ID: 1105247395

View in Genome Browser
Species Human (GRCh38)
Location 13:18665926-18665948
Sequence CATCCAGGAGCAGCCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 4, 1: 2, 2: 2, 3: 27, 4: 263}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105247388_1105247395 14 Left 1105247388 13:18665889-18665911 CCAGAGTGACGGGCCACACCAAC 0: 1
1: 4
2: 0
3: 4
4: 54
Right 1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG 0: 4
1: 2
2: 2
3: 27
4: 263
1105247382_1105247395 28 Left 1105247382 13:18665875-18665897 CCCGTTGCTCCCGGCCAGAGTGA 0: 1
1: 3
2: 0
3: 11
4: 95
Right 1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG 0: 4
1: 2
2: 2
3: 27
4: 263
1105247381_1105247395 29 Left 1105247381 13:18665874-18665896 CCCCGTTGCTCCCGGCCAGAGTG 0: 1
1: 3
2: 1
3: 2
4: 67
Right 1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG 0: 4
1: 2
2: 2
3: 27
4: 263
1105247383_1105247395 27 Left 1105247383 13:18665876-18665898 CCGTTGCTCCCGGCCAGAGTGAC 0: 1
1: 3
2: 3
3: 36
4: 328
Right 1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG 0: 4
1: 2
2: 2
3: 27
4: 263
1105247387_1105247395 18 Left 1105247387 13:18665885-18665907 CCGGCCAGAGTGACGGGCCACAC 0: 1
1: 3
2: 1
3: 8
4: 113
Right 1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG 0: 4
1: 2
2: 2
3: 27
4: 263
1105247386_1105247395 19 Left 1105247386 13:18665884-18665906 CCCGGCCAGAGTGACGGGCCACA 0: 1
1: 3
2: 1
3: 20
4: 443
Right 1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG 0: 4
1: 2
2: 2
3: 27
4: 263
1105247390_1105247395 1 Left 1105247390 13:18665902-18665924 CCACACCAACATCGTGGAGTACC 0: 5
1: 0
2: 0
3: 4
4: 130
Right 1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG 0: 4
1: 2
2: 2
3: 27
4: 263
1105247391_1105247395 -4 Left 1105247391 13:18665907-18665929 CCAACATCGTGGAGTACCTCATC 0: 5
1: 0
2: 0
3: 3
4: 48
Right 1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG 0: 4
1: 2
2: 2
3: 27
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105247395 Original CRISPR CATCCAGGAGCAGCCCGGCC AGG Intergenic
900946373 1:5833465-5833487 CCTGCAGGAGCAGCCGGTCCGGG - Intergenic
901083270 1:6595680-6595702 CATCCAGCAGCACCCTTGCCAGG + Intronic
901425826 1:9182122-9182144 CACCGAGAAGCAGCCCGGCTCGG + Intergenic
901842676 1:11963959-11963981 CAGCCAGGAGCAGACAGGGCAGG - Intronic
901976905 1:12952451-12952473 CAGGCATGAGCAGCCTGGCCCGG - Intronic
902008265 1:13249319-13249341 CAGGCATGAGCAGCCTGGCCCGG + Intergenic
902027234 1:13393086-13393108 CAGGCATGAGCAGCCGGGCCCGG + Intergenic
902398735 1:16146044-16146066 CTTCCAGCAGCAGCATGGCCAGG + Intronic
902630807 1:17703265-17703287 CCTCCAGGGGCAGCTCAGCCAGG - Intergenic
902810006 1:18882796-18882818 CATCCAGCAGCAGGCAGGGCTGG - Intronic
904473267 1:30748690-30748712 CACTCCGCAGCAGCCCGGCCTGG + Intronic
904557490 1:31374706-31374728 CAGCCAGCAGCAGCCTGTCCAGG + Intronic
904812649 1:33173311-33173333 CAGGCAAGTGCAGCCCGGCCAGG - Intronic
905453781 1:38073823-38073845 CAACCAGGGGCACCCAGGCCAGG + Intergenic
907280949 1:53346757-53346779 AATCAAGGAGGAGCCAGGCCAGG - Intergenic
910358929 1:86395729-86395751 TATCCAGGAACGGCCCGGTCAGG + Intronic
914456642 1:147842724-147842746 CAGGCATGAGCAGCCGGGCCCGG + Intergenic
918952683 1:191160288-191160310 TATCCAGGTGCAGCCGGGCATGG + Intergenic
920005685 1:202832222-202832244 AATCCAGTAGCAGCCAGGCATGG + Intergenic
922586204 1:226736725-226736747 CCTGTAGGGGCAGCCCGGCCGGG + Exonic
922891289 1:229063627-229063649 CATACAGAAGCAGCCCTGCAAGG - Intergenic
924325536 1:242890824-242890846 CAACCAGGAAGAGCCCGTCCTGG - Intergenic
1063298127 10:4826520-4826542 CGCCCACAAGCAGCCCGGCCCGG + Intronic
1063374533 10:5546202-5546224 CATCCGGGTTCAGCCCAGCCTGG + Intergenic
1069692762 10:70364615-70364637 CACCCAGCAACAGCCTGGCCAGG + Intronic
1069749780 10:70737659-70737681 CATCAAGGACCTGCCAGGCCAGG - Intronic
1069813574 10:71179701-71179723 CAGCCAGGTGCAGCCCTCCCAGG + Intergenic
1069887514 10:71633467-71633489 CATGCCTGAGCAGCCCTGCCTGG + Intronic
1069909096 10:71749053-71749075 CACACAGCAGCAGCCAGGCCTGG + Exonic
1070148685 10:73792390-73792412 CATCCAGGCTCATCTCGGCCAGG - Exonic
1071579620 10:86757021-86757043 GAGCCAGGGGCTGCCCGGCCCGG + Intronic
1072569034 10:96642629-96642651 CATCCAGAAGCCCCCTGGCCCGG + Intronic
1073082800 10:100870618-100870640 GGTCCTGCAGCAGCCCGGCCTGG - Intergenic
1073241997 10:102065303-102065325 CATCCCGGAGCCGGCCGGGCGGG + Intergenic
1074169385 10:110918631-110918653 CAGCCAGAGGCAGCCCGGCCGGG - Intronic
1077495457 11:2884784-2884806 GAACCAGGGGCAGCGCGGCCAGG - Exonic
1077680762 11:4237928-4237950 CACCCAGCAGCCGCCCTGCCTGG + Intergenic
1078147259 11:8730395-8730417 CCTGAAGGAGCAGCCGGGCCGGG - Exonic
1079092442 11:17490588-17490610 ATTCCTGGAGCAGCCCTGCCTGG + Intergenic
1079128565 11:17735060-17735082 CAGCCAGGAGAACCCCCGCCTGG + Exonic
1083610173 11:64000635-64000657 CCTCCCGGAGCCGCCCTGCCTGG - Intronic
1083923149 11:65791200-65791222 CAGCCAGAGGCAGGCCGGCCCGG - Intronic
1084086189 11:66856465-66856487 CACCCCGCAGCAGCCCTGCCAGG + Intronic
1085276959 11:75306661-75306683 CAGGCAGCAGCAGCCAGGCCAGG + Intronic
1085736736 11:79045571-79045593 GCTCCAGTAGCAGCCAGGCCAGG - Intronic
1087182953 11:95157475-95157497 CCTCCAGGAGCTGCTGGGCCAGG + Intergenic
1088811435 11:113395296-113395318 CATCCAAGATCACCCCAGCCCGG - Intronic
1090359967 11:126165442-126165464 CCTCCAGGTGCAGCCCGTGCTGG - Intergenic
1090398132 11:126432517-126432539 CACACAGGAGCTGCCCAGCCAGG + Intronic
1090399121 11:126436995-126437017 CTTCCAGGACCAGGCCTGCCCGG + Exonic
1090770062 11:129912123-129912145 CATCCAGGTGCAGCACATCCAGG - Exonic
1091339410 11:134798675-134798697 CCTCCAGGAGCTGGCCGGCCAGG - Intergenic
1091545700 12:1500205-1500227 CCTCCCGCAGCAGCCAGGCCCGG + Intergenic
1092169415 12:6363810-6363832 CATCCCGGAGAAGCCTGGGCGGG + Intronic
1094296681 12:28914784-28914806 CTTGCAGGAGCAGCCAGGCAAGG - Intergenic
1095989810 12:48027038-48027060 CCTCCAGGAGCAGGCCTGGCTGG + Intergenic
1100565443 12:95790319-95790341 GAGCCGGGAGCAGCCGGGCCGGG + Exonic
1100980057 12:100156689-100156711 CCTCCAGGAGCACCCAGGCTTGG - Intergenic
1101262550 12:103047696-103047718 CAACCAAGATCAGCCAGGCCTGG - Intergenic
1101737664 12:107475119-107475141 CAGCCAGAGGCAGCCAGGCCAGG - Intronic
1102519127 12:113468111-113468133 CATCCAGGTGCGGCCCGGGGCGG - Exonic
1102575461 12:113853588-113853610 CCTTCAGGACCAGCCCGGTCTGG + Intronic
1103779418 12:123389167-123389189 CACCCACCTGCAGCCCGGCCAGG - Intronic
1103954840 12:124570152-124570174 CAGCCAGCTGCAGCCTGGCCTGG - Intergenic
1104720591 12:131043161-131043183 CACCCTGGAGCAGCCCGGCCCGG + Intronic
1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1105539350 13:21301561-21301583 CATCAAGGATCAGCACGGTCTGG - Intergenic
1106563016 13:30862951-30862973 CCAACAGGAGCAGCCAGGCCTGG + Intergenic
1106707777 13:32300260-32300282 CTTCCAGGAGCTCCTCGGCCAGG + Intergenic
1109450914 13:62512958-62512980 CCTGCAGGAGCAGCCAGGCAGGG + Intergenic
1112566180 13:100552955-100552977 TACCCAGGAGCAGGCAGGCCAGG + Intronic
1113748543 13:112763037-112763059 CATCCCTGAGCAGCCCTGCGCGG + Intronic
1113926468 13:113944378-113944400 CATCCAGCAGCAACCTGCCCTGG - Intergenic
1115001200 14:28421392-28421414 CAGACAGGAGCAGCCTGGTCAGG - Intergenic
1117648258 14:57875486-57875508 CATCCAGGATCAACCAAGCCTGG - Intronic
1118159422 14:63273838-63273860 GAGCCAGGTGCAGCCTGGCCAGG + Intronic
1119858837 14:77922195-77922217 CACCCAGGACCAGCCCTGGCTGG + Intronic
1120255515 14:82114341-82114363 CATGCAGTAGCAGCCCTTCCTGG + Intergenic
1121437406 14:93928640-93928662 CATCCAGAAGCTGCCCAGCCTGG + Exonic
1121454199 14:94027880-94027902 CTTCCAGGAGCAGCTCAACCAGG - Intronic
1122366204 14:101196177-101196199 GATGCAGGCGCAGCCCTGCCAGG - Intergenic
1122666623 14:103334467-103334489 CAGCGAGGAGCGGCCGGGCCAGG - Exonic
1122717003 14:103701902-103701924 CACCCAGGAGCTGCTCTGCCAGG + Intronic
1122772783 14:104104702-104104724 CATCCAGGCTCAGCCCTGGCTGG - Exonic
1122893833 14:104745524-104745546 CAGCCAGGAGCAGCTCGCCCAGG - Intronic
1122993199 14:105248611-105248633 CAGCCTAGCGCAGCCCGGCCAGG - Exonic
1123019605 14:105391526-105391548 CCCCCAGGAGCTGCCTGGCCTGG + Intronic
1202849826 14_GL000225v1_random:9482-9504 CATCCAGCAGCAGGCCGGAGGGG - Intergenic
1202852714 14_GL000225v1_random:31163-31185 CATCCAGCAGCAGGCCGGAGGGG - Intergenic
1202857294 14_GL000225v1_random:59188-59210 CATCCAGCAGCAGGCCGGAGGGG - Intergenic
1202860532 14_GL000225v1_random:78941-78963 CATCCAGCAGCAGGCCGGAGGGG + Intergenic
1125727840 15:41877124-41877146 TGTCCAGGTGCAGCCAGGCCTGG + Exonic
1128333060 15:66768902-66768924 CATCCACCAGCAGGCTGGCCTGG - Intronic
1129664158 15:77570047-77570069 CAGCCAAGAGCAGCCAGGCAGGG + Intergenic
1130537512 15:84797920-84797942 CATCCAGGAGCGACACTGCCAGG + Exonic
1131260460 15:90884868-90884890 TACCCAGCAGCAGCCTGGCCTGG - Intronic
1132255564 15:100373465-100373487 GACCCCGGTGCAGCCCGGCCAGG + Intergenic
1132289039 15:100686473-100686495 TGTCCAGCAGCAGCCCTGCCGGG - Intergenic
1132383112 15:101380313-101380335 CATTCAGGAGCCGCCCTGACGGG + Intronic
1132648785 16:1011100-1011122 CAGGCAGGAGCAGCCCCGCCCGG + Intergenic
1133234754 16:4382620-4382642 CGGCCAGGAGCACCGCGGCCAGG - Exonic
1133240276 16:4409952-4409974 CCTGCATGAGCAGCCCTGCCGGG - Intronic
1136417828 16:30114261-30114283 CATCCCTGAGGAGCCAGGCCGGG - Exonic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1138537327 16:57666972-57666994 CTTCCAGGAGAAGGCTGGCCAGG + Intergenic
1138578340 16:57923106-57923128 CAGCCAGAAGCAGCCTGGGCAGG + Intronic
1139366963 16:66439427-66439449 CAGGCAGGAGCAGCCCAGCATGG + Intronic
1139633685 16:68245450-68245472 CATCCGGGAGCAGCCCCACACGG - Exonic
1139962563 16:70726294-70726316 CACCCACCAGCGGCCCGGCCCGG - Intronic
1141075606 16:81004380-81004402 CTCCCAGGAGCAGCCTGGCTTGG - Intronic
1141664252 16:85457717-85457739 CATCCAGCTTCAGCCCGGCTGGG + Intergenic
1141665546 16:85463475-85463497 CCTCCAGGAGCCGCATGGCCAGG - Intergenic
1142141421 16:88474370-88474392 GATGCAGCAGCTGCCCGGCCAGG + Intronic
1142270653 16:89087739-89087761 AATCCAGAAGCAGCCTGGCTGGG + Intergenic
1142306544 16:89289148-89289170 CAGCCAGGAGCTGCCTGCCCGGG - Intronic
1142309669 16:89305142-89305164 CAGCCCGGAGCAGCCCAGGCAGG - Intronic
1142799799 17:2337855-2337877 CGTCCAGGACCCGCCCCGCCCGG - Intronic
1142906753 17:3048842-3048864 CATCCAGTGGCAGCCGGGCGGGG - Intergenic
1143089508 17:4440675-4440697 CACCCAGGAGCAGCACATCCAGG - Intronic
1143904575 17:10198611-10198633 GATCCGCGAGCTGCCCGGCCCGG - Intergenic
1144729824 17:17519910-17519932 GATCCAGGAGCAGCTAGACCAGG - Intronic
1144771170 17:17760454-17760476 CATCCAGGAGTTCCCAGGCCAGG - Intronic
1144862878 17:18316608-18316630 CATCCAGGATCAGGCCAGCCAGG + Exonic
1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG + Exonic
1146315737 17:31805576-31805598 TAACAAGGTGCAGCCCGGCCAGG - Intergenic
1146484145 17:33229830-33229852 CCTCCAGGAGCAGCCAGGGCTGG - Intronic
1146915320 17:36674584-36674606 AATCCAGGAGCAGCTGAGCCAGG - Intergenic
1147006201 17:37406435-37406457 CATCCACGAGCAGCCCTTCGGGG + Intronic
1148157491 17:45432223-45432245 TTTCCCGGAGCAGCCCGGCCGGG + Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149606263 17:57927217-57927239 CATCCAGGGGCAGGCGGGCCTGG + Intronic
1150389178 17:64780914-64780936 TTTCCCGGAGCAACCCGGCCGGG + Intergenic
1150496829 17:65614243-65614265 CATCCAGAAGCAGCCTGACTTGG + Intronic
1151367314 17:73626026-73626048 CCTCCAGGAGCAGCTCGGAAAGG - Intronic
1151388573 17:73770537-73770559 CATCCTGTTCCAGCCCGGCCAGG - Intergenic
1151419455 17:73987619-73987641 CATCCTGGAGGAGCCCGTCCTGG + Intergenic
1151732054 17:75917530-75917552 CATGCAGGGGCCGCCTGGCCAGG - Intronic
1151965008 17:77426549-77426571 GTTCCAGGAGCAGCCAGGCCAGG - Intronic
1152613844 17:81329009-81329031 CCTCCAGAAGCAGCCTCGCCAGG - Intronic
1152659726 17:81536662-81536684 CATCCTGGTGCTGCGCGGCCTGG + Exonic
1152733498 17:81985303-81985325 CATGCTGGTGCAGCCCTGCCGGG + Intronic
1153528158 18:6016914-6016936 CATGGAGAAGCAGCCAGGCCAGG + Intronic
1154348939 18:13566978-13567000 CAGCCTGGTGCAGCCTGGCCTGG + Intronic
1154441450 18:14393196-14393218 CATCCAAGAGCAGCCCGGCCAGG - Intergenic
1154497831 18:14975299-14975321 CATCCAGAAGCAAACAGGCCTGG + Intergenic
1155152981 18:23136545-23136567 CTCCCTGGAGCAGCCAGGCCAGG + Exonic
1156379754 18:36547207-36547229 CACCTAGGAACAGGCCGGCCTGG - Intronic
1157131481 18:45011703-45011725 CATGCAGGGGCAGCCACGCCTGG - Intronic
1157405896 18:47422685-47422707 CACCCAGCGGCAGCCCGGGCTGG + Intergenic
1158623910 18:59055728-59055750 CATCCAGGCACAGCCTGACCTGG - Intergenic
1160325177 18:77939923-77939945 CCTCCAGGAGCATCCCAGCAAGG - Intergenic
1160461417 18:79041720-79041742 AATCCCAGAGCAGCCAGGCCTGG + Intergenic
1160891459 19:1380841-1380863 GATCTAAGGGCAGCCCGGCCAGG + Intergenic
1161342863 19:3752528-3752550 CAGCCAGGGGCAGCCCCACCAGG + Exonic
1161531487 19:4792556-4792578 CATCCAGGAGCAGCCCGGCCAGG + Exonic
1163178614 19:15583443-15583465 CATCCGGGAGCACCCCGTCCTGG - Intergenic
1163843263 19:19624519-19624541 CATCCAGGAGCAGTACCACCTGG + Exonic
1164879102 19:31715688-31715710 CAGCCAGGAGGAGCCCCGCCAGG + Intergenic
1165160289 19:33811988-33812010 CATCCAGGAAGAGCCGGTCCAGG - Intronic
1165758499 19:38307691-38307713 CCTCCAGGGTCAGCCAGGCCAGG + Exonic
1166793132 19:45409604-45409626 CAGCCAGCAGGAGCCTGGCCTGG + Exonic
1166972346 19:46577677-46577699 AATTCAGGAGCAGCCCAGCTAGG + Intronic
925404523 2:3597254-3597276 GATCCCGGAGCAGCCCAGGCTGG - Intronic
925981925 2:9184191-9184213 CAGCCAGGAACAGCATGGCCAGG - Intergenic
926087389 2:10028878-10028900 CTCCCAGGACCAGCTCGGCCCGG + Intergenic
926268071 2:11344325-11344347 CAGCCCGGCCCAGCCCGGCCCGG + Exonic
929992878 2:46804280-46804302 CCTCCAAGAGCAGTCAGGCCGGG + Intergenic
932568491 2:72924322-72924344 CGTGCAGAAGCAGCCCGTCCTGG - Exonic
935134124 2:100284435-100284457 GCTCCAGGGGCAGCACGGCCAGG + Exonic
935216973 2:100982335-100982357 GATCCAGGAGCAGCTCTGCCTGG + Exonic
938108480 2:128549124-128549146 CAGCCAGGAGCAGCGGGGCCTGG - Intergenic
940322326 2:152390242-152390264 CATCCAGGGGCAGCACCTCCGGG + Intronic
946354552 2:219176801-219176823 CGTCCAGCAGGAGCCCGGTCAGG + Exonic
947749685 2:232525779-232525801 CTTCCAGAGGCAGCCCTGCCTGG - Intergenic
947765630 2:232635271-232635293 GGTCTGGGAGCAGCCCGGCCAGG - Intronic
948355119 2:237371816-237371838 CTTCCGGGAGCTGCCCAGCCTGG - Exonic
948358043 2:237396059-237396081 CATCTAAGAGCAACCTGGCCTGG + Intronic
948408258 2:237739275-237739297 CCTCCAGGGCCAGCTCGGCCCGG + Intronic
1169339814 20:4787768-4787790 CACCCAGGAGCAGCCCTGAGAGG + Intronic
1170118483 20:12886984-12887006 AATCCAGGAGCAGCTCAGCTGGG + Intergenic
1172210903 20:33197894-33197916 CAGCCATGAGCAGCCCTGCTGGG + Intergenic
1172386529 20:34537803-34537825 CAGCCTGGAGCAGCCTGGCCCGG + Intronic
1172704897 20:36875985-36876007 CACCCAGCAGCAGCTCGGCCTGG + Intergenic
1172837714 20:37883602-37883624 CATCCAGTAGCATCACGGGCAGG + Intergenic
1174270940 20:49367937-49367959 CATGTGGGAGCAGCCCAGCCAGG + Exonic
1176423296 21:6533022-6533044 CCCCCAGGAGCAGCACGGCTGGG - Intergenic
1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1176832784 21:13763027-13763049 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1179698789 21:43141338-43141360 CCCCCAGGAGCAGCACGGCTGGG - Intergenic
1179878578 21:44284098-44284120 CAGCGAGCAGCAGCCCGGCCTGG + Intergenic
1179886886 21:44318028-44318050 CATCCAGGAGCTGCCCCCCAGGG - Intronic
1180859159 22:19067209-19067231 CATCCAGTATCAGTCCTGCCTGG + Intronic
1181051089 22:20238649-20238671 TCCCCAGGAGCAGCCCAGCCTGG + Intergenic
1181845895 22:25708343-25708365 CATCCAGGACCATCCTGGCTGGG + Intronic
1182298038 22:29321403-29321425 AAACCAGGAGCAGCCAGGCTGGG - Intergenic
1183472983 22:38019396-38019418 ACTCCAGGAGCAGCCCGCCCTGG + Intronic
1184769397 22:46588792-46588814 CATCCAGGCTCTGCCCAGCCCGG - Intronic
1185027704 22:48425110-48425132 CCTGGAGGAGCAGCCGGGCCTGG - Intergenic
1185047609 22:48536920-48536942 CAGCCAGCTGCAGCCCAGCCAGG - Intronic
1185231761 22:49687789-49687811 GCTCCAGGAGCAGCCCAGGCTGG - Intergenic
1185288380 22:50012353-50012375 CTTCCCGGAGCAGCTCGGCAGGG + Intronic
949636357 3:5985806-5985828 AATCCAGGAGCAGCTTGGCTGGG + Intergenic
953687726 3:45091323-45091345 CATCCAGGAGCAGCGGACCCGGG - Exonic
955856462 3:63278400-63278422 CACCCTGGAGCAGCCCGGCGAGG - Exonic
960948487 3:122983047-122983069 CATCCCGCAGCCGCCCTGCCTGG - Intronic
961358159 3:126351840-126351862 CCTCCAGCCGCAGCCTGGCCAGG + Exonic
962429557 3:135306728-135306750 CATGCAGGCACAGCCCTGCCAGG - Intergenic
968047157 3:195630900-195630922 AGTCCAGGAGGAGCCTGGCCAGG + Intergenic
968307490 3:197659144-197659166 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
968609054 4:1548927-1548949 CACGCAGGAGCGGCCGGGCCAGG - Intergenic
969718333 4:8879168-8879190 CATCCACGAGGAGCCCAGCACGG - Intergenic
982840220 4:160174974-160174996 CAAGCAGGTGCAGCCAGGCCAGG - Intergenic
983297185 4:165880872-165880894 CTTACAGCAGCAACCCGGCCAGG - Intronic
984807690 4:183766589-183766611 CATCGAGGAGCAGTCTGGACTGG + Intergenic
984881494 4:184413505-184413527 ACTCCAGTAGCAGCCCTGCCAGG + Intronic
984918944 4:184747395-184747417 CCTGTAGGAGCAGCCAGGCCAGG + Intergenic
985744447 5:1638233-1638255 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
985775272 5:1837942-1837964 CCTCCAGGAAAAGCCAGGCCAGG - Intergenic
986018188 5:3776025-3776047 CATTCATGAGCAGCCAGGCCTGG - Intergenic
990003832 5:50922913-50922935 CACGCAGGAGCGGCCGGGCCAGG + Intergenic
991352622 5:65734275-65734297 CAGGCATGAGCAGCCTGGCCCGG + Intronic
992529107 5:77638466-77638488 CAGCCAGGAGAAGCCGGGGCAGG - Intronic
993904129 5:93604343-93604365 CATCCCGGCGGAGCGCGGCCCGG - Intergenic
994583588 5:101678305-101678327 CATCCAGGTGTAGCCAGGACTGG + Intergenic
996980784 5:129491290-129491312 CACTCAGGAGTGGCCCGGCCTGG - Intronic
998136522 5:139677031-139677053 CATGCAGGAGCCGGCCAGCCGGG - Intronic
1002322800 5:178385511-178385533 CCTCCTGGAGGAGACCGGCCAGG - Intronic
1002819410 6:710958-710980 CTTCCCGCATCAGCCCGGCCGGG + Intergenic
1003125269 6:3351037-3351059 CCTCCAGGAGAAGCAAGGCCAGG + Intronic
1003292240 6:4789362-4789384 AACCCAGGAGCAGCCAGGCGCGG - Intronic
1006400544 6:33814736-33814758 CTGCCAGGAGCAGCCCTACCGGG + Intergenic
1006510958 6:34520811-34520833 TCTCCAGGAGAAGCCCGGCTTGG + Intronic
1006838565 6:37014054-37014076 CATCCAGAAGCTGCCAGCCCAGG + Exonic
1007752079 6:44076795-44076817 CCTGCAGGCGCTGCCCGGCCTGG + Intergenic
1007847531 6:44772303-44772325 CATCCATGAGCACCCCAGCTGGG + Intergenic
1011527042 6:88276578-88276600 CATACAGGGACAGCACGGCCTGG + Intergenic
1011754327 6:90483554-90483576 CATCCAGCAGGAGTCCAGCCAGG - Intergenic
1013667879 6:112366713-112366735 CATCCAGGAGCAGCCCAGCCAGG - Intergenic
1016058526 6:139603882-139603904 AATCCAGGAGCAGCTTAGCCAGG + Intergenic
1016451501 6:144187482-144187504 CCTCAAGTAGCAGGCCGGCCCGG + Exonic
1016461534 6:144284861-144284883 CAGCCCGCAGCAGCCCGGCTCGG - Intergenic
1017160993 6:151366003-151366025 CAACCTGGAGCAGGCCGACCAGG - Exonic
1017324780 6:153131667-153131689 CACCCAGGAGCCGGCCTGCCAGG + Intergenic
1018580202 6:165301810-165301832 CATCCAGGAGGGCCCCGTCCAGG + Exonic
1019111721 6:169723031-169723053 CAAGCAGGCGCAGCCCGGCTAGG + Intronic
1019183456 6:170207465-170207487 CATCCAGGAGCTGCTAGGCCAGG - Intergenic
1019586859 7:1809788-1809810 CAGCCAGGCGCACCCCGGCCGGG - Intergenic
1020026712 7:4904818-4904840 CCTCCAGGAGCTCCCAGGCCTGG + Intergenic
1020083582 7:5298981-5299003 CCTCCAGGAGCACCCAGCCCCGG + Exonic
1020092673 7:5350177-5350199 CATCCACGGACAGCCCGGGCAGG + Intronic
1021912942 7:25404725-25404747 AATCTGGGAGCAGCTCGGCCAGG + Intergenic
1021923903 7:25516044-25516066 AATCCAGGAGCAGCCCCAACAGG + Intergenic
1021927202 7:25545252-25545274 CTTCCAGGAGCAGTAAGGCCTGG - Intergenic
1022508598 7:30921751-30921773 CATCCAGCTGCATCCAGGCCAGG - Intronic
1022521146 7:31007749-31007771 AAACCAGCAGCAGCCTGGCCTGG - Intergenic
1023617796 7:42038199-42038221 AGTGCAGGAGCAGCCAGGCCAGG + Intronic
1023895654 7:44430960-44430982 CATGCAAGAGGAGCCAGGCCAGG - Intronic
1024578352 7:50782555-50782577 CGTGGAGGACCAGCCCGGCCCGG - Intronic
1024772759 7:52743770-52743792 CTGCCAGGAGCAGCCAGGGCAGG + Intergenic
1025210701 7:57018212-57018234 CCTCCAGGAGCACCCAGCCCCGG - Intergenic
1025661255 7:63558635-63558657 CCTCCAGGAGCACCCAGCCCCGG + Intergenic
1031977706 7:128104347-128104369 TCTCCAGCTGCAGCCCGGCCCGG - Intergenic
1033757180 7:144404666-144404688 CAGCCAGGGGCGGCCCTGCCAGG + Exonic
1034447984 7:151123099-151123121 CCCCCAGGAGCAGCCGGGCCGGG - Intronic
1035470703 7:159106979-159107001 CATCCAGGGGCAGAGAGGCCAGG + Intronic
1035991621 8:4497206-4497228 CATCCAGGAGTAGCACAGTCTGG - Intronic
1036453852 8:8892026-8892048 CATCGTGGAGCTGACCGGCCTGG - Exonic
1036964080 8:13276701-13276723 GACCCAGGAGCAGCCCGGCGCGG - Intronic
1037902865 8:22697928-22697950 CATTCAGGAGCAGTCCCACCAGG - Intergenic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1039781196 8:40787780-40787802 CATCCAGGTTCATCCCGCCCTGG - Intronic
1041675104 8:60530434-60530456 CAGCCAGGAGCAGCCAGGCATGG - Intronic
1043570179 8:81594349-81594371 CAGCCTTGAGCAGCCCAGCCTGG + Intergenic
1044099981 8:88123031-88123053 AATCCAGGAGCAGCTTAGCCAGG - Intronic
1045057557 8:98382606-98382628 CCTCATGGAGCAGCCCGGGCAGG - Intergenic
1045365834 8:101475358-101475380 AATCCAGGAGCAGCTCAGCCAGG - Intergenic
1049549713 8:143251421-143251443 CATCCAGGAGCAGTGTGGACGGG + Intronic
1049710174 8:144059852-144059874 CATCCTGGAGCAGGTGGGCCAGG - Exonic
1050472369 9:6007382-6007404 CTTCCCGCAGCAGCCCGGACAGG - Exonic
1054965863 9:71026304-71026326 CATGCAGGTGCAGCCAGGCTGGG - Intronic
1056395497 9:86177415-86177437 CAGCCAAGAGCAGCCCATCCAGG - Intergenic
1056767515 9:89454159-89454181 CATCCAGGAAGATCCCAGCCTGG + Intronic
1061089872 9:128420631-128420653 GACCCTGGAGCAGCCCCGCCCGG - Exonic
1061249909 9:129420553-129420575 AACCCAGGAGCAGCACGGGCTGG + Intergenic
1061424628 9:130491316-130491338 GGCCCCGGAGCAGCCCGGCCAGG - Intronic
1062743147 9:138192776-138192798 CTTAAAGAAGCAGCCCGGCCAGG + Intergenic
1185849878 X:3475387-3475409 CACCCAGGAGCAACTCAGCCCGG + Intergenic
1186470975 X:9822135-9822157 GACCCAGGAGCAGACAGGCCTGG + Intronic
1190273846 X:48887562-48887584 CAGGCAAGAGCAGCCTGGCCTGG - Intergenic
1191137617 X:57082810-57082832 CAAGCAGGTGCAGCCAGGCCAGG - Intergenic
1192057103 X:67784250-67784272 AATCCAGGACAAGCCCAGCCTGG + Intergenic
1192157159 X:68755220-68755242 CATCCAGGTGGAGGCCGACCAGG + Intergenic
1192169060 X:68843236-68843258 GCTCCAGGAGCACCCCAGCCAGG - Intergenic
1192223092 X:69210664-69210686 CCTCCAAGAGCTGCCCTGCCAGG + Intergenic
1196763628 X:119223178-119223200 CCTCCAGCCGCAGCCGGGCCTGG - Intergenic
1201175880 Y:11308013-11308035 CATCCAGCAGCAGGCCGGAGGGG - Intergenic
1201179850 Y:11333428-11333450 CATCCAGCAGCAGGCCGGAGGGG - Intergenic
1201223047 Y:11789817-11789839 CAACCAGGAAGAGCCCGTCCTGG - Intergenic