:46607236-46607258 TGTGGTGGTTACTCAGAAAATGG + Intronic
1174096719 20:48095718-48095740 GGTGGTGGTTGCACAACAATGGG + Intergenic
1175035874 20:56001463-56001485 GGTGGTGGTGGCTCAGAGAAGGG - Intronic
1176449907 21:6852942-6852964 GTTGGTGGTTGTTCAGCAGAGGG + Intergenic
1176828074 21:13717960-13717982 GTTGGTGGTTGTTCAGCAAAGGG + Intergenic
1178660229 21:34501637-34501659 GGTGGTGGTTGGTTAGCGTATGG + Intergenic
1183383905 22:37504117-37504139 GGAGGTGGCTGTTCGGGAAACGG + Intronic
1185126038 22:49011357-49011379 GCTGGTGGTTCCACAGCAAAGGG - Intergenic
950013704 3:9741816-9741838 GGTGCTGGTAGTTCAAGAAAGGG + Intronic
951685295 3:25337196-25337218 GGTGGGGGTTGGTAAGAAAAAGG - Intronic
952519424 3:34141309-34141331 GGTGGTTGTTGTTGAGCAGTAGG + Intergenic
952728879 3:36618585-36618607 AGTGGGGGTTTTTCAGTAAATGG - Intergenic
955581730 3:60430310-60430332 GGTAATGTTTGTTCAGAAAATGG - Intronic
956204124 3:66738391-66738413 GGTGGAGGTTGTTAGGCAGAGGG + Intergenic
958017561 3:87958881-87958903 GGTGGTGGTGGTTGAGAAAGTGG - Intergenic
964164011 3:153679851-153679873 GATGGTTGTTTTTCAGAAAAAGG - Intergenic
965703977 3:171487258-171487280 GGGCTTGGTTGTTAAGCAAATGG + Intergenic
969831875 4:9804530-9804552 TGTGGTGGTGAGTCAGCAAATGG - Intronic
975324479 4:73043903-73043925 AGTGGTACTTGTTCAGTAAATGG + Intergenic
975361556 4:73476985-73477007 AGGGGTGGTTGCTCAGCATAGGG + Intergenic
977137802 4:93327798-93327820 GGTGGTGGTAGATATGCAAAAGG + Intronic
978026717 4:103885574-103885596 GGTGGTGGATGTTTACTAAACGG + Intergenic
981635696 4:146876609-146876631 GGTGGTGGATAATCAGTAAACGG + Intronic
981772815 4:148329613-148329635 CATGGTGGATGTTTAGCAAATGG - Intronic
983400507 4:167258765-167258787 GGTGGTCATTGATCAACAAATGG + Intergenic
984320364 4:178188062-178188084 GATGGTGGTTTCTCAACAAAAGG + Intergenic
986972566 5:13354278-13354300 GCTTGTGGTTGTTCAAAAAATGG - Intergenic
990540366 5:56766445-56766467 GGTGGTGGTTGTACAACAATGGG - Intergenic
990952602 5:61312844-61312866 GGTGGGGTTTGTCCATCAAATGG + Intergenic
992259001 5:74951248-74951270 GGGTGTGCTTGTTCAGCCAATGG - Intergenic
993111845 5:83666865-83666887 GGTGGCCAATGTTCAGCAAATGG + Intronic
999356915 5:150943917-150943939 GGTGGTGGTTGTTTAGAGACTGG - Intergenic
1000124727 5:158232670-158232692 TGTGCTGGCTGTTCAGAAAAGGG - Intergenic
1001715400 5:173811190-173811212 GGTGGTGGTTGTTGTGGTAATGG + Intergenic
1007162458 6:39802818-39802840 GGTGGTGGATGTTCAGTTTATGG - Intronic
1012813035 6:103985208-103985230 GGTAGGGATTGTTCATCAAAAGG - Intergenic
1016437423 6:144051387-144051409 GGTGGGTGTTGTTTACCAAAAGG - Intronic
1017724988 6:157270529-157270551 GGTGGTGGTTGTGCTGGCAATGG - Intergenic
1017941168 6:159054365-159054387 GGTGGTTATTATTCAGCAATAGG + Intergenic
1017975210 6:159350920-159350942 GGAGGTGCTTGTTCAGCAGGAGG - Intergenic
1019702149 7:2479185-2479207 GGTGGTGGTTGTTATGCGATGGG - Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020838098 7:13180047-13180069 GGAGGTGGTTGTACAACAGAAGG - Intergenic
1022514221 7:30965247-30965269 GGTGGTGGCCATTCAGCAGATGG + Intronic
1023026452 7:36055068-36055090 GGTGGTGTGTGTTCAACATATGG - Intergenic
1024042834 7:45568340-45568362 GGTGGTGGCTGGTCAGCATCTGG - Intergenic
1027119114 7:75503076-75503098 GGTGGTGGTGCTGCAGGAAAGGG - Intergenic
1027364008 7:77438336-77438358 GGTTTTGGTTTTTCATCAAAGGG - Intergenic
1030694882 7:112573955-112573977 GGTGGTGGTTTTTGTGCATACGG + Intergenic
1030872211 7:114770514-114770536 GATAGTGGTTGTTTAGGAAAAGG + Intergenic
1031108148 7:117571110-117571132 GGTGGTGGACAGTCAGCAAAGGG + Intronic
1034198875 7:149268184-149268206 TGTGGTCATTGTTCAGGAAAAGG - Intronic
1034225249 7:149476511-149476533 GGTGGTGGTTCTTCTGAAATCGG + Intronic
1034755334 7:153612413-153612435 GGTGGTGGTGGTTCAAAAAATGG + Intergenic
1037637545 8:20713230-20713252 GGAGGGGGTTGATAAGCAAAGGG - Intergenic
1043370549 8:79585588-79585610 GGAGGTGGTGATTCACCAAAGGG + Intergenic
1046333456 8:112752370-112752392 TTTGGGGGTTGTTCAGCAGATGG - Intronic
1047206635 8:122807607-122807629 TGTGGTGGGTGGTGAGCAAAGGG + Intronic
1047591017 8:126327725-126327747 GGTGGTAATTGTCCAGCAATAGG + Intergenic
1050735071 9:8752619-8752641 GGTGGTGGTGTTACAGGAAAGGG - Intronic
1053030737 9:34775463-34775485 GGTGATGGTTGTACAGCAGTGGG + Intergenic
1059655407 9:116353279-116353301 CGTAGTAGTTGTTCAGTAAATGG + Intronic
1061589860 9:131591333-131591355 GGTGGTGGCTGCCCAGCAGATGG + Intronic
1062043867 9:134416309-134416331 GGGGGTGGGCGCTCAGCAAAGGG - Intronic
1062381619 9:136289666-136289688 AGTGGTGGTTGCACAGCACACGG + Intronic
1203519275 Un_GL000213v1:31575-31597 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1186075314 X:5872102-5872124 GTTGGTGGTTGCACAGCAAAGGG - Intronic
1190100941 X:47522760-47522782 GGTGGGGATTGTTAAGGAAAAGG + Intergenic
1192522074 X:71811343-71811365 GGTGACGGTTGTACAGCAATGGG - Intergenic
1192524142 X:71827118-71827140 GGTGATGGTTGCACAGCAATGGG + Intergenic
1193262109 X:79420193-79420215 TTTGGTGGTTTTTCAGGAAATGG + Intergenic
1193392769 X:80948839-80948861 GGCAGTGGTGGTTCAGCACATGG + Intergenic
1197257738 X:124282031-124282053 TGTTGTTGTTGTTTAGCAAAGGG - Intronic
1197752100 X:129971804-129971826 GGTAGTGGTTGTACAGCACTGGG + Intergenic