ID: 1105249483

View in Genome Browser
Species Human (GRCh38)
Location 13:18685074-18685096
Sequence AGGAATAGGGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1307
Summary {0: 5, 1: 0, 2: 7, 3: 126, 4: 1169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105249483_1105249489 18 Left 1105249483 13:18685074-18685096 CCTGCCTCTTTCTCCCTATTCCT 0: 5
1: 0
2: 7
3: 126
4: 1169
Right 1105249489 13:18685115-18685137 TTTGCATTGTCTTTGCTGTCAGG 0: 4
1: 0
2: 1
3: 31
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105249483 Original CRISPR AGGAATAGGGAGAAAGAGGC AGG (reversed) Intergenic
900415528 1:2532797-2532819 AGGGGGAGGGAGGAAGAGGCGGG - Intergenic
900423662 1:2566584-2566606 ACCAACAGGGAGAGAGAGGCAGG + Intergenic
900918548 1:5656138-5656160 AGGGATGGAGAGAAAGAGGAAGG + Intergenic
901520725 1:9783011-9783033 AGAAAAAGAGAGAGAGAGGCTGG + Intronic
901653069 1:10754197-10754219 TAGAATAGGGAGTGAGAGGCAGG - Intronic
901944870 1:12693615-12693637 AGCAGGAGGAAGAAAGAGGCAGG - Intergenic
902165799 1:14570384-14570406 AGGAATTGGGAGGAGGAGGAGGG - Intergenic
902182157 1:14697606-14697628 AGGAATAGGAAGAGAGATGGGGG - Intronic
902623538 1:17664166-17664188 AGGGAAAGAGAGAGAGAGGCAGG + Intronic
902657599 1:17880124-17880146 GGGAATAGGCAGGAAGAGGCTGG - Intergenic
902793914 1:18787950-18787972 AGGAAAAGAGAGAGGGAGGCAGG + Intergenic
902797965 1:18811651-18811673 AGGAGAAGGGAGAAAGATGAAGG - Intergenic
902862696 1:19257535-19257557 AGGAACGGAGGGAAAGAGGCGGG + Intronic
902921455 1:19668114-19668136 AGGGATAGGGAGAAGGAGCTGGG - Intronic
903404553 1:23085537-23085559 AGGAATGGGGACCCAGAGGCTGG - Exonic
903642429 1:24869025-24869047 GGGCATAGGGAGACTGAGGCAGG + Intergenic
903742428 1:25565949-25565971 AGGAAGAGGAAGGAGGAGGCAGG - Intronic
903895493 1:26600752-26600774 AAGATTAGGGAGAAACAGCCGGG + Intergenic
903923248 1:26816210-26816232 AGGAAGAAAGAGAAAGAGGGAGG + Intergenic
903994645 1:27298143-27298165 AGGATGAGGGAGAAAGCAGCTGG + Intronic
904251687 1:29229449-29229471 AGCATTAGGGAGACTGAGGCGGG - Intronic
904448124 1:30591021-30591043 TGGAGCAGGGAGAAAGAGTCAGG + Intergenic
904718175 1:32485000-32485022 AGGAATCGGGAGGATCAGGCAGG + Intronic
904935475 1:34126848-34126870 GGGAATAGGGACACAGAGACAGG + Intronic
904965485 1:34369426-34369448 AGGAAGAGGGAGAGAGAGAAAGG - Intergenic
905006392 1:34713616-34713638 AGGAAAAGGCAGAACCAGGCTGG + Intronic
905077531 1:35286577-35286599 AAAAATAGGCAGACAGAGGCAGG - Intronic
905255280 1:36677732-36677754 AGAAAGAGAGAGAAAGAGGGAGG + Intergenic
905481952 1:38267892-38267914 AGGAAGAGAGAGAAGGAGGGAGG - Intergenic
905767289 1:40611958-40611980 TGGAATCGGGAGACTGAGGCAGG - Intergenic
905906083 1:41619308-41619330 AGGAATAGGGGGCACGGGGCTGG - Intronic
906376344 1:45299681-45299703 ATGAATGGGAAGCAAGAGGCAGG - Intronic
906436753 1:45803306-45803328 AGAACTAGGGAGAGAGGGGCCGG - Intronic
906615280 1:47229385-47229407 AGGGGTGGAGAGAAAGAGGCAGG + Exonic
906717546 1:47981308-47981330 AGGAAAAGAGAGAATGTGGCCGG - Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
907110419 1:51921869-51921891 AATAATAGGGAGAAAGAGGGAGG - Intronic
907274921 1:53311627-53311649 AGGAGTAGGGAGAGAGAGATGGG - Intronic
907514913 1:54987720-54987742 AGGCATAGCTAGAAAGTGGCAGG + Intronic
907520830 1:55022328-55022350 AGGAATAGGGAGAGAGGGACAGG - Intergenic
907620487 1:55972987-55973009 GGGAATAGTGAGAAAAAGGCTGG + Intergenic
907670468 1:56470392-56470414 AGGAATAGAAAGAGAGAGGAAGG - Intergenic
907730533 1:57061306-57061328 ACGAAAAGGGAGAAGGGGGCAGG + Intronic
908091644 1:60692132-60692154 AGGAAGAGGGAGAGAGATGGGGG - Intergenic
908325267 1:63017474-63017496 ACTAAAAGGGAAAAAGAGGCAGG - Intergenic
908800894 1:67879634-67879656 AGGGAAAGGGAGAGAGAGGAAGG - Intergenic
909055874 1:70820520-70820542 GGGCATATGGAGAAAGAGGAAGG + Intergenic
909162300 1:72168381-72168403 AGGAATAGGAAGAAAGAAAGAGG - Intronic
909892451 1:81024625-81024647 ATGAATAGGGAGATACAGACCGG - Intergenic
909950912 1:81719445-81719467 AGGAACACAGAGAAAGAAGCAGG - Intronic
910165834 1:84326450-84326472 AGAAAGAGGGAGAAAGTGGCAGG + Intronic
910332973 1:86097450-86097472 AGGAGGAGGGAGGAAGAGGAGGG - Intronic
910473184 1:87577302-87577324 AGAAATATGGGGAAAGAAGCTGG - Intergenic
910666192 1:89728130-89728152 TGAAATAAGGAGGAAGAGGCAGG - Intronic
910713073 1:90202004-90202026 AGGAAGAGAGAGAAAGAGGAGGG + Intergenic
910727681 1:90355909-90355931 AGGAAGGGGGAGAAAGAGAGAGG + Intergenic
910798724 1:91123901-91123923 AGGAAGAAGGAAAAAGAGCCTGG + Intergenic
911387329 1:97193710-97193732 ATGAGGAGGGAGACAGAGGCAGG - Intronic
911787467 1:101968967-101968989 AGGAGAAGGAAGAAAAAGGCAGG - Intronic
912095994 1:106144628-106144650 AGGAAGAGAGAGAAAGAGAAAGG - Intergenic
914439453 1:147691090-147691112 AGAAAGGGGGAGAAAGAGGGTGG - Intergenic
914505732 1:148287597-148287619 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
914846552 1:151286864-151286886 AGGAAGAGGGGAAAGGAGGCGGG - Exonic
914868499 1:151453214-151453236 GCGAAAAGGGAGAAAGAGGCTGG - Intronic
914918626 1:151833065-151833087 ATGAGTAGTGAGAAAGAGGAGGG + Intergenic
914919283 1:151836925-151836947 AGGGAGAGGGAGAAAGAAGTTGG + Intergenic
915111033 1:153564812-153564834 AGGACTAAGGTGCAAGAGGCAGG - Intronic
915205690 1:154268983-154269005 AGGGATAGGAAGGAAGAGGAAGG - Intronic
915622143 1:157092427-157092449 AGCAATATGGTGAAAGAGGAGGG + Exonic
916039505 1:160950332-160950354 AAGCATGGGGAGAAAGAGACAGG - Intronic
916585265 1:166144526-166144548 AGGGATGGGGAGAAAGAGGTTGG + Intronic
916804510 1:168245100-168245122 GGGAGTAGGGGGAAAGAGGGAGG + Exonic
916906862 1:169295370-169295392 GGTAATAGGGTGAAATAGGCAGG + Intronic
916980944 1:170136292-170136314 TGCAATAGGGAAAAAGAGACTGG + Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917643691 1:177008568-177008590 AGGAAGAGAGAGAAAGAAGAAGG + Intronic
917674312 1:177304841-177304863 AGGAAAAGGGAGGAAGAGAAAGG + Intergenic
918043623 1:180928054-180928076 AGGAGGAGGGAGAAAGGGCCCGG - Intronic
918069509 1:181124582-181124604 AGGAGGAGGGAGGAAGAGGAAGG - Intergenic
918563866 1:185902626-185902648 ATGAATGAGGAGAAAGAGTCAGG + Intronic
918635613 1:186770889-186770911 AAGAAGAGAGAGAAAGAGTCAGG - Intergenic
918662389 1:187105989-187106011 AGAAATAGGGAGAAAAAGGCTGG + Intergenic
918703559 1:187635338-187635360 AGGAAGAGAGAGGAAGAGACAGG + Intergenic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
918827816 1:189349370-189349392 GGGAATGGGGAGATAGAGGAAGG + Intergenic
919704051 1:200659484-200659506 AGGAATGGGGAGAATGGGGCAGG + Intronic
919710375 1:200721331-200721353 AGAGAGAGAGAGAAAGAGGCCGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
919888732 1:201954792-201954814 AAGAAGAGAAAGAAAGAGGCCGG + Intergenic
920096779 1:203491708-203491730 ATGGATAGGGAGAGAGAGGCGGG - Intergenic
920127113 1:203702144-203702166 AGGAAAAGGGAGAAGGAAGATGG - Intronic
920265095 1:204715731-204715753 AGGGATAGGGAGTAAGTGGGGGG - Intergenic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
920869804 1:209784577-209784599 CGGAATGGGGGGAAAGAGGGCGG - Intergenic
920942339 1:210495564-210495586 AGAAAGAGGGAGAAGGAGGGAGG - Intronic
921302209 1:213762071-213762093 AGGGAAAGGGAGAGAGAGGGAGG + Intergenic
921575629 1:216831505-216831527 AGAGAGAGAGAGAAAGAGGCAGG + Intronic
921623351 1:217350934-217350956 GGTAATAGGGACACAGAGGCTGG - Intergenic
921929566 1:220744116-220744138 AGAAAAAGAGAGAATGAGGCAGG - Intergenic
922010154 1:221575365-221575387 AGGAAGAGGAAGAAAGAAGGTGG + Intergenic
922236466 1:223726289-223726311 AGGGATGGGGAGGAAGAGGGTGG + Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922360812 1:224819684-224819706 ATGGCCAGGGAGAAAGAGGCAGG - Intergenic
922722728 1:227906801-227906823 AGGAGGAGGGAGGGAGAGGCAGG - Intergenic
922853715 1:228756055-228756077 AGGGATGGGGAGAAAGATGCAGG + Intergenic
922883718 1:229002201-229002223 AGAAAGAGGGAGCAAGAGGGCGG + Intergenic
922888972 1:229046090-229046112 AGAAACAGGGAGAGAGAGGCGGG - Intergenic
922988602 1:229886140-229886162 AGAAATCGGGAGAACGTGGCGGG - Intergenic
923145321 1:231193775-231193797 AGGAATTGAGAGAGAGAGGAGGG + Intronic
923282849 1:232461280-232461302 AGGAAAAGGCAGAGAGAGACAGG - Intronic
923295889 1:232594626-232594648 AAGAATAGCTAGAAAGAGGCTGG - Intergenic
923455703 1:234163328-234163350 AGTGTTAGGGAGAAAGAGGAGGG + Intronic
924155186 1:241168177-241168199 AGGAATGATGAGAAAGAGGATGG + Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924457120 1:244227846-244227868 AAGAATAGGGAGACTCAGGCTGG - Intergenic
924482781 1:244451908-244451930 AGGAAGAAGGAGCCAGAGGCCGG + Exonic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924712506 1:246541716-246541738 AGGAAAAGGATGAAAGAGGTAGG - Intronic
1062913752 10:1231583-1231605 TGCAGTAGGGAGAGAGAGGCAGG - Intronic
1063001880 10:1932388-1932410 AGAAAGAGAGAGAAAGAGGGAGG + Intergenic
1063461780 10:6219415-6219437 AGAGAAAGGGAGAAAGATGCTGG - Intronic
1063715796 10:8525720-8525742 AGAAAGAGAGAGAAAGAGGAAGG + Intergenic
1063908845 10:10809186-10809208 AGAAAGAGAGAGAAAGAGGGAGG - Intergenic
1063910352 10:10822715-10822737 AGAAAGAGAGAGAAAGAGGAAGG + Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064060642 10:12133944-12133966 AGGAATAGGGACATAGAGATAGG + Intronic
1064176080 10:13076324-13076346 AGGACTAGGAAAAATGAGGCTGG + Intronic
1064333239 10:14414361-14414383 AGAAAAAGAGAGAGAGAGGCAGG + Intronic
1064504702 10:16015821-16015843 AGGAGAAGGGAGAGAGAGGGAGG + Intergenic
1064508157 10:16056627-16056649 AGGTATATGGAAAATGAGGCTGG + Intergenic
1064940533 10:20730273-20730295 AGTAAGAGGGAGAAGGAGACAGG - Intergenic
1064944455 10:20772220-20772242 AGCAAGAGAGAGAGAGAGGCGGG - Intergenic
1065521400 10:26576866-26576888 AGGAATATGGAGAAAGTGTGTGG + Intergenic
1065608244 10:27444165-27444187 AGAAAGAGGGAGGGAGAGGCTGG - Intergenic
1065628902 10:27658027-27658049 AGGAAAAGGGAGAGAGAGAAAGG + Intergenic
1065708762 10:28495343-28495365 AGGAAAAGAGAAAAAGAGGGAGG + Intergenic
1066010437 10:31189510-31189532 AGGAATAGCCAGAAAGATCCAGG + Intergenic
1066213094 10:33259102-33259124 AGGAATTGGGTGATAGTGGCAGG - Intronic
1066782908 10:38971880-38971902 AGGTATTGGGGGAAAGAGGAAGG - Intergenic
1067021158 10:42799400-42799422 GAGAATAGAGAGAAAGGGGCTGG - Intronic
1067685030 10:48461530-48461552 AGGAATAGAGGGAGAGAGGAAGG + Intronic
1067781694 10:49212412-49212434 GGGAGTAGGGAGAGGGAGGCAGG - Intergenic
1067925531 10:50504595-50504617 GGTAATAGGGAGGGAGAGGCAGG + Intronic
1068008939 10:51423446-51423468 AGAAATAGGGAAAAGGAGACAGG - Intronic
1068332678 10:55591666-55591688 AGGAGTAAGGAGGAATAGGCAGG + Intronic
1068781634 10:60925091-60925113 AGCAATAGGGAGAGAGAGCATGG - Intronic
1068814318 10:61292462-61292484 AGGAAGAGGGAAAAAGAGACAGG - Intergenic
1068872906 10:61964250-61964272 AGAGATAGGGAGGAAGAGTCAGG + Intronic
1068923273 10:62508384-62508406 AGTAATAGAGATAAAGAGCCAGG - Intronic
1069178332 10:65323520-65323542 AGGAAAATAAAGAAAGAGGCAGG - Intergenic
1069308758 10:67006390-67006412 AGAAAGAGGGAGAAAGAGAAGGG - Intronic
1069580832 10:69565438-69565460 AGGCATTGTGAGAAAGAGACTGG + Intergenic
1069895344 10:71677066-71677088 AGGAATGGGCAGAAAGCAGCTGG - Intronic
1069914127 10:71776791-71776813 AGCAGTGGGGAGAAAGAGGCGGG - Intronic
1069940547 10:71952364-71952386 AGGAATAGGGGGAGAGCGGAGGG + Intergenic
1070110821 10:73485323-73485345 AGGAATTGGGAAAAAGGGGGTGG + Intronic
1070296238 10:75163742-75163764 AGAAAAAGAAAGAAAGAGGCTGG - Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070524468 10:77283334-77283356 AGGAGGAGGGAGAAGGAGGCAGG + Intronic
1071876246 10:89846362-89846384 AGGAGAAGGGAGAAGGAGGGAGG + Intergenic
1072421990 10:95297010-95297032 AGGAACAGGGCAAAGGAGGCAGG + Intergenic
1072615468 10:97046574-97046596 AGGGAAAGGAAGAGAGAGGCTGG - Intronic
1072621754 10:97084314-97084336 AGGGATGGAGAGAATGAGGCAGG - Intronic
1072923721 10:99597877-99597899 AGGAACAGGCAGAAAGAGAATGG + Intergenic
1073006032 10:100325431-100325453 AGGAAGAGGCAGGTAGAGGCAGG + Intronic
1073061774 10:100737647-100737669 AGGCAAAGGGAGAAGGCGGCTGG - Intronic
1073302547 10:102479876-102479898 AGGAAAAGGGAGAAAGAGCCTGG + Exonic
1073928560 10:108546186-108546208 AGGAGTAGGGAGTGGGAGGCTGG + Intergenic
1073943993 10:108730019-108730041 AGGAATAGACAGAAGGAGGGAGG + Intergenic
1073943997 10:108730039-108730061 AGGAATAGATGGAAGGAGGCAGG + Intergenic
1073999964 10:109361377-109361399 AGGATTTGGGTGAAAGAGGATGG + Intergenic
1074015560 10:109530457-109530479 AGGAATCTGGAGAAGGAGTCTGG - Intergenic
1074280795 10:112049665-112049687 AGTAAACTGGAGAAAGAGGCAGG + Intergenic
1074563846 10:114558557-114558579 TGGAATAGGGTGAAGGATGCGGG + Intronic
1074572049 10:114633002-114633024 TGGATTTGGGAGACAGAGGCTGG - Intronic
1074786579 10:116847528-116847550 AGGAATAATGAGAAATAGGGTGG - Intergenic
1074914457 10:117942014-117942036 AGGCATAGAGAGAATCAGGCTGG + Intergenic
1074915036 10:117947360-117947382 AGAGAAAGGGAGGAAGAGGCTGG - Intergenic
1075455689 10:122583403-122583425 AGGAAGAGAGAGCAAGAGGGAGG + Intronic
1075457812 10:122596106-122596128 AGGAAGAGAGAGCAAGAGGGAGG + Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076121446 10:127939988-127940010 AGGAATAGACAGGAAGAGGCAGG + Intronic
1076252394 10:128994764-128994786 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1077532519 11:3103871-3103893 AGGAATGGGGCTACAGAGGCAGG - Intronic
1077563034 11:3277302-3277324 AGGAACAGGGGGAAATAGGAAGG - Intergenic
1077568925 11:3323118-3323140 AGGAACAGGGGGAAATAGGAAGG - Intergenic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077818458 11:5711746-5711768 AGGAATAGTGTGAAAGTGCCTGG + Intronic
1077837661 11:5938452-5938474 GGGAAAAAGGAGAGAGAGGCGGG + Intronic
1078451400 11:11443527-11443549 ACCAATAAGGAGAAAGAGGGTGG + Intronic
1078502600 11:11896387-11896409 AGGAATTGGGAGGAGGAGGACGG + Intronic
1078898315 11:15617854-15617876 AGGGAATAGGAGAAAGAGGCTGG - Intergenic
1078987813 11:16612214-16612236 AGAGAGAGGGAGAGAGAGGCTGG - Intronic
1079072901 11:17363563-17363585 AAGAAAAGAGAGAAAGAGGAAGG - Intronic
1079169539 11:18079518-18079540 AGAAAAAGGGAGAAAGAGAAGGG - Intronic
1079209436 11:18448167-18448189 AGGACTCTGGAGAAAGAGTCAGG + Intronic
1079410280 11:20181097-20181119 AGGAAGAGGGAGGAGGAGGAAGG - Intergenic
1079495870 11:21043436-21043458 AGAGAAAGGGAGACAGAGGCAGG + Intronic
1079601467 11:22316515-22316537 GGGAAGAGAGAGAGAGAGGCGGG - Intergenic
1079626814 11:22625936-22625958 AGGAACACGGATAAAGACGCTGG - Exonic
1079915952 11:26368632-26368654 AGGAAGAGAGACAAAGAGGAGGG + Intronic
1080418127 11:32088674-32088696 AGGAACAGGGAGAAAAAGATTGG - Intronic
1080650698 11:34220623-34220645 AGCAAAAGGCAGAAAGAGCCTGG + Intronic
1080703504 11:34666490-34666512 AAGAATGGGGAGAAAGAAGGGGG - Intergenic
1080806926 11:35662604-35662626 AGGAGGAGGGAGAAGGAGGATGG - Intergenic
1080951207 11:37035308-37035330 AAGAAGAGAGAGAAAGAGGGAGG - Intergenic
1081205832 11:40274539-40274561 ATGAAAAGGGAGACAGAGGAGGG + Intronic
1081206119 11:40277453-40277475 AAGAAGAGGGGGAAAGAGGAAGG + Intronic
1081306379 11:41516851-41516873 AGGAATTGAGAAAAAGGGGCCGG - Intergenic
1081559643 11:44201762-44201784 AGGAGAAGGGAGAATGAGGTAGG - Intronic
1081910356 11:46696253-46696275 AGGAATAGGGACAGGGAGCCTGG - Intronic
1082008371 11:47433879-47433901 AGGAAGAGGAAGACAGAGGGAGG + Intergenic
1082069666 11:47928790-47928812 AGGAAAAGGCAGAAATAAGCAGG + Intergenic
1082170390 11:48997377-48997399 AGGAATAGGGAAAAAGGGCTAGG + Intergenic
1082769066 11:57191738-57191760 AGGGATAGGGAGAGGGAGGGAGG + Intergenic
1082837779 11:57664203-57664225 AGGAATAGGAAGGAAGGGGAAGG - Intergenic
1082965138 11:58959372-58959394 AAGAAAAGGGAAGAAGAGGCAGG - Intronic
1083335552 11:61919709-61919731 AGGCAGAGGGAGATAGAGGGAGG - Intronic
1083436133 11:62644709-62644731 AGGACTCGGGAGGATGAGGCAGG + Intronic
1083590051 11:63888526-63888548 AGGGAGACAGAGAAAGAGGCGGG - Intronic
1084149780 11:67282693-67282715 AGGAATGGGGAAAGGGAGGCAGG - Intronic
1084404083 11:68960996-68961018 AGGATGCGGGAGACAGAGGCCGG - Intergenic
1084418142 11:69045932-69045954 AGGACTAGGAAAAATGAGGCTGG - Intergenic
1084418148 11:69045981-69046003 AGGACTAGGGAAAATGAGGCTGG - Intergenic
1084418155 11:69046030-69046052 AGGACTAGGAAAAATGAGGCTGG - Intergenic
1084418161 11:69046079-69046101 AGGACTAGGAAAAATGAGGCTGG - Intergenic
1084600187 11:70140925-70140947 AGGACTAGGAAAAATGAGGCCGG - Intronic
1084782203 11:71417635-71417657 AGGAGGAGGGAGAGAGAGGAAGG + Intergenic
1084793736 11:71490818-71490840 AGGGAGAGGGAGAAAGAGCGCGG - Intronic
1084931370 11:72559168-72559190 AGAGATTGGGAGAAAGAGGCAGG - Intergenic
1085178050 11:74507816-74507838 AGGAAGTGGGTGAAACAGGCTGG - Intronic
1085841523 11:80016854-80016876 AGTAAAAAGTAGAAAGAGGCAGG - Intergenic
1085889557 11:80561660-80561682 AGGGATAGAGAAGAAGAGGCAGG + Intergenic
1086014041 11:82142814-82142836 TGGAGTAGGGAGAAAGAGTCAGG - Intergenic
1086025503 11:82285611-82285633 AGAAAGAGGTAGAAAAAGGCAGG + Intergenic
1086097974 11:83069568-83069590 GGGAACAGGAAGAAAGAGGGGGG + Intronic
1086101718 11:83107296-83107318 AGGAAGAGGAAGAAATAAGCTGG - Intergenic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086474553 11:87157823-87157845 AGGGAGAGGGAGAAAAAAGCTGG + Intronic
1086695425 11:89838987-89839009 AGGAATAGGGAAAAAGGGCTAGG - Intergenic
1086710728 11:90005498-90005520 AGGAATAGGGAAAAAGGGCTAGG + Intergenic
1087145784 11:94810149-94810171 AGGTACAGAGAGAAAGAGTCTGG + Intronic
1087593662 11:100225500-100225522 AGGAAAGGAAAGAAAGAGGCAGG - Intronic
1087640258 11:100748995-100749017 AGAAAGAGGGAGAAAGAGAGAGG - Intronic
1088645494 11:111913391-111913413 AGGATGAGGGAGGATGAGGCTGG - Intronic
1088715169 11:112542727-112542749 AGGAAGAGGGAGGAAGGGGCGGG + Intergenic
1089076392 11:115742076-115742098 AGGAATGGGGAGAATGAAGAGGG + Intergenic
1089113122 11:116072572-116072594 AGGAGGAGGAAGAGAGAGGCCGG + Intergenic
1089168737 11:116498143-116498165 AGGCATAGGGTGAAAAAGGATGG + Intergenic
1089879305 11:121758191-121758213 AGGAGAAGGGAGAAAAAGGGAGG - Intergenic
1089979978 11:122764231-122764253 AGCCATAAGGAGAAATAGGCAGG + Intronic
1090077425 11:123588043-123588065 AGGGAAAGGGAGACTGAGGCAGG - Intronic
1090202600 11:124866831-124866853 AGGATTGGGGAGAAAGACGATGG + Intronic
1090259282 11:125306970-125306992 AGAAACGGGGAGGAAGAGGCTGG - Intronic
1090407396 11:126485213-126485235 AGGAACAAGGAGCAAGACGCAGG + Intronic
1090924500 11:131237486-131237508 AGGAAAAGGGAAAGAGGGGCTGG + Intergenic
1091163256 11:133445815-133445837 AGGAAAAGTGAGAAACAAGCAGG + Intronic
1091264251 11:134258144-134258166 AGGAAAAGGGTGAGAGGGGCCGG - Intronic
1091631166 12:2162063-2162085 AGGAATGGGGATAAAAATGCAGG + Intronic
1091666791 12:2424695-2424717 TGGAATTGGGAGAGGGAGGCAGG - Intronic
1091828250 12:3531299-3531321 GGGAAGAGGGAGGAAGAGGAGGG + Intronic
1091836678 12:3591053-3591075 AGGATGAGGAAGAGAGAGGCTGG + Intronic
1092657970 12:10707222-10707244 GGGAAGAGGTAGAAAGTGGCTGG - Intronic
1092716033 12:11391746-11391768 AGGGATAGGGGGAGAGAGGATGG - Intronic
1092737157 12:11593355-11593377 AGGAGTAGGGAGGAGAAGGCAGG + Intergenic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1093509652 12:19911383-19911405 AGAAAGAGGGAGAGAGAGGGAGG - Intergenic
1093635122 12:21457695-21457717 AGGAAGAGAGAGAAGGGGGCTGG + Intronic
1093743609 12:22715139-22715161 AGTAAGAAGGAGAAAGAGGGAGG - Intergenic
1094117226 12:26929831-26929853 AGGAAGAGAGAGAGAGAGGATGG + Intronic
1096015067 12:48263821-48263843 AGGAAGAGAGAGAAAGGGGAAGG + Intergenic
1096366593 12:51033417-51033439 AGAAATAGAAAGAAAGAGACAGG - Intergenic
1096405303 12:51339806-51339828 AGGGATAGGCAGAGAGTGGCGGG + Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097007493 12:55929579-55929601 AGGAACAGGGCAAAAAAGGCCGG + Intronic
1097142188 12:56911294-56911316 AGGAATGGGGAAAGGGAGGCAGG - Intergenic
1097394303 12:59054905-59054927 AGGAAGAAGGAGACAAAGGCTGG + Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097823099 12:64147361-64147383 AGGAATTGGGAGGAGGAGGTGGG - Exonic
1097882203 12:64696126-64696148 AGGGAGAGGGAGAGAGAGGGAGG - Exonic
1098119716 12:67223069-67223091 AGGAATGAGGGGAAAGAGGCGGG + Intergenic
1098191430 12:67953250-67953272 GGGAGGAGGGAGAAGGAGGCTGG + Intergenic
1098317010 12:69203235-69203257 AGGCCTAGGGAAAAAGAAGCTGG + Intergenic
1098358610 12:69633896-69633918 AGGATGAGGGAGAAAGAGCATGG - Intergenic
1098394423 12:70003098-70003120 AGGAGGAGGGAGGAGGAGGCAGG + Intergenic
1098790398 12:74815605-74815627 ACTAATAGGGAGACAGAGGCAGG + Intergenic
1098860050 12:75698786-75698808 AGGAATAAGCAGACAGAAGCTGG + Intergenic
1098964750 12:76775109-76775131 AGGAATAACCACAAAGAGGCCGG - Intronic
1099493869 12:83320402-83320424 AGGACAAGAGAGAAAGAGGAAGG - Intergenic
1099585588 12:84508601-84508623 AGGAAAAGAAAGAAACAGGCAGG + Intergenic
1099603740 12:84775125-84775147 AAGAATATGGAGAAAGAGAGGGG - Intergenic
1099724987 12:86413897-86413919 AGGGATAGGGAAAGAGAAGCAGG + Intronic
1100043151 12:90344874-90344896 AGAAAGAGAGAGAAAGAAGCTGG + Intergenic
1100059930 12:90562375-90562397 GGGACTAGGAAGAATGAGGCTGG + Intergenic
1100336691 12:93637939-93637961 AGAAATGGGGTGAAAGAGGAAGG - Intergenic
1100921660 12:99494884-99494906 AGGAGCAGGGAGCAAGAGGAAGG + Intronic
1101108369 12:101461749-101461771 AGAAAAAGAAAGAAAGAGGCTGG - Intergenic
1101580406 12:106037424-106037446 AGGAAAAGAGAGAAAGAGAAAGG - Intergenic
1101604469 12:106237552-106237574 TTGAATAGGCATAAAGAGGCTGG - Intergenic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1102184347 12:110936070-110936092 AGGAATAGCAAGAGAGAAGCTGG - Intergenic
1102230374 12:111257659-111257681 AGGAAGAGGGGGGAAGAGGGAGG - Intronic
1102230377 12:111257669-111257691 AGGAGGAGGGAGGAAGAGGGGGG - Intronic
1102282333 12:111628185-111628207 TAGAAAAGGGAGAAAGAAGCTGG + Intergenic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1102528993 12:113532423-113532445 GGGAAGAGAGACAAAGAGGCAGG - Intergenic
1102908447 12:116694873-116694895 AGGAAGAGGGAGGAGGAGGCAGG + Intergenic
1103022983 12:117551286-117551308 AGGAATAGGAAGAAGGAAGGAGG - Intronic
1103037327 12:117667125-117667147 GGGAAGAGGGAGAGAGAGGGCGG + Intronic
1103205727 12:119127430-119127452 AGGAAAAGGGAGGAGGAGCCAGG + Intronic
1103247651 12:119471855-119471877 AGGGATAGAGAGAAAGAAACAGG - Intronic
1103767542 12:123291759-123291781 GGGAAAAGGGAGAAACAGGTGGG + Exonic
1103834486 12:123807981-123808003 AGGGAGAGGGAGAGAGAGACGGG + Intronic
1104301648 12:127570114-127570136 AGGTAAAGGGATAGAGAGGCAGG + Intergenic
1105067605 12:133214522-133214544 AGCAATGTGCAGAAAGAGGCTGG + Intergenic
1105249483 13:18685074-18685096 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1105331928 13:19425736-19425758 AGCAATAGCGAGAGAGAGGGAGG - Intronic
1105590152 13:21785261-21785283 AGGAATATGGGGACAGAGGCAGG + Intergenic
1105959046 13:25312171-25312193 AGGAATAGGGAGACAGCTGGGGG + Intronic
1106027231 13:25966904-25966926 GGGGATAGGGAGAGAGAGGGAGG + Intronic
1106092001 13:26604411-26604433 ATGATTAGGGGGAAAGAGTCAGG + Intronic
1106195622 13:27491718-27491740 AGGAAGAGGAAGAAACAGGAGGG + Intergenic
1106260829 13:28065213-28065235 AGGGATATGTAGAAAGAGGGTGG + Intronic
1106363091 13:29050500-29050522 AGAATCAGGGAGAAAGAGACAGG - Intronic
1106704313 13:32264626-32264648 AGTAAAATGGAAAAAGAGGCTGG - Intronic
1107032346 13:35866135-35866157 AGAAATAAGGACACAGAGGCAGG - Intronic
1107336589 13:39362271-39362293 AGGAAGAGAGAGAAAGGGGGAGG - Intronic
1107399273 13:40053233-40053255 AGGAGTAAGGAGAAAGAAGTGGG + Intergenic
1107485715 13:40825508-40825530 AGCAATAGCGAGAGAGAGGGAGG - Intergenic
1107922844 13:45228248-45228270 AGCAATAAGGAAAATGAGGCAGG - Intronic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108598460 13:51970491-51970513 AGGAATCTGCAGAAAGAAGCTGG - Exonic
1108625273 13:52222530-52222552 AGCAATAGCGAGAACGAGGGAGG - Intergenic
1108660785 13:52583886-52583908 AGCAATAGCGAGAACGAGGGAGG + Intergenic
1108926461 13:55753338-55753360 CGGAATAGAGGGAAAGAGACAGG - Intergenic
1109689461 13:65866696-65866718 AGAACTAGGGAGAGTGAGGCAGG - Intergenic
1109792522 13:67268378-67268400 TGGAGAAGGGAGAAAGAGGAAGG + Intergenic
1110438810 13:75504974-75504996 AAAAAAAGAGAGAAAGAGGCCGG - Intergenic
1110493969 13:76143528-76143550 AGGGATAGGGTGAGAGAGGATGG - Intergenic
1111081768 13:83320844-83320866 AGGAAGAGAGAGAAAGAGAGAGG + Intergenic
1111720771 13:91941417-91941439 AGGAAGGGGGAGATAGAGACAGG - Intronic
1111760582 13:92458643-92458665 AGAAAAAGAGAGAAAGAGGAAGG + Intronic
1111849570 13:93555191-93555213 AGCATTAAGGAGAAAGAGACAGG - Intronic
1112223654 13:97515952-97515974 AGAAACAGGGAGCAAGATGCAGG + Intergenic
1112310031 13:98310021-98310043 AGGAATAGAGAGAGAGAGGATGG - Intronic
1112698522 13:101977533-101977555 AGGAGTAGGGAGGAAAATGCTGG - Intronic
1112995030 13:105563762-105563784 AGGAAAAGGGAGAAAGACCTTGG + Intergenic
1113058078 13:106290836-106290858 AGGAAAAGAGAGAAAGAGAGAGG + Intergenic
1113304441 13:109061526-109061548 AAGAAGAGGGAGAGAGAGGTGGG + Intronic
1113695244 13:112341600-112341622 AGGGAGAGAGAGAAAGAGGGAGG - Intergenic
1114670319 14:24407694-24407716 AGGACCAGGGAGAGAGTGGCTGG + Intronic
1114975247 14:28088516-28088538 AGGAAGAGGGAGAATTAGACAGG - Intergenic
1115483527 14:33886273-33886295 AGGAATAGGGACCCAGAGGCTGG + Intergenic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1115922841 14:38395790-38395812 AGAAATAGTGAGAATGATGCTGG - Intergenic
1116218927 14:42056738-42056760 AGAAAGAGAGAGAAAGAGGAAGG + Intergenic
1117058167 14:51934083-51934105 AGTATGATGGAGAAAGAGGCAGG + Intronic
1117419826 14:55533180-55533202 AGGATTAGAGAAAAGGAGGCAGG + Intergenic
1118127243 14:62920212-62920234 AGGGATAGGGAAAAGAAGGCAGG + Intronic
1118302220 14:64625953-64625975 AGCAGGAGGGAGGAAGAGGCAGG + Intergenic
1118463097 14:66004369-66004391 AGGAAGAGGGAGAGAGAGAAAGG - Intronic
1118502319 14:66373362-66373384 ATGAATACATAGAAAGAGGCAGG - Intergenic
1118755802 14:68843168-68843190 AGAGATAGAGAGAAAGAGGCAGG - Intergenic
1119335851 14:73833054-73833076 AAGAAAAGGGAGAAAGAAGGAGG + Intergenic
1119598702 14:75959520-75959542 AGGACTTGGGAGGCAGAGGCAGG + Intronic
1119662807 14:76463741-76463763 ACGAATAGATAAAAAGAGGCCGG - Intronic
1120279287 14:82419429-82419451 GGGAATGGGGAGAAAGGGGAAGG - Intergenic
1120290466 14:82563640-82563662 AGGAAGAGGGAGACAGCGGGAGG + Intergenic
1120445210 14:84586730-84586752 AGAAAAAGGGAGAGAGAGGTGGG - Intergenic
1120612050 14:86654068-86654090 AGGATGAGGGAGAAAGATGGAGG - Intergenic
1120811775 14:88811394-88811416 AGGAAGAGAGAGAGAGAGGAAGG - Intergenic
1120873730 14:89360331-89360353 AGAAAGAGGGAGAAAGAGAAAGG + Intronic
1120996070 14:90419613-90419635 AGGAAGAGGTAGAATGAGGCTGG + Intergenic
1121002595 14:90463106-90463128 AGGAAGAGGAAGAAAGAGTGTGG + Intergenic
1121092377 14:91191564-91191586 GGGAACAGGGAGAATGAGGCTGG - Intronic
1121152932 14:91654066-91654088 AGGAAAAGGGATAAAGAAGGAGG + Intronic
1121228578 14:92339943-92339965 AGGAATAGGTTGAGAGAGGCAGG + Intronic
1121280742 14:92695847-92695869 AGAAACAGGGAGAGAGAGGGAGG - Intergenic
1121577591 14:95001089-95001111 AGGAAGAGAAAGCAAGAGGCAGG + Intergenic
1121709790 14:96029127-96029149 AGGATTACAGAGAAAGAGGCAGG - Intergenic
1122109749 14:99490577-99490599 AGGAATGGGGAAAAACAGGATGG - Intronic
1122114976 14:99523089-99523111 AGGAACTGAGAGAAAGTGGCTGG + Intronic
1122195890 14:100085448-100085470 AGGGACATGGAGAAATAGGCTGG + Intronic
1122248236 14:100419300-100419322 AGGAGAAGGAAGAAAGAGGTAGG - Intronic
1122281016 14:100622439-100622461 AGGAGGAGGGGGAAAGAGGAAGG - Intergenic
1122618014 14:103034515-103034537 AAGAAAAGGGAGGTAGAGGCTGG + Intronic
1202923402 14_KI270724v1_random:4195-4217 AGGAACAGAGGGAGAGAGGCAGG - Intergenic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124622491 15:31282122-31282144 AAGAAGAGGAAGAGAGAGGCTGG - Intergenic
1124856129 15:33391117-33391139 AGGGATGAGGGGAAAGAGGCAGG - Intronic
1125144887 15:36455630-36455652 AGGAAGAGAGAGAGAGAGGGGGG - Intergenic
1125599258 15:40906627-40906649 AGGAGAAGGGAGGGAGAGGCCGG - Intergenic
1125708934 15:41767757-41767779 AAGAATAGGGAGAGAGAGGATGG + Exonic
1126260010 15:46678270-46678292 AGAAAGAGAGAGAAAGAGGTGGG + Intergenic
1126881248 15:53100701-53100723 AAGAGTAGGGAGAAATAGGAAGG - Intergenic
1126885923 15:53150026-53150048 GGGAATAGGGAGAAAGATAGGGG - Intergenic
1127418028 15:58776299-58776321 GGGAATGGGGAGACTGAGGCAGG - Intronic
1127539924 15:59927160-59927182 GGGAATAGGGAGAAAGGGGAGGG + Intergenic
1128374718 15:67066444-67066466 GGGAAGAGGGAGAGAGAGGGAGG + Intronic
1128407866 15:67362061-67362083 GGGAACAGGAAGAAAGAGGAAGG + Intronic
1128570829 15:68731571-68731593 GGGAAGAGGGAGGAAGAGGCAGG + Intergenic
1128869802 15:71145805-71145827 GGAAATGGGGAGAAAGAGGTTGG + Intronic
1129289814 15:74556259-74556281 AAGAAGAGGGAGAAAGATGGAGG + Intronic
1129487866 15:75893903-75893925 AGGAAGAGGGAGGGAGAGGAGGG - Intronic
1129557757 15:76530798-76530820 AGGAAGAGAGAGACAGAGGGAGG + Intronic
1129726648 15:77904863-77904885 AGAAGGAGGGAGAAAGATGCAGG + Intergenic
1129792882 15:78353377-78353399 AGGAATAGGGGAAAACAGACTGG + Intergenic
1130178080 15:81595749-81595771 AGTAAAAGGGAGAGAAAGGCTGG - Intergenic
1130542567 15:84832160-84832182 TGGAACTGGGAGAAAGAGGAAGG - Intronic
1130721066 15:86386176-86386198 AGGAAGAGGGAGGAAGAGGGAGG - Intronic
1130880477 15:88051293-88051315 TGGAGTGGGGAGAAAGAGGAGGG - Intronic
1131131861 15:89905453-89905475 AGGAGTGGGGAGAGAGAGACAGG - Intronic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1131401811 15:92131334-92131356 AGGAATAGGGAGGTTGAGGCTGG - Intronic
1132058854 15:98673859-98673881 AGGAACAGGGAAAAAGATGCTGG - Intronic
1133475435 16:6116837-6116859 AGACAGAGGGAGAGAGAGGCTGG + Intronic
1134617551 16:15663174-15663196 AGGAATGAGGAGAAACAGCCAGG - Intronic
1134663228 16:15999760-15999782 AGAGAGAGAGAGAAAGAGGCCGG - Intronic
1134779765 16:16885233-16885255 GGAAATGGGGAGAAAGGGGCTGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1135010550 16:18873866-18873888 AGAAATAAGGAGAAAGTGGGTGG - Intronic
1135259548 16:20969125-20969147 GGAAATCGGGAGAAAGAGACAGG - Intronic
1135317424 16:21461451-21461473 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1135370322 16:21893263-21893285 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1135402700 16:22177328-22177350 AGAAAAAGGGAGAACAAGGCCGG + Intronic
1135441467 16:22477438-22477460 AGAAATAAGGAGAAAGTGGGTGG + Intergenic
1135475989 16:22775500-22775522 AGGAAGAGAGAGAGAGAGGAAGG + Intergenic
1136062090 16:27733691-27733713 AGAAGAAGGGAGAAAGAGCCTGG + Intronic
1136314213 16:29441191-29441213 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1136327652 16:29542956-29542978 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136392396 16:29973886-29973908 AGGAAGAGGGAGAGGGAGACCGG + Exonic
1136442340 16:30282956-30282978 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1137314823 16:47306796-47306818 AATAAAACGGAGAAAGAGGCCGG + Intronic
1137530599 16:49276562-49276584 AAGAAGAGGGAGAAAGAAGAGGG + Intergenic
1137656145 16:50159534-50159556 AGAAATAAGCAGAGAGAGGCCGG - Intronic
1137661184 16:50208153-50208175 AGGAATACAGAAAAAGAGGAGGG - Intronic
1138081866 16:54098216-54098238 AGGATTAGGGAGAAAATGGTGGG - Intronic
1138379517 16:56590361-56590383 ATGCATAGGGAGTAAGAGGTGGG + Intronic
1138498410 16:57423108-57423130 AGGAAAAGGAAGAAAGGGGAAGG + Intergenic
1138498623 16:57424357-57424379 GGGAGACGGGAGAAAGAGGCAGG - Intergenic
1139605167 16:68013104-68013126 AAGAGGAGGAAGAAAGAGGCTGG + Intronic
1139687957 16:68618946-68618968 AGGATACGGGAGAAAGAGGGAGG - Intergenic
1139889145 16:70236676-70236698 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1140483056 16:75272967-75272989 AGGAAGAGAGAGAGAGAGGGAGG + Intergenic
1140791982 16:78400636-78400658 AGGAAAAGGGGGAAGGAAGCAGG + Intronic
1140814179 16:78605262-78605284 AGGAAGAGGAAGCAGGAGGCTGG - Intronic
1140887137 16:79254250-79254272 ATGTAGAGAGAGAAAGAGGCAGG - Intergenic
1141320638 16:83005334-83005356 ATGAACAGGGAGAAAGAGTGAGG - Intronic
1141478723 16:84292138-84292160 AGGGAGAGAGAGAGAGAGGCAGG + Intergenic
1141887551 16:86902960-86902982 AGGAAGAGAGAGAAATAGTCTGG - Intergenic
1142435445 16:90053831-90053853 AGGAAAAGAGAGAGCGAGGCTGG - Intergenic
1142865667 17:2790089-2790111 AGGATGATGGAGAAAGATGCTGG - Intronic
1142913950 17:3118355-3118377 ATGAATAAAGAGACAGAGGCTGG + Intergenic
1142962009 17:3557158-3557180 AGGGATTGGGAGAGAGAGGGAGG - Intronic
1143129449 17:4667759-4667781 AATAATAGGGTGAAAGAGGATGG - Intergenic
1143204899 17:5134607-5134629 GGGAATGGGGAGAGACAGGCTGG + Intronic
1143360924 17:6370534-6370556 AGGATTGGGCAGAAAGAAGCTGG + Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143920784 17:10329594-10329616 TGGAATAGAGAGCAAGAGGCAGG - Intronic
1143944762 17:10581094-10581116 TGGAATAGGAAGGAAAAGGCTGG + Intergenic
1144486389 17:15668537-15668559 AGGAAGAGGGGGAATGACGCTGG - Intronic
1144996088 17:19270006-19270028 AAGAATAGGGATTAAGAGGATGG + Intronic
1146138365 17:30343097-30343119 AGGAAGAGGGAGAGAGAAACAGG - Intergenic
1146160628 17:30557597-30557619 GGGAATGGGGAGAACAAGGCTGG + Exonic
1146297152 17:31659158-31659180 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297162 17:31659184-31659206 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297170 17:31659204-31659226 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146724112 17:35143620-35143642 GAGAATGGGTAGAAAGAGGCAGG - Intergenic
1146759108 17:35460643-35460665 AGGAAGAGGGAGCCAGAGGCCGG + Intergenic
1146930120 17:36770930-36770952 AGAAAGAGAGAGAAAGAGGAAGG - Intergenic
1147050401 17:37790078-37790100 GGGAGTGGGGAGAAAGAGACAGG + Intergenic
1147171295 17:38620616-38620638 AGGACTGGGGAGAAAGAGTCTGG + Intergenic
1147428393 17:40357023-40357045 AGGCAGAGGGAGAAAGGGGCTGG - Intronic
1147584503 17:41646167-41646189 AGGGACAGAGAGAAGGAGGCAGG - Intergenic
1147638766 17:41980964-41980986 AGGGATAGGGTGCTAGAGGCAGG - Intronic
1147743029 17:42679473-42679495 GGGAACACTGAGAAAGAGGCAGG - Exonic
1147979115 17:44263760-44263782 AGGAAGAGAGAGAGAGAGGAAGG - Intronic
1147988023 17:44317586-44317608 AGGCATAGGGAGAACTAGGATGG - Intronic
1148020341 17:44548999-44549021 AGAAAGAGGGAGAAAGAGAAAGG - Intergenic
1148071958 17:44913867-44913889 AGGAATGGGGAGAAGGAGCCTGG - Intronic
1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG + Intergenic
1148545530 17:48515986-48516008 AGGAAGAGAGAGAAGGAGGGAGG + Intergenic
1148545540 17:48516022-48516044 AGGAAGAGAGAGAAGGAGGGAGG + Intergenic
1148545550 17:48516058-48516080 AGGAAGAGAGAGAAGGAGGGAGG + Intergenic
1148638270 17:49165691-49165713 AGGAAGGGGGAGAGAGAGGGAGG - Intronic
1148642947 17:49201827-49201849 AGGAAAAGGGAGTAAGCGGAAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148694034 17:49548495-49548517 AGGAAGGGGGAGCATGAGGCTGG - Intergenic
1148701464 17:49589478-49589500 AGGGACAGGGAGAAAGAGAAGGG + Intergenic
1149015822 17:51907329-51907351 AGGAAGAGGAAGGAAGAGGTTGG + Intronic
1149516653 17:57286047-57286069 AGGGAAAGACAGAAAGAGGCTGG - Intronic
1149636424 17:58174062-58174084 AGGAAGAGAGAGTAAGAGGGAGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150477845 17:65488076-65488098 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150478006 17:65488668-65488690 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150917303 17:69449907-69449929 AGAGAAAGAGAGAAAGAGGCCGG - Intronic
1151201050 17:72468197-72468219 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1151272854 17:73010264-73010286 ATGAAAAGGGAGAAAGGGTCTGG - Intronic
1151276989 17:73042502-73042524 AGCAATAATCAGAAAGAGGCTGG + Intronic
1151448342 17:74181841-74181863 AGGAGGAGGGAGGCAGAGGCTGG - Intergenic
1152228368 17:79102921-79102943 AGGAAAAGGAGGGAAGAGGCAGG + Intronic
1152243815 17:79175036-79175058 AGGAAGAGGAAGGAAGAGGCAGG - Intronic
1152328804 17:79658469-79658491 AGGAAGAGAGAGAAAGAGAGAGG - Intergenic
1152332597 17:79681736-79681758 AGGAGTGGGGAGAGAGAGGAAGG + Intergenic
1153016093 18:583892-583914 AGGACTGGGCAGAGAGAGGCTGG + Intergenic
1153079995 18:1211305-1211327 TGGAATAATGAGAAACAGGCTGG - Intergenic
1153232542 18:2953156-2953178 TGGAATAGGGAGAAAAAGGCTGG + Intronic
1153294826 18:3535410-3535432 AGAAATAGGGAAAAAGGGCCGGG + Intronic
1153362084 18:4208754-4208776 AGGGAGAGGGAGAAAGAGAGAGG + Intronic
1153591280 18:6676040-6676062 AGGAAAAGTGAGAAAGAGAAAGG - Intergenic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1154439350 18:14373827-14373849 AGGAATAGGGAGAAAGAGGCAGG + Intergenic
1155075722 18:22352569-22352591 AGGAGGAGGTGGAAAGAGGCTGG - Intergenic
1155150819 18:23121524-23121546 AGGCATAGGGAGAAAGTCGGGGG + Intergenic
1155977460 18:32146074-32146096 AGGAAGAGAGAGAGAGAGGAAGG - Intronic
1156030959 18:32711696-32711718 AGGAACAGTGAAAAAGAGTCAGG - Intronic
1156482603 18:37445582-37445604 GGGAGCAGGGAGAGAGAGGCAGG + Intronic
1156601947 18:38618241-38618263 ATGAATAGAGAAAAAGAGCCTGG - Intergenic
1156700342 18:39817502-39817524 AGGAGCAGGGAGAGATAGGCAGG + Intergenic
1157084543 18:44565795-44565817 AGGAAGAGAGGGAAAGAGGAGGG + Intergenic
1157177907 18:45467900-45467922 AGGTATGGGGAGAGAGGGGCTGG + Intronic
1157420998 18:47547416-47547438 AGGTGTAGAGAGACAGAGGCAGG - Intergenic
1157702129 18:49768077-49768099 AGGAAGAGAGAGAAGGAGCCAGG - Intergenic
1157965842 18:52207215-52207237 AGGACAAGGGAGAGAGAGGCAGG + Intergenic
1157995474 18:52549537-52549559 AGGAATAGGTAGAAAAACACTGG - Intronic
1158416941 18:57256965-57256987 AGGGAAAGGGAGCAGGAGGCTGG + Intergenic
1159030022 18:63221438-63221460 AGGAAAAGGGGGATAGAGGAAGG + Intronic
1159228331 18:65570549-65570571 AGGACTAGGGAGAAAGAAGTAGG - Intergenic
1159347802 18:67229062-67229084 AGGTATTGAGAGAAAGAGGATGG - Intergenic
1159457378 18:68677882-68677904 AGGATGAGTGAGAAGGAGGCAGG + Intronic
1160443093 18:78907533-78907555 AGGAATAGTGAGGAAGAGTTGGG + Intergenic
1160448621 18:78946962-78946984 AGGAAAAGGGAGGAAGAGGAGGG + Intergenic
1160448692 18:78947183-78947205 AGGAAGAGGGAAGAAGAGGATGG + Intergenic
1160900178 19:1424079-1424101 AGGAAGAGGGAGGAGGTGGCGGG - Intronic
1160965743 19:1746221-1746243 AGGAGTGGGGAGGAAGAGGGAGG + Intergenic
1161273647 19:3404026-3404048 AGGGATGGGGGGAAAGGGGCAGG - Intronic
1161285261 19:3465101-3465123 AGGAACAGGGAGATAGAGCCAGG - Intronic
1161329094 19:3677972-3677994 AGGAATAGAGGGAAGGAGGATGG + Intronic
1161450300 19:4342200-4342222 AGGATTTGGGTGCAAGAGGCTGG + Intronic
1161500341 19:4611211-4611233 AGAAACAGAGAGATAGAGGCAGG + Intergenic
1161910761 19:7192023-7192045 AGAAAGAGAAAGAAAGAGGCAGG + Intronic
1162012042 19:7823361-7823383 AGGGAAAGAGAGAAAGAGGGAGG + Intergenic
1162297440 19:9823003-9823025 ACGAAGAGGGAAAATGAGGCCGG + Intronic
1162303379 19:9856923-9856945 AGGAACAGGGGGAATGAGGATGG + Intronic
1162806569 19:13140491-13140513 AGGAAAAGGCAGAGAGGGGCAGG - Exonic
1162832133 19:13291913-13291935 AGGAACAGGAAGAGAGATGCTGG - Intronic
1162871199 19:13588041-13588063 AAGAAAAGAAAGAAAGAGGCCGG + Intronic
1162877788 19:13633720-13633742 AGGAAAAGAGAGACAGAGGAAGG - Intergenic
1163061267 19:14763904-14763926 AGGAAGAGGAGGAAAGAGGATGG - Intronic
1163139824 19:15339838-15339860 AAAAAAAGGGAAAAAGAGGCCGG + Intergenic
1163402343 19:17101715-17101737 AGGATGAGTGTGAAAGAGGCAGG + Exonic
1163561102 19:18020199-18020221 AGGCAGAGGGAGACAGAGACAGG - Intergenic
1163602145 19:18255589-18255611 AGGAGCAGGGGGAAAGAGGACGG - Intergenic
1163768944 19:19179181-19179203 GGGACTGGGGAGACAGAGGCTGG + Intronic
1164441497 19:28283417-28283439 AGGAGTGGGGAGAAGGAGGTTGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1164719571 19:30422711-30422733 AGGAAGAGAGAGAAAGAGAAGGG - Intronic
1165100544 19:33436145-33436167 AGGAAGATGGAGGAAGAGGAAGG + Intronic
1165301883 19:34975357-34975379 AGGAAAAGGGAAGAAGATGCAGG - Intergenic
1165393860 19:35553404-35553426 AGGGACAGAGAGACAGAGGCAGG + Intronic
1165416031 19:35694085-35694107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
1165454315 19:35901898-35901920 AGGGAAATGGAGAAAGAGGGAGG - Intronic
1165701684 19:37943003-37943025 AGAGAGAGAGAGAAAGAGGCTGG - Intronic
1165722715 19:38090938-38090960 AGGGCTGGGGAGACAGAGGCTGG - Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166328745 19:42066799-42066821 AGGAAGAGGGAGACAGAGGATGG + Intronic
1166638548 19:44473584-44473606 AGGAATGTGGAGAAATGGGCAGG + Intergenic
1167389506 19:49185012-49185034 AAGAATACAGAGATAGAGGCAGG - Intronic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1167608204 19:50492919-50492941 AGGAGGAGGGAGTAAGAGGAAGG + Intergenic
1167631917 19:50630717-50630739 TGAAATGGGGAGAATGAGGCTGG - Intronic
1167649859 19:50723376-50723398 AGGAACAGGAAGAGAGAAGCTGG + Exonic
1167734668 19:51286294-51286316 AGGGAGAGGGAGAGAGAGTCGGG - Intergenic
1167791928 19:51688601-51688623 AGGAAGGGGGAGAGAGAGACGGG + Intergenic
1168063920 19:53908927-53908949 AGGAAGAGACAGAAAGAGACAGG - Intergenic
1168220716 19:54958271-54958293 AGAAGTAGGGAGAAAGAGGTGGG + Intronic
925207178 2:2016681-2016703 ATCAAGAGGGAGAAAGAAGCTGG + Intronic
925332891 2:3072371-3072393 AGAAAGAGGGAGAGAGAGGCAGG + Intergenic
925793599 2:7519071-7519093 AGAAAGAGGGAGAAAGGAGCGGG + Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
925965692 2:9063112-9063134 AGGAAGAGAGAGAAAGAGGAAGG + Intergenic
925965701 2:9063294-9063316 AGAAAGAGAGAGAAAGAGGAAGG + Intergenic
925968927 2:9093586-9093608 AGAAAGAGAGAGAGAGAGGCAGG + Intergenic
926266833 2:11330853-11330875 AGGAAGAGGGAGGAGGAGGGAGG + Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926668703 2:15553769-15553791 AGGGAGAGAGAGAAAGAGGGAGG - Intronic
926824055 2:16884669-16884691 AGGAAAAGAGAGACAGAGGAAGG - Intergenic
926918512 2:17916342-17916364 AGGAAGAGGGAGAAAGAAGGAGG + Intronic
926979497 2:18552889-18552911 AGCAAAAGGGAGAAAGAAGGAGG + Intergenic
927050766 2:19326023-19326045 AGGAAGAGGGGGAAAGAAGGGGG + Intergenic
927329371 2:21843851-21843873 AGGAATTAAGAGAAAGAGGGTGG - Intergenic
927490546 2:23518393-23518415 GGGATTAGGGAGCAAGAGCCTGG + Intronic
927732917 2:25491177-25491199 AGAGAGAGGGAGGAAGAGGCAGG + Intronic
927761696 2:25762367-25762389 AAGAAGAGTAAGAAAGAGGCTGG + Intronic
927947811 2:27147887-27147909 AGAGAAAGGGAAAAAGAGGCCGG - Intergenic
927957817 2:27220349-27220371 AGATAAAGGAAGAAAGAGGCGGG + Intronic
928084361 2:28336559-28336581 AGGGAGAGGTAGAGAGAGGCAGG + Intronic
928131476 2:28654759-28654781 AAGAAGAGGGAGAAAGCAGCCGG + Intergenic
928320510 2:30279505-30279527 AGTAATAGGGAGGCTGAGGCAGG - Intronic
928478481 2:31655664-31655686 AGGAAGTGGGAGGAAGAGGTGGG + Intergenic
928690029 2:33789687-33789709 GGGTATAGGGAGAAAAGGGCAGG - Intergenic
929019922 2:37542372-37542394 AGGATCAGGGAAATAGAGGCAGG - Intergenic
929144456 2:38694493-38694515 AGGGAGAGAGAGAAAGAGGAAGG + Intronic
929402309 2:41598721-41598743 AGCAATAGGAAGAAAGAGCTTGG + Intergenic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
929828520 2:45329153-45329175 AGGGAAAGGGAGAAAGAAGAGGG + Intergenic
930011121 2:46939596-46939618 AGGACTAGGAAAAAAGAGGCAGG + Intronic
930031321 2:47059673-47059695 AGGAACACTGAAAAAGAGGCTGG + Intronic
930082313 2:47461885-47461907 AAGAAAAGAGAGACAGAGGCTGG - Intronic
930397863 2:50846066-50846088 AGCTATAGGGAGTAAAAGGCAGG + Intronic
930685575 2:54303880-54303902 AGTAATAGGTAGAAAGATTCTGG + Intronic
930722808 2:54654074-54654096 AGGAGTAGGGAGAATGGGACAGG - Intronic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931827093 2:66012330-66012352 TGGAATTGTGGGAAAGAGGCAGG + Intergenic
931940455 2:67246287-67246309 AAGGATAGGGAGAAAGAAGGAGG + Intergenic
932102635 2:68914631-68914653 AGGAATTGGGTGCAAAAGGCTGG + Intergenic
932272711 2:70424856-70424878 AGGAAAATGCAGAAAAAGGCTGG + Intergenic
932461574 2:71885240-71885262 TGGAATACAGAGAAAGAGCCCGG + Intergenic
932842799 2:75099423-75099445 AGGAATAGGAAGAAAATGTCAGG - Intronic
932881071 2:75502615-75502637 AGGAAAAGAGGGAAAGAGGGAGG + Intronic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933231071 2:79808263-79808285 AGGAGAAGGGAGAAGGAGGAAGG + Intronic
933260030 2:80122197-80122219 AGAAATAGGGAGAAACAGGACGG - Intronic
934051411 2:88214401-88214423 AGGAGTGGGGAGAAACAGGCAGG + Intergenic
934525558 2:95049535-95049557 AGGGATGGGGAGAGAGAGACGGG - Intronic
934535339 2:95128700-95128722 AGGAAGAAGGAGAAAGAAGGAGG + Intronic
935033875 2:99348862-99348884 AGGAATAGGAAGAAATATGGGGG + Intronic
935302858 2:101708479-101708501 AGGAATAAGGAAAGTGAGGCAGG + Intronic
935531674 2:104240388-104240410 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
935556371 2:104513727-104513749 GGGAAGAGAGAGAAAGGGGCAGG - Intergenic
935745621 2:106188168-106188190 AGGGATATGGAGAGAGGGGCAGG - Intronic
936172217 2:110186173-110186195 AGAAAGAGGGAGAAAGAGGCTGG - Intronic
936327011 2:111513857-111513879 AGTAATAGGGAAGGAGAGGCCGG - Intergenic
936527984 2:113255111-113255133 AGGAATAGAGGGAAGGAGGAAGG + Intronic
936851796 2:116908255-116908277 AGGAAGGGTGAGAAAGGGGCGGG - Intergenic
937034536 2:118769836-118769858 GGGAAGAGGGGGAAAGAGGGAGG + Intergenic
937161195 2:119763126-119763148 ATGAATGGGGAAAAAGAGGAGGG + Intronic
937217299 2:120321072-120321094 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217303 2:120321085-120321107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217307 2:120321098-120321120 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217316 2:120321127-120321149 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937264231 2:120606009-120606031 AGGGATAGGGAAAGAGAAGCTGG + Intergenic
937685368 2:124690615-124690637 AGGAATAGCAGGAGAGAGGCTGG - Intronic
939103605 2:137924544-137924566 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
939379296 2:141413932-141413954 AGAAAAAGAGAGAAAGAGGCTGG + Intronic
939522156 2:143244987-143245009 AGCAATAGAGAAAAGGAGGCAGG + Intronic
939996860 2:148927889-148927911 AGGGACAGGGAGAGAGAGGAGGG - Intronic
940015077 2:149095746-149095768 AGGGAGAGAGAGAAAGAGGCAGG + Intronic
940058067 2:149534458-149534480 AGAAGGAGGGAGAAAGAGACAGG - Intergenic
940324043 2:152406406-152406428 AGGAAGAGGAGGAAAGAGACTGG + Intronic
941885329 2:170521826-170521848 AGGATTAGGGAGAAAGGGGTTGG - Intronic
942282744 2:174383241-174383263 AGGTAGAAGGAGAAAAAGGCAGG + Intronic
942710780 2:178833197-178833219 AGAAATAGTGAGCAGGAGGCCGG + Exonic
943335329 2:186606586-186606608 AGGAAAAGGGAGAATGTAGCAGG - Intronic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943685225 2:190810969-190810991 AGAAAAAGGGTGAGAGAGGCTGG - Intergenic
944117875 2:196208741-196208763 AGGAATACACAGAAGGAGGCTGG + Intronic
944128949 2:196325156-196325178 AGAAAGAGGGAGAAGGAGGGAGG + Intronic
944853606 2:203744766-203744788 AGAAAGAGAGAGAAATAGGCAGG - Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945606833 2:211943652-211943674 AAGTAGAGGGGGAAAGAGGCAGG - Intronic
946025453 2:216669268-216669290 AGGAATGGGGAATAAGAGGAGGG + Intergenic
946405647 2:219490666-219490688 GGGAGTAGGGAGGAAGAGGTAGG + Intronic
946538590 2:220658633-220658655 AGGAGAAGGGAGAGAGAGGATGG + Intergenic
946608791 2:221435944-221435966 AAAAAAAGGAAGAAAGAGGCAGG + Intronic
947002967 2:225478339-225478361 AGGAAGAGAGAGAGAGAGACTGG - Intronic
947068032 2:226252443-226252465 AGGAAGAGAGAGAGAGAGGAGGG + Intergenic
947091911 2:226521417-226521439 AGCAAAAGGGAGAAAGAGTTGGG + Intergenic
947133546 2:226954612-226954634 AGAAAAAGAGAGAAAGAGACGGG + Intronic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947451070 2:230209481-230209503 AGGATCAGGGAGGAAGGGGCTGG + Intronic
947703709 2:232257365-232257387 AGGACTAGGCAGAGAGAGGACGG - Intronic
947813094 2:233016581-233016603 AGAGAGAGGGAGAGAGAGGCAGG - Intergenic
948091950 2:235302222-235302244 AGGAAGAGGGAGGAGGAGGGAGG - Intergenic
948091959 2:235302248-235302270 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
948563170 2:238867238-238867260 AGAAAGAGGGAGAGGGAGGCAGG + Intronic
948581002 2:238987053-238987075 AGGACGAGGAAGACAGAGGCAGG + Intergenic
1168820689 20:771685-771707 AGGAGAAGAGAGAAAGAGGGAGG + Intergenic
1168968265 20:1913292-1913314 TGGGAATGGGAGAAAGAGGCAGG + Intronic
1169137101 20:3203945-3203967 AGAAATGGGGGGAAAGAGGGAGG + Intronic
1169270408 20:4195006-4195028 AGGACTATGAAGAAACAGGCAGG - Intergenic
1169325604 20:4673111-4673133 AGAAAGAGGGAGAGAGAGGGAGG - Intergenic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169574067 20:6938927-6938949 AGGAAGAGAGGGAAAGAGGAAGG - Intergenic
1169941468 20:10942349-10942371 AGAAAGTGGGAGAAACAGGCAGG - Intergenic
1170215456 20:13886146-13886168 AGGAGTAGGGTGAGAGAGGAGGG + Intronic
1170224546 20:13977352-13977374 AGGAAGAGGGAAAAAGAAGATGG + Intronic
1170311116 20:14993044-14993066 AAGAGAAGGGAGAAAGAGGGAGG - Intronic
1170557788 20:17529432-17529454 AGCAATTGGGAGACAGAGGTGGG - Intronic
1170633934 20:18088593-18088615 AGAGAGAGAGAGAAAGAGGCGGG - Intergenic
1170657011 20:18297178-18297200 AGGATCAGAGAGAAAGAAGCTGG - Intronic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1170912480 20:20587260-20587282 AGGAAAAGGGAGAAAGAGGTGGG + Intronic
1171025167 20:21623732-21623754 AGGAAGGGAGAGAAAGAGGGAGG - Intergenic
1171324025 20:24274991-24275013 GGGAATATGGACAAAAAGGCAGG + Intergenic
1171488422 20:25500060-25500082 GGGAATAGGGAGAGGGGGGCAGG + Intronic
1171850833 20:30306845-30306867 ATGAATGGGGAGGAAGAGGATGG - Intergenic
1172228713 20:33322750-33322772 AGAAATAAAGAGACAGAGGCAGG + Intergenic
1172689867 20:36782982-36783004 GGGGAGAGGGAGAAAGAGCCTGG + Exonic
1172886428 20:38234215-38234237 AGGAATAGGGTGAACAAAGCTGG - Intronic
1172894665 20:38292155-38292177 AGAATGAGGAAGAAAGAGGCAGG - Intronic
1173443150 20:43095763-43095785 AGGAAAAGGGAGGGAGAGGTTGG - Intronic
1173608534 20:44349771-44349793 AGAAAGAGGGAGAAAAAGGCTGG + Intronic
1173761563 20:45565073-45565095 AGGAAGAAAGAGAAAGAGGGAGG + Intronic
1174296914 20:49552494-49552516 AGAAAGAGGGAGAGAGAGACTGG - Intronic
1174501340 20:50987259-50987281 AGGAAGAATGAGAAACAGGCAGG + Intergenic
1175053441 20:56176340-56176362 AAAAAAAGGGAGAGAGAGGCAGG + Intergenic
1175336885 20:58202258-58202280 AGGTAGAGGGAGGCAGAGGCAGG + Intergenic
1175392447 20:58635917-58635939 AGGAAGAGAGAGAGAGAGGGAGG + Intergenic
1175503316 20:59465476-59465498 AGGAGGAGGGAGACAGAGGAAGG - Intergenic
1175610166 20:60344613-60344635 AGGAAGAGAGAGAGAGAGGAAGG - Intergenic
1175924966 20:62467042-62467064 AGCAATGGGGAGACATAGGCAGG - Intronic
1176057099 20:63154715-63154737 AGGAGGAGGGAGGAAGAGGGAGG - Intergenic
1176057116 20:63154767-63154789 AGGAGGAGGGAGGAAGAGGGAGG - Intergenic
1176099905 20:63360218-63360240 AGGAAGAGGGAGGAAGGGGAAGG + Intronic
1176421301 21:6518282-6518304 AGAAAGAGGGAGAGAGTGGCAGG - Intergenic
1176456333 21:6915581-6915603 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1176741076 21:10602820-10602842 AGCAATAGCGAGAGAGAGGGAGG + Intronic
1176834507 21:13780641-13780663 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1176947358 21:14999008-14999030 AGAAAGAGAGAGAGAGAGGCAGG + Intronic
1177160710 21:17545115-17545137 AGGGAGAGGAAGAGAGAGGCAGG + Intronic
1177645778 21:23898641-23898663 AGGAAGAGTGAGGAAGAGGAGGG + Intergenic
1178383886 21:32134141-32134163 AGCACTAGGGAGAAGGTGGCAGG + Intergenic
1178723997 21:35035254-35035276 AGGAAAAGGGAGAAACAGAAAGG + Intronic
1178900195 21:36592393-36592415 AGGAAGAGAGAGAAAGAGGGAGG - Intergenic
1179295790 21:40061210-40061232 AAGATTAGGAAGATAGAGGCAGG - Intronic
1179342198 21:40523146-40523168 AGGAATAGTGATACAGAAGCGGG + Intronic
1179461170 21:41536264-41536286 AGGAACAGCGAGGAAGTGGCAGG + Intergenic
1179538596 21:42068598-42068620 AGGTGCAGGCAGAAAGAGGCAGG - Intronic
1179586157 21:42375365-42375387 AGGAGCAGGGAGAAAGTGGGAGG - Intronic
1179658112 21:42858142-42858164 AGAAAAAGTGAGCAAGAGGCAGG + Intronic
1179696791 21:43126597-43126619 AGAAAGAGGGAGAGAGTGGCAGG - Intergenic
1180738918 22:18039613-18039635 TGAAAGAGGGAGCAAGAGGCTGG + Intergenic
1181361788 22:22343315-22343337 AGGGATGGGGAGATGGAGGCTGG - Intergenic
1181890482 22:26058700-26058722 AGGAAGAAAGAGAGAGAGGCAGG - Intergenic
1181934429 22:26428944-26428966 AGGAACAGAGAGACAGAGGGAGG + Intergenic
1182399659 22:30066072-30066094 AGGGAGAGGGAGACAGAGGGAGG - Intergenic
1182809208 22:33102023-33102045 GGAAATGGAGAGAAAGAGGCAGG - Intergenic
1182995628 22:34809431-34809453 TGGAACATGGAGAAAGTGGCAGG - Intergenic
1183094489 22:35543967-35543989 AGGCAGAGGGTCAAAGAGGCAGG - Intronic
1183536585 22:38405154-38405176 AGGATTAGGGAGAATGAGATGGG - Intergenic
1183709935 22:39497113-39497135 AAGAAAAGGAAAAAAGAGGCCGG - Intergenic
1184050187 22:41998609-41998631 GAGAAAGGGGAGAAAGAGGCGGG - Intergenic
1184257873 22:43297280-43297302 AGGGATTGGGAGGGAGAGGCTGG - Intronic
1184345429 22:43909968-43909990 AGGGAAAGGGAGAAAGAGAGAGG + Intergenic
1184350822 22:43942912-43942934 AGGAAGAGGAAGAAAAAGTCTGG - Intronic
1184370235 22:44077289-44077311 GTGAAGAGGGAGACAGAGGCTGG - Intronic
1184425326 22:44405912-44405934 AGGAATGAGGAGAGAGAGGTTGG - Intergenic
1184550110 22:45199968-45199990 AGGGATGGGGAGAAGAAGGCAGG + Exonic
1184656127 22:45943163-45943185 AGGGAGAGGGAGAAACAGGGGGG - Intronic
1184816787 22:46878297-46878319 AGGAAGAGAGAGAAGGAGGTGGG + Intronic
1184948970 22:47826210-47826232 AGGACGATGGAGAATGAGGCAGG - Intergenic
1185051049 22:48554135-48554157 AAGGATCGGGAGGAAGAGGCTGG + Intronic
1185133610 22:49055813-49055835 AGGAAGAGAGAGAGAGAGGAAGG - Intergenic
1185133612 22:49055833-49055855 AGGAAGAGAGAGAGAGAGGGAGG - Intergenic
949295064 3:2511715-2511737 AGCTGTAGGGAGAAAGAGGGGGG - Intronic
949299509 3:2567449-2567471 AGGCTGAGGGGGAAAGAGGCTGG - Intronic
950136214 3:10582792-10582814 AGTCAGAGGGAGAAAGAGGCAGG + Intronic
950163073 3:10774456-10774478 AGGGCTGGGGAGAAGGAGGCAGG + Intergenic
950181264 3:10915133-10915155 AGGAATGGGGTGCAAGAGCCAGG - Intronic
950358923 3:12436784-12436806 AGAAAGAGGGAGAAAGGAGCAGG - Intergenic
950582079 3:13869099-13869121 AGAAAGAGGGAGAGAGAGGGAGG + Intronic
950685931 3:14618655-14618677 AGCAATGGGCAGGAAGAGGCAGG + Intergenic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951222600 3:20084494-20084516 AGGAATAGGGAGATGGAGATGGG - Intronic
951494431 3:23310635-23310657 AGGACTTGGGAGACTGAGGCAGG + Intronic
951634980 3:24763842-24763864 AGGAAAAGGGAAAAAGAGCTGGG + Intergenic
951641805 3:24844816-24844838 GGGAGCAGGGAGAAAGAGGAGGG - Intergenic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
951930043 3:27955512-27955534 AGGAAGAGGAAGGAAGAGGAAGG - Intergenic
951930075 3:27955643-27955665 AGGAAGAGGAAGGAAGAGGAAGG - Intergenic
952325794 3:32319430-32319452 GGGCATAGGGAGAGAGAGGGAGG - Intronic
952506262 3:34009174-34009196 AGGGAGAGAGAGAAAGAGGGAGG - Intergenic
952881887 3:37990745-37990767 AGGAGTAGGGAGGCAGAGACTGG + Intronic
953006490 3:38984074-38984096 AGGAACAGTGGGAAAGAGGGAGG - Intergenic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
953393724 3:42549737-42549759 GGGCAGAGGTAGAAAGAGGCAGG + Intronic
953660551 3:44888503-44888525 AGGGAGAGGAAGGAAGAGGCCGG - Intronic
953887059 3:46720114-46720136 AGGAAAATGAAGACAGAGGCTGG - Intronic
954367420 3:50154107-50154129 AGGAAAGAGGAGAAAGAGGAGGG + Intergenic
954560102 3:51549463-51549485 AGAAATCGGGAGAAAAAGGCTGG + Intronic
954774697 3:53006279-53006301 CGGAATGGGGAGGAAGAGCCTGG + Intronic
955020065 3:55111248-55111270 AGGTATAAGGAGGCAGAGGCTGG - Intergenic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955080489 3:55653965-55653987 AGGAATGAGGAGGAAGAGGAGGG - Intronic
955228782 3:57081149-57081171 AGGTAAGGGGAGAAAGAGGCTGG + Intergenic
955360713 3:58272096-58272118 AGGGAGAGGGAGAGAGAGGCCGG - Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
955930863 3:64055518-64055540 ATGAATAGGGAGGAAGAGAGAGG - Intergenic
955937970 3:64120828-64120850 AGGAATAGGGAGAGAAAGCACGG + Intronic
956162050 3:66365609-66365631 AGGGTGGGGGAGAAAGAGGCAGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956351091 3:68337281-68337303 AGGAAGAGAGAGAATGGGGCAGG + Intronic
956659066 3:71581968-71581990 AGGAATAGGGAGAAGGGGGTGGG + Intronic
957030256 3:75232410-75232432 AGCAATATGGAGCAAGAGTCTGG + Intergenic
957556539 3:81769289-81769311 AGGAAGAGAGAGAGAGAGGGAGG - Intergenic
958028894 3:88083048-88083070 AAGAAGAGGGAGGAAGAGGGAGG - Intronic
959107968 3:102087631-102087653 GGGACCAGGGAGAATGAGGCGGG - Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959712194 3:109396377-109396399 AAGAATATGGAAATAGAGGCCGG - Intergenic
959842392 3:110993497-110993519 AGAAATAGGGAGAAAGACAGAGG - Intergenic
960130524 3:114051204-114051226 AGGAGTAGGGAGAATGAAACAGG - Intronic
960223873 3:115147454-115147476 GGGAAGAGGAAGAAAGGGGCGGG - Intergenic
960252962 3:115477101-115477123 AGGAAGAGGGAGAAAGAGAGAGG + Intergenic
960325038 3:116285339-116285361 AGAAAAAGGGAGACAGAGTCTGG - Intronic
960357462 3:116671094-116671116 GGGAAGAGGGAGGAGGAGGCAGG + Intronic
960504820 3:118479685-118479707 AGGAAGAGAGAGGAAGAGGGAGG - Intergenic
960614064 3:119580781-119580803 AGGAATTGGCTGAAAGAGGGGGG + Intronic
961059230 3:123814243-123814265 CGGAATAGGGTGAATGTGGCCGG - Intronic
961432716 3:126894429-126894451 AAACATAGGGAGAAAGGGGCAGG + Intronic
961525636 3:127495530-127495552 AATATTAGAGAGAAAGAGGCTGG - Intergenic
961786165 3:129348098-129348120 AGGACCAGGAAGCAAGAGGCGGG + Intergenic
962076018 3:132082319-132082341 AGGGAGAGGGAGAGAGAGGCAGG - Intronic
962360715 3:134740591-134740613 AGGAAAGAAGAGAAAGAGGCGGG - Intronic
962564989 3:136648759-136648781 AAGATTAGAGAGAAAGAGGAAGG - Intronic
962855357 3:139340175-139340197 AGAAAAAGGGACAGAGAGGCAGG + Intronic
962908505 3:139826439-139826461 AGCAATTGGGAGGAAGAGTCGGG + Intergenic
963480973 3:145874337-145874359 GGGGATAGGGAGAAAGGGGAGGG - Intergenic
963506938 3:146198164-146198186 AGGGCTAGGGACAAAGAGGAGGG + Intronic
963534703 3:146513154-146513176 AGGAAGGGGGAGAAGGAGGGAGG - Intergenic
963607040 3:147420778-147420800 ATGACTAGGAAGAAAGTGGCCGG + Intronic
963747904 3:149143756-149143778 AAGAATAGGGAGAAAAAAACTGG + Intronic
963950001 3:151189144-151189166 AGAAAGAGGGAGAAAAAGGTTGG + Intronic
964716526 3:159728361-159728383 AGGAGGATGGAGAATGAGGCAGG + Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
964824400 3:160809348-160809370 AGGAAGAGGGAGGTAAAGGCAGG - Intronic
966314018 3:178625250-178625272 AGGAAAAGGCAGAGAGAGGCAGG + Intronic
966922076 3:184619034-184619056 AGGAAGAGGGAGAAGGAAGGAGG - Intronic
967003949 3:185365835-185365857 GGGGATGGGGAGAAAGAGGTAGG - Intronic
967119341 3:186368963-186368985 AGGAATCGGGAGAATGAGAGAGG + Intergenic
967456502 3:189692673-189692695 AGCAATAGGGGGAAACAGGATGG + Intronic
967981865 3:195070622-195070644 AGGAGAAGGGAGAGAGAAGCAGG + Intronic
968020065 3:195378038-195378060 AGGAATAGTGAAAAAGAAGAGGG + Intronic
968096473 3:195934131-195934153 AGGAGGAGGAAGAAAGAGGAAGG + Intergenic
968355865 3:198106219-198106241 AGGAAGAGGGAGAAAGATGGAGG - Intergenic
968738021 4:2308750-2308772 AAGAAAAGAGAGAAAGAGGGAGG + Intronic
969066016 4:4481948-4481970 AGGAATTGGGGGAAAGTGACAGG - Intronic
969268147 4:6079404-6079426 AGGTAGAGGGAGATGGAGGCAGG + Intronic
970310368 4:14776606-14776628 AGCAATAGGGAAAAGCAGGCAGG + Intergenic
970349781 4:15190661-15190683 AGGGAAAGTGAGAGAGAGGCCGG + Intergenic
970955234 4:21803217-21803239 AGGAAGTGGGAGATAGAGGGAGG - Intronic
970990972 4:22212700-22212722 GGGAAGAGGGAGAAAAAGGTAGG + Intergenic
971972948 4:33643994-33644016 AGCACTAGGTAGAAAGAGCCTGG - Intergenic
971982950 4:33778365-33778387 AGGAAGAGGGAGAAAGACAGAGG + Intergenic
972260045 4:37398451-37398473 AGGAGTGGGGAGAAAGGGGAGGG + Intronic
973177074 4:47220355-47220377 TGGAACAGGGAGAAGGAAGCAGG - Intronic
973276084 4:48310920-48310942 AATAATAGGGAAAAAGAGGCAGG + Intergenic
973721103 4:53724483-53724505 AGAATTTGAGAGAAAGAGGCTGG - Intronic
973779111 4:54271851-54271873 AGGAAAAGGGAGAACAAGGGAGG - Intronic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974434631 4:61840931-61840953 TGGAATAGAGAAAAAGAGGTGGG - Intronic
974940828 4:68465682-68465704 AAGAATAGGGAGGAAGAGAAAGG + Intronic
975042732 4:69763774-69763796 AGGACTAGTGAGCAAGAGGGTGG + Intronic
975259971 4:72286938-72286960 AGGAGTAGAGAAAAAGAGGCTGG + Intronic
975281691 4:72569204-72569226 CGGGAGCGGGAGAAAGAGGCAGG + Intergenic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
975787708 4:77910259-77910281 TGGTATAGGGATAAAGAGCCTGG - Intronic
975870710 4:78776178-78776200 AGGAAGAGAGCGAAAGAGGCTGG - Intergenic
975969413 4:80015768-80015790 AGGACTAGGGAGAAGGAAGGTGG + Intronic
976550789 4:86392778-86392800 AGGGATAAGGAGGAAGTGGCTGG + Intronic
976813837 4:89124378-89124400 AGGAGTGGGGAGAAAGAAGCTGG - Intergenic
976820202 4:89197813-89197835 AGCAAAAGAGAGAAAGGGGCAGG - Intergenic
977211788 4:94226831-94226853 AGGAATAGGGAGTTAGGGTCAGG + Intronic
977257772 4:94758695-94758717 AGGCATAGAGAGAGAGAAGCAGG - Intronic
977638912 4:99332693-99332715 AGCAAAAGGAAGAATGAGGCAGG - Intergenic
977919223 4:102625198-102625220 AGAGAAAGGGAGAAAGAGGAAGG - Intergenic
978133341 4:105226634-105226656 AGGAAGAGGGAGGAAGAGGGAGG - Intronic
978649350 4:110981582-110981604 AGGAAAAGAGAGATAGAGGAGGG - Intergenic
979391430 4:120132613-120132635 AGAACAAGGAAGAAAGAGGCTGG + Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979633195 4:122926291-122926313 AGGTTTAGGAAGAAAGAGGCAGG + Intronic
979857588 4:125652339-125652361 AGGAATAGGGAGATGGAGACAGG - Intergenic
979996919 4:127442427-127442449 AAGAATAGGGAGAACCGGGCAGG + Intergenic
980609018 4:135132411-135132433 AGGAAGAGAGAGAAAGAAGAAGG - Intergenic
980715183 4:136618160-136618182 ATGAATCGGGAGACACAGGCCGG - Intergenic
980801872 4:137762151-137762173 AGAAAAAGGGAGAAAAATGCGGG - Intergenic
980928680 4:139164093-139164115 AGGGAGAGAGAGAAAGAGGGAGG + Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981259254 4:142700034-142700056 AGGGAGAGAGAGAAAGAGGGTGG - Intronic
981367251 4:143917641-143917663 AGCAAGAGGGAGCAAGTGGCTGG - Intergenic
981582624 4:146265393-146265415 AGGTATATGGAGAAAAATGCAGG - Intronic
981709203 4:147692285-147692307 AGAAAAAGGGAGAATTAGGCCGG + Intergenic
981752162 4:148102986-148103008 ACGAATGGAGAGAAAGAGGAGGG - Intronic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
982223195 4:153141997-153142019 TGAAATAGAAAGAAAGAGGCTGG - Intergenic
982510558 4:156276928-156276950 AGGAATAGGGAGACAGTGATAGG + Intergenic
982977638 4:162086304-162086326 AGGAAGAGGGAGAAAGGAGGGGG - Intronic
983140081 4:164139517-164139539 AGAAAGAGGGAGAAAGAGAAAGG + Intronic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983231835 4:165136467-165136489 ATCAGTAGGGAGAAAGAGGTTGG + Intronic
983269647 4:165546313-165546335 AGGAATAAAGAAAGAGAGGCAGG + Intergenic
983528498 4:168785037-168785059 AGCAAAAGGGAGAAAAAAGCTGG - Intronic
983672455 4:170254171-170254193 AGAAAGGAGGAGAAAGAGGCTGG + Intergenic
984233781 4:177131872-177131894 AGGAATATGGAGAAATAAGTGGG + Intergenic
984369489 4:178844068-178844090 AGGACTAGGGAGAAATGGGGAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984811464 4:183798677-183798699 AGGAAGAGACACAAAGAGGCCGG + Intergenic
985025001 4:185731767-185731789 AGGAAGAGAGAGAGACAGGCGGG - Intronic
985039264 4:185872715-185872737 GGGGAGAGGGAGAAAGAGGGAGG + Intronic
985158957 4:187024254-187024276 AGGGAAAGGGAGAGAGATGCAGG - Intergenic
985183172 4:187287451-187287473 AGAAATAGGGAGACAGAGATGGG + Intergenic
985364879 4:189218261-189218283 ATTAATAGGAAGAAAGAAGCAGG + Intergenic
986111961 5:4728225-4728247 GGGAAGATGGAGAAATAGGCTGG + Intergenic
986441573 5:7787176-7787198 AGGAACAGGGAGAGACACGCAGG - Intronic
986576539 5:9219252-9219274 AGGAATAAGAAGAAAGACTCAGG + Intronic
986899698 5:12416297-12416319 AGGAATAGGAAGGAGGAGGCTGG + Intergenic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
987220171 5:15783193-15783215 AGAAATAGTGAGAAAGTGGCAGG + Intronic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987546314 5:19314734-19314756 AGAAAGAGGGAGAGAGAGGAAGG + Intergenic
987581567 5:19800636-19800658 AGGACAAGGGAAAAAGAGGTAGG + Intronic
987723832 5:21671709-21671731 AGAAAAAGAGAGAAAGAGGAAGG - Intergenic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
988440862 5:31231257-31231279 AGCAATAAGGAGAAAAAGACTGG + Intronic
988921437 5:35946274-35946296 TGGAAAAGGAAGAGAGAGGCTGG - Intergenic
988922204 5:35953941-35953963 AGGAAAAGGGAGAAAGGAGGAGG + Exonic
989137073 5:38166551-38166573 AGTAATAGAGACAAAGAGGCAGG + Intergenic
990433647 5:55765050-55765072 AGAAGTAGGGAGAAAGAGACTGG - Intronic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991529012 5:67594988-67595010 AGGAATTAGGAGGAAGAGGCAGG + Intergenic
991954668 5:71982462-71982484 AAGAACAGAGAGAAAGAAGCAGG - Intergenic
992123437 5:73617321-73617343 AGAAATAGGTAGAAAAGGGCCGG - Intergenic
992284655 5:75221708-75221730 AGAAAAAGAGAGAAAGAGGAGGG - Intronic
992364990 5:76082535-76082557 AGGAGGAGGGAGAAAGAGAGAGG - Intergenic
992724304 5:79591115-79591137 AGGAATAGAGAGAAAATGGGCGG - Intergenic
992936355 5:81710802-81710824 AGGAATAGGCAAAAATTGGCAGG + Intronic
993105621 5:83597047-83597069 AGAAATATGGAGAAAGAGTATGG - Intergenic
993202338 5:84831526-84831548 AGGAAGAGGGGGAAAGATGGAGG + Intergenic
994253565 5:97566020-97566042 AGCAAGAGCAAGAAAGAGGCGGG + Intergenic
994315632 5:98329921-98329943 AGAAAAAGAGAGAGAGAGGCAGG + Intergenic
994627186 5:102234900-102234922 AGAAATAGGGCAAGAGAGGCAGG - Exonic
994843844 5:104959595-104959617 AGCAACAGCAAGAAAGAGGCAGG + Intergenic
995688664 5:114799242-114799264 AGGAATAGAGGGAAGGAGGAGGG + Intergenic
995881181 5:116846237-116846259 AGCATTTGGGAGACAGAGGCGGG + Intergenic
995962095 5:117854106-117854128 AAGAAAAGAGAGAGAGAGGCAGG + Intergenic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
996856175 5:128009872-128009894 AGAAATGTGGAGGAAGAGGCTGG - Intergenic
997194940 5:131973110-131973132 AGGAAGAATGAGAAAGAGTCAGG + Intronic
997231462 5:132247166-132247188 AGGAAAGGGGAGAAAGAGATTGG + Intronic
997349709 5:133221771-133221793 AGAAATAAGGAGACAGAGTCGGG - Intronic
998468925 5:142367955-142367977 AGGTACAGGGAGAAATGGGCTGG - Intergenic
998567404 5:143227773-143227795 AGGACTAGAGAGAAAGAGAAAGG + Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999150335 5:149422446-149422468 AGGAGAAGGGAGGAGGAGGCCGG + Intergenic
999403794 5:151288482-151288504 AGGAAGAGGCAGACAGAGGGAGG + Intronic
999547895 5:152651051-152651073 AGGAAAATGGAGAAAGTGGAGGG - Intergenic
999572267 5:152933081-152933103 AGGAAGAGGAAGAAAGGGGGAGG + Intergenic
999773470 5:154792813-154792835 AGGACTTGGGAGAAGGTGGCAGG + Intronic
999790419 5:154934643-154934665 AGGGAGAGGGAGAAGGAGACGGG - Intronic
1000024081 5:157343697-157343719 AGGCATAGCGAAAAAGTGGCAGG + Intronic
1000046786 5:157528397-157528419 AGGAAGAGGCAGACAGAAGCAGG + Intronic
1000155398 5:158546297-158546319 AGGAAGAGAGAGAGAGAGACAGG - Intergenic
1000269870 5:159673683-159673705 AGGAATAGAGAGAGAGAGAGAGG - Intergenic
1000496610 5:161991953-161991975 CTGAATAGGGAGAAATAGTCAGG - Intergenic
1000538841 5:162513279-162513301 AGAAAAAGAGAGAAAGAGACAGG - Intergenic
1001095197 5:168770698-168770720 AGAAACAGGGAGAAGGAGCCAGG - Intronic
1001476900 5:172057136-172057158 AGGAATAGGGGAAACGATGCAGG - Intronic
1001477670 5:172062222-172062244 AGGAATAGGGAGGCCGAGGCGGG - Intronic
1001698855 5:173692172-173692194 ATGAAAAGGGAGGAAGTGGCAGG + Intergenic
1001763802 5:174228928-174228950 AAGGATATGGAGAAAGAGCCAGG + Intronic
1001772820 5:174308767-174308789 GGGAATGGACAGAAAGAGGCAGG + Intergenic
1001776150 5:174330599-174330621 AGAAATAAGAAGAAAGAGGACGG + Intergenic
1001966376 5:175912638-175912660 AGGAATTGTGACAAAGAGGATGG - Intergenic
1002250571 5:177926565-177926587 AGGAATTGTGACAAAGAGGATGG + Intergenic
1002482212 5:179510095-179510117 AGGAAGAGGAAGAAAGAAGAAGG - Intergenic
1002790626 6:435185-435207 AGGAGCAGGGAGAGAGAGCCAGG - Intergenic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002943747 6:1741327-1741349 AGGGATGGGTGGAAAGAGGCTGG - Intronic
1003144274 6:3496483-3496505 AGGAATAGAGAGAGAAAGGCAGG - Intergenic
1003333008 6:5145211-5145233 AGCAAATGGGAGAAAGGGGCAGG - Intronic
1003528715 6:6920072-6920094 AGGAAGCTGAAGAAAGAGGCGGG - Intergenic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1004034979 6:11915068-11915090 AGGAGTTGGGAGAAAGAAGTTGG + Intergenic
1004589126 6:17031750-17031772 AGCAGTAAGGAGAAAGAAGCGGG - Intergenic
1005080107 6:21948143-21948165 AGGAATAGGAAAAAAGAAGTAGG + Intergenic
1005434840 6:25797842-25797864 AAAAATAGGGAGGACGAGGCGGG - Intronic
1005490333 6:26341940-26341962 AGGAAGAGAGAGAAGGAGGGAGG + Intergenic
1005528612 6:26678565-26678587 AGGAGTGGGGAGAAACAGACAGG + Intergenic
1005530656 6:26702053-26702075 AGGAGTGGGGAGAAACAGACAGG + Intergenic
1005540140 6:26799593-26799615 AGGAGTGGGGAGAAACAGACAGG - Intergenic
1005542184 6:26823083-26823105 AGGAGTGGGGAGAAACAGACAGG - Intergenic
1005689280 6:28286647-28286669 AGGAAGATGGAGAGAGAGACAGG - Intronic
1005865827 6:29935250-29935272 AGGAAGAGAGAGAAAGAAGGAGG - Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006886979 6:37390104-37390126 AGGAATAGGCAGGGAGAGGCGGG - Intronic
1006920895 6:37626363-37626385 AGGAAGGGGGAGCAAGAGGCCGG + Intergenic
1007014162 6:38446525-38446547 GGGGAGAGGGAGAAAGGGGCAGG - Intronic
1007074985 6:39060625-39060647 GGGCAGAGGGAGAGAGAGGCTGG - Intronic
1007089406 6:39172803-39172825 AGGAAAGGGGAGAAACAGGTGGG + Intergenic
1007646263 6:43383818-43383840 AGTGATGTGGAGAAAGAGGCAGG + Intergenic
1007811013 6:44485686-44485708 TGGAGTAGGGAGAAAGACGAGGG + Intergenic
1008631236 6:53364369-53364391 AGGAATAGTGGGAAACAGGCTGG + Intergenic
1008863256 6:56176971-56176993 AGGAGCAGGGAGGAAGAGGGAGG + Intronic
1009012986 6:57865130-57865152 AGGAGTGGGGAGAAACAGACAGG - Intergenic
1009248280 6:61267545-61267567 AGGAAAAGGAAAAAGGAGGCAGG + Intergenic
1009812077 6:68681072-68681094 GGGAATAGGCAGAAAGAAGAGGG + Intronic
1010200617 6:73278914-73278936 ATGAAAAGTGACAAAGAGGCAGG - Intronic
1010643239 6:78356307-78356329 AGAAAAGGGGAGAAAGAGGGTGG - Intergenic
1010710049 6:79162974-79162996 AAGAGAAGGGAGACAGAGGCAGG - Intergenic
1010800481 6:80168725-80168747 AGGAAGAGGGGGAGGGAGGCAGG + Intronic
1011103970 6:83758443-83758465 AGGGAGAGAGAGAGAGAGGCTGG + Intergenic
1011152151 6:84286303-84286325 AGGGAGAGAGAGAAAGAGGAAGG - Intergenic
1011529320 6:88302763-88302785 TGGAATTTGGAGACAGAGGCAGG + Intergenic
1012392600 6:98759988-98760010 AAGAAGAGGGAGAAAGATGGAGG - Intergenic
1012411401 6:98962055-98962077 AGACAAAGGGAGAAAAAGGCTGG + Intergenic
1012427514 6:99130751-99130773 AGGAAGAGGGAGAATGAGAGAGG - Intergenic
1012763450 6:103332642-103332664 ATGAATGGGGAGCCAGAGGCGGG - Intergenic
1013036548 6:106390391-106390413 AAGAAAAGGGAGAGAGAGGAGGG - Intergenic
1013192290 6:107813898-107813920 AGACACAGAGAGAAAGAGGCAGG - Intronic
1013215068 6:108019663-108019685 AGCAAGAAAGAGAAAGAGGCAGG + Intergenic
1013656733 6:112254332-112254354 AGAGAGAGGGAGAGAGAGGCTGG - Intronic
1014121797 6:117734407-117734429 AGTAAAATGGAGAAAGAGGCTGG - Intergenic
1014142592 6:117961532-117961554 AGGAATAGGAAGACAGACACAGG - Intronic
1014627917 6:123752155-123752177 GGGACTGGGGAGACAGAGGCAGG - Intergenic
1015189427 6:130457067-130457089 AGGAGGAGGGAGAAAGAGAAAGG - Intergenic
1015245119 6:131066104-131066126 AGGGAGAGAGAGAAAGAGTCTGG - Intergenic
1015286508 6:131491330-131491352 AGAAAGAGGGAGAAAAAGGGAGG + Intergenic
1016126907 6:140414929-140414951 AGGACTGGGGAGAAGGAGGGAGG - Intergenic
1016860164 6:148709815-148709837 AGGAAGAGAGAGAAAGAAACAGG + Intergenic
1017207031 6:151814059-151814081 AGGAACAGGCAGAATGAGCCCGG - Intronic
1017322150 6:153106460-153106482 AAGAAAAGGGATGAAGAGGCTGG + Intronic
1017753097 6:157507123-157507145 GGGATTAGGGAGAAAGAGGAAGG - Intronic
1018092909 6:160360959-160360981 AGGGGTAGGGAGTAAGAGGAGGG + Intronic
1018139731 6:160818578-160818600 AGGAAAAGGGAGGCCGAGGCAGG - Intergenic
1018533429 6:164793289-164793311 AGGCACATGGAGAAAGAGGGAGG + Intergenic
1018773920 6:166997572-166997594 TGGAAGAGGTAGGAAGAGGCTGG - Intergenic
1018815453 6:167327023-167327045 AGGTATTGGGGGAAAGAGGAAGG + Intronic
1019742914 7:2683862-2683884 AAAAAGAGAGAGAAAGAGGCTGG - Intronic
1020340661 7:7106295-7106317 AGGTACAGAGAGAAAGAGTCTGG - Intergenic
1020953693 7:14712424-14712446 AGAAATAGAGAAAATGAGGCGGG + Intronic
1021931074 7:25581860-25581882 AGGAATGGGGAGAAAAAGTTGGG + Intergenic
1022112874 7:27242148-27242170 AGGAGTAAGGAGACAGAGGTGGG + Intergenic
1022157075 7:27671427-27671449 AAGCATAGAAAGAAAGAGGCAGG + Intergenic
1022335425 7:29417253-29417275 AGGAAAAGGAAGAGAGAGGGAGG + Intronic
1022457468 7:30570909-30570931 AGGTACAGAGAGAAAGAGTCTGG - Intergenic
1023032041 7:36098352-36098374 AGGAATAGGAAGATGAAGGCAGG + Intergenic
1023085269 7:36564099-36564121 AGGAAGAGGGAGAGAGAAGTTGG - Intronic
1023362003 7:39426567-39426589 AAGAAGAGGGAGGAAGAGGAGGG - Intronic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1023902161 7:44490305-44490327 AGGAAAAGGAGGAAACAGGCTGG + Intronic
1024307942 7:47943874-47943896 AGGAATGGGGATGATGAGGCAGG - Intronic
1024524745 7:50338500-50338522 AGAAATGGGGAAAAAAAGGCTGG + Intronic
1025007918 7:55369011-55369033 AGACATAGGGAGAAAGAAGATGG + Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025251675 7:57355438-57355460 AGAAAGAGAGAGAAAGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1025945318 7:66100123-66100145 AGGAAGAGGGAGAAACAGCCAGG + Intronic
1025971344 7:66328819-66328841 AGAAAGAGAGAGAGAGAGGCTGG - Intronic
1026361716 7:69607346-69607368 AGGAAGAGAGAGAAAGAAGAAGG - Intronic
1026494151 7:70888188-70888210 AGGAAAAGGGAGAATGAGAGGGG + Intergenic
1026556736 7:71414933-71414955 AGGTATAGGGAGGAAAAGGAGGG - Intronic
1026837648 7:73649100-73649122 AGGGAGAGAGAGAAAGAGGAGGG - Intergenic
1026886156 7:73947648-73947670 AGAAATATTCAGAAAGAGGCTGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027978853 7:85191147-85191169 AGGATTTGGGCCAAAGAGGCTGG - Intergenic
1028210555 7:88069146-88069168 AGGGAGAGGGAGGAAGAGGGAGG - Intronic
1029017450 7:97329060-97329082 AGGAACAGGAAGATAGAGACAGG - Intergenic
1029148631 7:98464675-98464697 AAGCATAGGGAGGCAGAGGCTGG + Intergenic
1029838735 7:103340132-103340154 AGCAAGAGGGAAAAAGAGGCAGG - Intronic
1029843141 7:103387006-103387028 AGGAATTGGAAGACTGAGGCAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030300728 7:107971785-107971807 TGGAATAGAGAAAAAGAGGAAGG + Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031014906 7:116562925-116562947 AGGAAGAGAAAGAAAGAGGAAGG + Intergenic
1031038489 7:116814099-116814121 AGGACTTGGGAGACTGAGGCAGG - Intronic
1031173536 7:118320689-118320711 AGGAACAGGGAGCAAGAGTGTGG - Intergenic
1031346375 7:120671808-120671830 AGGAATATGTAGAATGACGCAGG - Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031711381 7:125050279-125050301 AGGAAGAGAGAGAAAGAGAGAGG + Intergenic
1032435682 7:131898493-131898515 AGGCATATGGAGAAAGAAGGTGG - Intergenic
1032515126 7:132501173-132501195 AGAAATAGGGAGACAGAGAAAGG + Intronic
1032527356 7:132588871-132588893 AAGAAAAGGGGGAAAGAGGTAGG + Intronic
1033118685 7:138648235-138648257 AGGAAGAGGGGCAACGAGGCAGG + Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033561495 7:142536351-142536373 TGTAATAGGGAGAAGGAGGTGGG + Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035105254 7:156436668-156436690 AGGAGCTGGGAGAACGAGGCGGG - Intergenic
1035470556 7:159106471-159106493 AGGAAGGGGCAGAGAGAGGCCGG + Intronic
1035476144 7:159145170-159145192 AGGAGAACGGAGAGAGAGGCTGG - Intergenic
1035580315 8:735894-735916 GGAAGTAGGGAGAGAGAGGCAGG - Intronic
1035702694 8:1648723-1648745 AGGGAGAGGAGGAAAGAGGCCGG - Intronic
1035905935 8:3510293-3510315 GGGAATGGGAAGACAGAGGCAGG - Intronic
1035945518 8:3957129-3957151 AAGTAGGGGGAGAAAGAGGCAGG - Intronic
1036111413 8:5907147-5907169 AGGAATAGAGAGATGGAGGGAGG - Intergenic
1036155381 8:6337429-6337451 AGGTATAGGGAGTCAGAGGAGGG - Intergenic
1036546238 8:9771963-9771985 AGTGAGAGGGAGAAAGAGGTGGG + Intronic
1036761990 8:11515575-11515597 AGGAAGGGGGAAATAGAGGCAGG - Intronic
1036943058 8:13069709-13069731 AGGAACAGAGAGAATGAGGAGGG - Intergenic
1037091694 8:14927533-14927555 AGGAAGAGGAAGAAAGAAGAGGG + Intronic
1037682020 8:21105441-21105463 AATAATATGGAGAAATAGGCTGG - Intergenic
1037745356 8:21639425-21639447 AGGAAGAGGGAGAAACAGGGAGG + Intergenic
1037747171 8:21655113-21655135 AGGTATAGGGAGAAGGATGGTGG - Intergenic
1037782593 8:21880638-21880660 AGAAATAGAAAGAAAGAGGAAGG + Intergenic
1038276822 8:26128203-26128225 AGAAAGAGAGAGAGAGAGGCAGG + Intergenic
1038319261 8:26513319-26513341 AGGAATATAGAGAGAGACGCAGG - Intronic
1038491732 8:27976616-27976638 AGGAATTGGGAGAGTGAGACAGG - Intronic
1038906534 8:31910309-31910331 ATGAAAATGGAGACAGAGGCGGG + Intronic
1038973039 8:32659253-32659275 AGCACTCGGGAGAATGAGGCAGG - Intronic
1039379745 8:37074103-37074125 AGGAAGAGAGAGAAAGGGTCAGG + Intergenic
1039763358 8:40601520-40601542 AGAAAGAGGGAGAAAGGGGAAGG + Intronic
1040691034 8:49938643-49938665 AGGAAGAGAGAGAGAGAGGAAGG - Intronic
1040857727 8:51967446-51967468 AGGAAACTGGAGAAAGAGGAAGG + Intergenic
1040891148 8:52317577-52317599 ACGTATAGGGAGAAACAGTCAGG - Intronic
1041110315 8:54477119-54477141 AGGAACATGATGAAAGAGGCTGG + Intergenic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1041848355 8:62357700-62357722 AGGCAGAGAGAGAAACAGGCAGG - Intronic
1042347190 8:67739687-67739709 AGGATAAGTGAAAAAGAGGCAGG + Intronic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1042927726 8:73983627-73983649 AGTAGAAGGAAGAAAGAGGCTGG + Intergenic
1043055935 8:75438533-75438555 ATGAAGAGAGAGAAAGAGGGAGG - Intronic
1043127766 8:76421323-76421345 AGGATCAGGTAGAAAGAGCCTGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043547808 8:81335065-81335087 AGAAACAGAGAGAAAGAGGGAGG + Intergenic
1043615997 8:82126401-82126423 AGGAGTAGGGAGAATGAGACAGG + Intergenic
1043683743 8:83063931-83063953 AGGAAAAGGGAGAGAGAGAAAGG - Intergenic
1043820128 8:84853177-84853199 AGGGCTAGGAAGAATGAGGCTGG - Intronic
1044199818 8:89421326-89421348 AAGAATAGGGATAATGTGGCCGG + Intergenic
1044489293 8:92793142-92793164 GGGAAGACAGAGAAAGAGGCTGG - Intergenic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1044962539 8:97544905-97544927 AGGAATGGGGTCAAAGAGGAAGG + Intergenic
1044984854 8:97748383-97748405 TGGAATAGGGAGAAAATGGAAGG + Intergenic
1045167980 8:99628456-99628478 AGGAAAAGGGAACAGGAGGCAGG - Intronic
1045347347 8:101305017-101305039 AGGAAGAGGGAGGGTGAGGCAGG + Intergenic
1045690081 8:104751386-104751408 AGGAGTAAGGAGAAAGAAGCAGG + Intronic
1046184474 8:110694624-110694646 AGGAAGAAGGACAAAGAGGAAGG + Intergenic
1047157150 8:122332135-122332157 AGAAAGAGAGAGAAAGAGGGAGG - Intergenic
1047526419 8:125638099-125638121 AGGAGGAGGGAGAAAGAAGGGGG + Intergenic
1047612978 8:126539120-126539142 AGCACTTGGGAGACAGAGGCAGG + Intergenic
1047641837 8:126828788-126828810 AGGAAGAGGGAGAGAGAAGTAGG - Intergenic
1047735395 8:127760823-127760845 AGGAAAAGGTACAAAGAGGCAGG - Intergenic
1047857719 8:128930534-128930556 AGGAAAGGAGAGAAAGAGGGAGG - Intergenic
1048158759 8:131991665-131991687 AGGCATGGAGAGAAAGAGGATGG + Intronic
1048283316 8:133121354-133121376 TGACATAGGGAGAAAGGGGCTGG - Intronic
1048451076 8:134534571-134534593 AGGAAGAGGGAGAGAGAGAAGGG + Intronic
1048591553 8:135825286-135825308 AGGAAGAGAGAGAGAGAGGCAGG - Intergenic
1048807461 8:138253933-138253955 AGGAACAGGAAGCCAGAGGCTGG - Intronic
1049097629 8:140558240-140558262 AGGAAGAGGGAGAGAGAGCCTGG + Intronic
1049141477 8:140959170-140959192 TGGAAAAGGGAGTAAAAGGCTGG + Intronic
1049183474 8:141235635-141235657 CGGAAGAGGGAGAGAGGGGCAGG + Intronic
1049198893 8:141330302-141330324 AGGAAGAGGGAAGGAGAGGCAGG - Intergenic
1049274733 8:141714495-141714517 AGAAATTGGCAGAAAGAGGAAGG + Intergenic
1049448760 8:142647022-142647044 AGGTATAGGCAGAAAAAGCCTGG + Intergenic
1049469260 8:142768203-142768225 AGGAATAGAGAGGAGGAGGGAGG + Intronic
1050080300 9:1908808-1908830 AGGAATAAGGAGACAAAGACAGG + Intergenic
1050204525 9:3182626-3182648 AGGAACTGGGAGAAAGAAGAAGG - Intergenic
1050231653 9:3532276-3532298 AGGGAGAGGGAGAGAGAGGGAGG - Intergenic
1050261263 9:3843019-3843041 AGGCATTGGGAGAGAGAGCCAGG - Intronic
1050328696 9:4523071-4523093 AGGGATGGGGAGGAGGAGGCTGG - Intronic
1050469531 9:5972196-5972218 AGGGATAGGAAGAAAGAATCTGG + Intronic
1050527446 9:6558285-6558307 AAGATTGGGCAGAAAGAGGCAGG + Intronic
1050754714 9:8988006-8988028 AGCAAAAGGGAGAGAGAGGCCGG + Intronic
1050782577 9:9356169-9356191 AGGAATAGGGAGAGTGAATCTGG + Intronic
1051173646 9:14343683-14343705 GGGAAAAGGAAGAAAAAGGCTGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1052206034 9:25841528-25841550 AGGAACAGAGAGAAAAATGCTGG + Intergenic
1052793582 9:32901863-32901885 TGCAATAGGGAGAAAGAGTAGGG + Intergenic
1052840703 9:33289351-33289373 AGGAAAAGGCAGAGAGGGGCAGG - Intergenic
1052864452 9:33456685-33456707 TGGAAGAGAGAGACAGAGGCTGG + Intergenic
1053174993 9:35916147-35916169 AGGAATGCGGAGAAAGAGCAGGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053900157 9:42787729-42787751 AGGTGTAGGGAGAAAGACACTGG - Intergenic
1054764147 9:69029007-69029029 AGGAAGAGGCAGCAAGAGGGCGG - Intergenic
1054916324 9:70498200-70498222 AGAAATAAAGAGAAAAAGGCAGG + Intergenic
1055212762 9:73817170-73817192 AGGAAAAAGGAGAAAAAGGCGGG + Intergenic
1055272450 9:74576450-74576472 AGGCTTAGGGAGAAAGAGAAGGG + Intronic
1055500696 9:76899870-76899892 AGGAAAAGCCAGAAAGAAGCTGG + Intronic
1055528689 9:77161125-77161147 AGGAAGAGGAAGAAAAAGGGGGG + Intergenic
1055784333 9:79856322-79856344 GGGAGTGGGGAGAAAGAGGGAGG - Intergenic
1055809041 9:80130275-80130297 AGGAATTGGGAGGCTGAGGCAGG + Intergenic
1055844197 9:80541405-80541427 AGGAAGAGGGGGAAAGAGAGGGG + Intergenic
1056040512 9:82660682-82660704 AGGAAGAGGGAGAGAGAAGGAGG + Intergenic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056545112 9:87606663-87606685 AGGGACAGGGAGAGAGAGGGAGG - Intronic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1056820730 9:89840168-89840190 AGGAAAAGGGACTAGGAGGCAGG + Intergenic
1057787318 9:98096705-98096727 GGGGATGGGGAGAAACAGGCAGG - Intronic
1057855098 9:98595560-98595582 AAGAATAGGGAGGAATGGGCTGG - Intronic
1058212249 9:102183762-102183784 AGGAATAAATAGAAAGAGGAGGG - Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1058485490 9:105439737-105439759 AGGAAAAGGGAAAAAGTGGGTGG - Intergenic
1059354261 9:113687179-113687201 AGGAGGAGGAAGAAAGAGGAAGG + Intergenic
1059965447 9:119609371-119609393 AGGAAGAGAGGGAAAGAGGGGGG + Intergenic
1060400466 9:123345959-123345981 AGGAAGAGAGGGAGAGAGGCAGG + Intergenic
1060601577 9:124881690-124881712 AGGAAAAGAGAGAAAGGGGCTGG + Intronic
1060679926 9:125553293-125553315 AGGATTTGGGAGGTAGAGGCAGG + Intronic
1061057459 9:128232171-128232193 AGGAGCAGGGAGAAGGAGGGAGG - Intronic
1061262986 9:129490162-129490184 GGGAGTAGGGAGGGAGAGGCAGG - Intergenic
1061337814 9:129953376-129953398 AGGACTAGGGAGGCTGAGGCAGG + Intronic
1061634824 9:131900922-131900944 AGGGAGAGGGAGAGAGAGGGAGG + Intronic
1061637119 9:131919102-131919124 GGGAGTAGGGAGAAGGAGGATGG + Intronic
1061698389 9:132395549-132395571 AGGATTGGGGAAAAACAGGCAGG + Intronic
1061744004 9:132726562-132726584 AGGAAAAAGGAACAAGAGGCCGG - Intronic
1061883270 9:133578515-133578537 AAAAATGGAGAGAAAGAGGCTGG + Exonic
1061892243 9:133629059-133629081 AGACAAAGGCAGAAAGAGGCAGG - Intergenic
1061916175 9:133755642-133755664 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1061996661 9:134189658-134189680 AGGAAGAGGGAGAGAGAGGGAGG + Intergenic
1062275228 9:135727332-135727354 GGAAAGAGGGAGAAAGAGGGAGG - Intronic
1062592997 9:137282495-137282517 AGGAATAAATAAAAAGAGGCCGG - Exonic
1062596165 9:137300761-137300783 AGGGAGAGGGAGAAGGAGGGAGG + Exonic
1062638417 9:137503611-137503633 AGGAGGAGGGAGAAGGAGGAGGG + Intronic
1203626652 Un_KI270750v1:32040-32062 CGGGATGGGGAAAAAGAGGCTGG - Intergenic
1185495508 X:551605-551627 AGGGAAAGGGAGAGAGAGACAGG - Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185617549 X:1432531-1432553 AAGAAAAGGGAGAAAGGGGCCGG + Intronic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185662002 X:1735487-1735509 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185683732 X:1910027-1910049 AGGCAGAGAGAGAAAGAGACAGG - Intergenic
1185683825 X:1910685-1910707 AGGAAGAGGGAGGAAGAGAGAGG - Intergenic
1185683951 X:1911525-1911547 AGGAAGAGGGAGAGAGAGAGAGG - Intergenic
1185707216 X:2276829-2276851 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707235 X:2276915-2276937 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707253 X:2277005-2277027 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707273 X:2277093-2277115 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707290 X:2277182-2277204 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707308 X:2277271-2277293 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707326 X:2277362-2277384 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707345 X:2277450-2277472 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707363 X:2277541-2277563 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707382 X:2277630-2277652 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707401 X:2277719-2277741 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707440 X:2277897-2277919 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707636 X:2278785-2278807 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707655 X:2278874-2278896 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707674 X:2278963-2278985 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707713 X:2279141-2279163 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707732 X:2279230-2279252 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707808 X:2279580-2279602 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707963 X:2280284-2280306 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707982 X:2280373-2280395 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708001 X:2280462-2280484 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708040 X:2280640-2280662 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708059 X:2280729-2280751 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708135 X:2281079-2281101 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708191 X:2281340-2281362 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708405 X:2282310-2282332 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185815750 X:3153715-3153737 AGCAAGAGGGAGAGAGAGGCAGG + Intergenic
1185835916 X:3345997-3346019 AAGAGTAGGAGGAAAGAGGCGGG + Intronic
1186156567 X:6732538-6732560 AGAAAGAGAGAGAAAGAGGGAGG + Intergenic
1186463474 X:9766061-9766083 AGGAAGAGGGAGGAGGAGGAGGG + Intronic
1186544149 X:10431636-10431658 AGGCAGAGAGAGAAAGAGGAGGG - Intergenic
1186615567 X:11183623-11183645 AGGAAAAAGGAGACAGAGGGAGG - Intronic
1187277440 X:17828321-17828343 AGGAATCAGGAGAGAGAGGGAGG - Intronic
1187557674 X:20367532-20367554 AGGAGTAGAGAGAGAGAGACAGG - Intergenic
1187896349 X:23983199-23983221 AGTGGTGGGGAGAAAGAGGCTGG + Intergenic
1188079136 X:25815171-25815193 AGGAAGAGGGAGGAAGAGGGAGG - Intergenic
1188079139 X:25815181-25815203 AGGGAGAGGGAGGAAGAGGGAGG - Intergenic
1188170931 X:26925205-26925227 AGCAAAACAGAGAAAGAGGCTGG + Intergenic
1188480026 X:30628045-30628067 AGGAGAAGAGAGAAAGAGGTAGG + Intergenic
1188760254 X:34019060-34019082 AGGAACAGAGAGAAAGGGGTTGG - Intergenic
1188772931 X:34176378-34176400 AGGAAAAGAGAGAAAGAGAATGG + Intergenic
1188963863 X:36526813-36526835 AGGAAGAGAGAGAGAGAGGGAGG + Intergenic
1189000408 X:36938016-36938038 AGTACTAGGGAGAATGAGGTGGG + Intergenic
1189066242 X:37812356-37812378 AGGAAGAAGGAGAAAGAGCTGGG + Exonic
1189502227 X:41573186-41573208 AGAAATTGGGAGACAGAGGTAGG - Intronic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190393097 X:49952175-49952197 AGAAAGGGGCAGAAAGAGGCTGG + Intronic
1190417987 X:50199832-50199854 GGGAAGAGGGAGAAAGGGGAGGG - Intronic
1190443755 X:50502340-50502362 ATCAATAAGGAGAAAGTGGCTGG + Intergenic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1190920876 X:54851541-54851563 AAAAAAAGAGAGAAAGAGGCCGG + Intergenic
1191915570 X:66198159-66198181 AGGGAAAGGGAGAGAGAGGGAGG - Intronic
1192002362 X:67167178-67167200 AGGATTGGGGAGAATGAGGGAGG + Intergenic
1192100009 X:68254483-68254505 AGAAATAGGAAGAAAGAGGATGG - Intronic
1192201279 X:69068258-69068280 AGAAAGAGGGAGATAGAGACTGG + Intergenic
1192845768 X:74905971-74905993 AGAAATAGGAAAAAAAAGGCTGG + Intronic
1193012635 X:76694583-76694605 AGGAATAGAGAGAGAGATGGAGG - Intergenic
1193022501 X:76805395-76805417 AGAAATAAGGAGAAAAAGGCAGG - Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193568349 X:83108426-83108448 AGAAAAAGGGAGAAAGAGAAGGG - Intergenic
1193667118 X:84334441-84334463 AGGAAAAGGGAGAAAGAGAAAGG + Intronic
1193940556 X:87676753-87676775 AGGAAAAAGGAGAAAAAGGGGGG + Intergenic
1195121333 X:101755981-101756003 AGAAAGAGAGAGAAAGAGGAAGG - Intergenic
1195244391 X:102982521-102982543 AGGAGTAGTGAGAAAGAAGGTGG + Intergenic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195435290 X:104836880-104836902 AGGGATAGGGGGTAAGAGGATGG - Intronic
1195747822 X:108136359-108136381 AAGGAAAGGGAGAAATAGGCAGG + Intronic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1196738348 X:119000860-119000882 AGAAATAGGGAGAGAGAGGGAGG - Intronic
1196835171 X:119807327-119807349 AAGAATAGAGAGAAAGGGGGTGG - Intergenic
1197432047 X:126378021-126378043 GGGAATAGGCAGAATGAGCCTGG + Intergenic
1197597760 X:128487474-128487496 AGGTTAAGTGAGAAAGAGGCAGG + Intergenic
1197767156 X:130066761-130066783 TTGAATGGGGAGAAAGGGGCTGG + Exonic
1197816406 X:130503087-130503109 AGCAAAAGAGAGAAAGAGGGAGG - Intergenic
1197887999 X:131238209-131238231 AGGAATAGGAATAAAGGGGAGGG - Intergenic
1197922045 X:131605356-131605378 GGGAATAGGGGGAAAGGGGAGGG - Intergenic
1197927328 X:131660590-131660612 AGGAATAGAGAGGAAGAGAGAGG - Intergenic
1197952198 X:131909572-131909594 AGGAAGAGGAAGAGAGAGGGAGG + Intergenic
1198167377 X:134071058-134071080 AGGAAAAGGAACACAGAGGCAGG - Intergenic
1198217972 X:134574194-134574216 AGGAATGGGGAGAAATAGTAGGG - Intronic
1198531764 X:137555079-137555101 AGGAGGAGAGAGAAAGAGGGAGG + Intergenic
1198605891 X:138336761-138336783 AGTAAGAGTGAGAAAGAGACAGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1200130447 X:153840746-153840768 AGGATAAAGGAGAAAGACGCTGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201341153 Y:12935712-12935734 AGAAAAAGAGAGAAAGAGGGAGG - Intergenic
1201461697 Y:14232775-14232797 AGGAAGAGGAAGAAAGAGGGAGG - Intergenic
1201618960 Y:15933710-15933732 AGGAATAGTACGAAAAAGGCTGG - Intergenic
1202599335 Y:26576682-26576704 AGCAATAGTGAGAGAGAGGGAGG + Intergenic