ID: 1105251687

View in Genome Browser
Species Human (GRCh38)
Location 13:18704421-18704443
Sequence GGATCTCTCCTGAAAACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105251687_1105251692 11 Left 1105251687 13:18704421-18704443 CCACCAGTTTTCAGGAGAGATCC 0: 2
1: 0
2: 0
3: 9
4: 147
Right 1105251692 13:18704455-18704477 AATTAAGCTAAACACGGCAAGGG 0: 2
1: 1
2: 1
3: 5
4: 102
1105251687_1105251690 5 Left 1105251687 13:18704421-18704443 CCACCAGTTTTCAGGAGAGATCC 0: 2
1: 0
2: 0
3: 9
4: 147
Right 1105251690 13:18704449-18704471 AGTTTCAATTAAGCTAAACACGG 0: 3
1: 0
2: 0
3: 18
4: 179
1105251687_1105251691 10 Left 1105251687 13:18704421-18704443 CCACCAGTTTTCAGGAGAGATCC 0: 2
1: 0
2: 0
3: 9
4: 147
Right 1105251691 13:18704454-18704476 CAATTAAGCTAAACACGGCAAGG 0: 2
1: 1
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105251687 Original CRISPR GGATCTCTCCTGAAAACTGG TGG (reversed) Intergenic
905195374 1:36272242-36272264 GGTACTCTCCTAAAAAGTGGGGG - Intronic
906657331 1:47558164-47558186 GAATCTCACCTGGAAAATGGGGG - Intergenic
907440606 1:54475910-54475932 GGGCCTCCCCTGAGAACTGGGGG - Intergenic
907767519 1:57424815-57424837 GGGTCTCTCCTGAGGACTGACGG - Intronic
910722122 1:90298039-90298061 ATAGCTCTCCTGAAAACTGGTGG + Intergenic
912318863 1:108692129-108692151 GGATTTCTCCTGAGAATTTGGGG - Intergenic
919192578 1:194242758-194242780 GGATCTCTACTGAAAAGGGCTGG - Intergenic
919744534 1:201000286-201000308 GGTTCCCTCCTAAACACTGGTGG + Intronic
919776796 1:201199484-201199506 GGGGCTCTCTTGAAGACTGGTGG - Intronic
921948537 1:220905958-220905980 TGATCTTTCCTTGAAACTGGAGG - Intergenic
922810902 1:228415039-228415061 GGAACTCGCCAGAAAACTGCAGG - Exonic
923153204 1:231253271-231253293 ACATCTCTACTAAAAACTGGAGG - Intronic
923410291 1:233701385-233701407 GGTTTTCACCTGAAAACTGAGGG - Intergenic
923685103 1:236148216-236148238 GCCTCTATCCTGAAACCTGGAGG - Intronic
923735007 1:236598092-236598114 TAATCTCTCCTTATAACTGGTGG + Intronic
1063655861 10:7987873-7987895 AGATCTCTTCTGAAATCTGTAGG + Intronic
1065836425 10:29662250-29662272 GAAGCTCTCCTGGAAACTGGGGG - Intronic
1067676874 10:48388604-48388626 GGTTATCTTCTTAAAACTGGGGG - Intronic
1069232394 10:66027954-66027976 GAATCTGTCCTTTAAACTGGAGG - Intronic
1070669296 10:78366924-78366946 TGATCTCTCCAGAAAAATAGTGG + Intergenic
1072628131 10:97127497-97127519 GGATCTCTCCTGAACAGTGCCGG + Intronic
1074237864 10:111604106-111604128 TGCACTCTCCTGAAAGCTGGGGG - Intergenic
1074768670 10:116719149-116719171 TGATCCCTCCTGATAACTTGGGG + Intronic
1080700714 11:34641708-34641730 GGATCTGTTCTGAAAGGTGGAGG + Intronic
1081170468 11:39863665-39863687 GTGGCTCTCCTGACAACTGGAGG - Intergenic
1081199383 11:40198321-40198343 GGATCTCAGCTGAAAATAGGTGG - Intronic
1082216668 11:49578955-49578977 TGTTCTCTCCTGAATCCTGGTGG - Intergenic
1084962651 11:72725438-72725460 GGGTCTCTCCAGGAACCTGGAGG - Intronic
1086632889 11:89045132-89045154 TGTTCTCTCCTGAATCCTGGTGG + Intronic
1088440874 11:109868494-109868516 TGCTCTATTCTGAAAACTGGTGG - Intergenic
1089341849 11:117763447-117763469 GGATGTTTCCAGAAAAGTGGAGG - Intronic
1091397072 12:160534-160556 GGGACTCTGCTGAATACTGGGGG - Intronic
1092243334 12:6849110-6849132 GGACGACTTCTGAAAACTGGAGG - Exonic
1093917471 12:24821683-24821705 GGCTCTGTGCTGAACACTGGAGG + Intronic
1094425666 12:30314745-30314767 GGCTCTCTCCTGGATCCTGGTGG + Intergenic
1096025741 12:48359548-48359570 GGAGCTCTCCTCAAGACTGAGGG - Intergenic
1096117464 12:49063544-49063566 AGACCTCTTCTGACAACTGGGGG - Intergenic
1096396351 12:51269706-51269728 GGCCCTCTCCTGACACCTGGTGG - Intronic
1096693124 12:53333195-53333217 TGTTCTCTCCTGAGAACTTGGGG + Intronic
1099142304 12:78994325-78994347 GATTCTCTCCTCAAAACTGAAGG - Intronic
1102533438 12:113563864-113563886 GGATTTCTTCTGCAAAATGGGGG + Intergenic
1103861368 12:124017138-124017160 GGATTTCTTATGGAAACTGGTGG + Intronic
1104808635 12:131605971-131605993 GCTTCTGTCCTGAAACCTGGGGG - Intergenic
1105251687 13:18704421-18704443 GGATCTCTCCTGAAAACTGGTGG - Intergenic
1105959215 13:25314016-25314038 GAATCTCTCTTGAACCCTGGAGG - Intronic
1106286179 13:28319885-28319907 GAAGATATCCTGAAAACTGGTGG + Intronic
1110120564 13:71875179-71875201 AGCCTTCTCCTGAAAACTGGAGG - Intergenic
1111050778 13:82881414-82881436 GGATTTCTCATGAAATCTGACGG + Intergenic
1120943027 14:89967409-89967431 GGAACTCACCTGAACTCTGGTGG - Exonic
1121678777 14:95775673-95775695 AGCTCTCTCCTGACAGCTGGGGG - Intergenic
1122663009 14:103310436-103310458 TGATCACTCTTGAAAACTGCTGG + Intergenic
1126272946 15:46844025-46844047 GGAGCTCTCCTGAGATCTGATGG - Intergenic
1126662801 15:51048824-51048846 GGATTACTCCTGGAACCTGGAGG - Intergenic
1126949100 15:53859985-53860007 GGATTTCTTATCAAAACTGGGGG - Intergenic
1129659117 15:77543231-77543253 GGCTCATTCCTGAAACCTGGAGG - Intergenic
1131703605 15:94968375-94968397 CCATCTGTCCTGAAAACTGCAGG + Intergenic
1133902273 16:9988230-9988252 GTGTCTCTCCTGAACACTGAAGG + Intronic
1134327454 16:13219988-13220010 GCATCTCACCTGAAAATTGGGGG + Intronic
1138728343 16:59165639-59165661 GGATCCCACCTGAAAACATGTGG - Intergenic
1139645167 16:68324182-68324204 GGATCTCTCCTCAATGCTTGTGG - Intronic
1139743429 16:69055095-69055117 GCCTGTCTCCTGAAAGCTGGTGG - Intronic
1140363601 16:74364923-74364945 AGATATCTCCTCAAATCTGGGGG - Intergenic
1141507322 16:84486409-84486431 TGTCCTCGCCTGAAAACTGGGGG + Intronic
1152935416 17:83133921-83133943 GCATCTCTCCTGAAGACAGAAGG + Intergenic
1154036985 18:10812824-10812846 GGAGCACACCTGAAAACAGGTGG - Intronic
1154942606 18:21129802-21129824 GGCTCTTTACTGTAAACTGGTGG + Intergenic
1156388101 18:36625112-36625134 GAATCTCTCCTGAAGCCTAGTGG - Intronic
1157387784 18:47273861-47273883 GGGTCTCTTCTGAAATCTGAAGG - Intergenic
1160239661 18:77113962-77113984 GGCTGGCTCCTGAAAACTGCCGG - Intronic
1160680133 19:408577-408599 GGATCTCTCCGGAAAAAGGTGGG - Intronic
1164750980 19:30654432-30654454 CAGTCTCTCCTGGAAACTGGTGG + Intronic
1166379715 19:42349594-42349616 GGATCTCTACTGCATACTTGTGG - Exonic
1167208073 19:48115864-48115886 GGACCTCACCTGAGCACTGGTGG + Exonic
927354310 2:22156095-22156117 GTATCTCTCCTAGAAACTGGTGG - Intergenic
929959270 2:46484237-46484259 GGAGGCCTCCTGAAAACTGTGGG - Exonic
932202050 2:69838074-69838096 AGTTCTCTCCTGAAAAATGCAGG + Intronic
932893491 2:75616050-75616072 GGATCTCTCAGGAGAGCTGGTGG - Intergenic
933203692 2:79480168-79480190 GGAACTCTCTTGAGAACTGATGG + Intronic
933860748 2:86464790-86464812 GGATCTCTTCTGGGAAGTGGTGG + Intronic
938660001 2:133476564-133476586 GCTTCTCTCCTGAAAAGTGAAGG - Intronic
939462788 2:142518387-142518409 GGATGTCTTCTGAAGGCTGGTGG - Intergenic
943314262 2:186366578-186366600 GGATCTCTTCTAATAACTAGTGG - Intergenic
1173360026 20:42335116-42335138 GAATCTCTCTTGAAATCTGTGGG - Intronic
1174448258 20:50604651-50604673 GTATCTCTCCCGGAAGCTGGGGG + Exonic
1174463744 20:50701256-50701278 GAATCTGCCCTGAAATCTGGGGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175919193 20:62442080-62442102 GGATGCCTCCTGAACACTGACGG + Intergenic
1176837211 21:13804307-13804329 GGATCTCTCCTGAAAACTGGTGG - Intergenic
1184379881 22:44138571-44138593 GGATGTCTGCTGAAAACCAGCGG + Intronic
949762583 3:7487715-7487737 GGATGTATCCGGAAGACTGGGGG + Intronic
950837519 3:15935242-15935264 AGTTCTCTCATGAAAACTGAGGG - Intergenic
953508728 3:43513081-43513103 AGACCTCTACTGAAAACTTGAGG - Intronic
953616564 3:44495997-44496019 GGCTCTTCCCTGAAATCTGGGGG + Intergenic
954289665 3:49642913-49642935 GGAGCCCTGCCGAAAACTGGGGG + Exonic
955008111 3:54988589-54988611 GGATCTCTCAGGGAAGCTGGAGG - Intronic
955400538 3:58588090-58588112 CGACCTCACCTGTAAACTGGAGG - Intronic
955409008 3:58643861-58643883 TGTTTTCTCCTGAAAACTAGTGG + Intronic
962009935 3:131382516-131382538 GGATCTCTCCTGGTAAAGGGTGG - Exonic
969869096 4:10093692-10093714 GGCTGACTCCTGAAAACTGGGGG - Intronic
972146804 4:36038031-36038053 GGATGTCTCCTGCTAAATGGTGG - Intronic
972164532 4:36266493-36266515 TGATCACTCCTTAAAACTGCAGG + Intergenic
975928472 4:79489170-79489192 GTATTTCCCCTGAGAACTGGAGG - Intergenic
977831468 4:101599054-101599076 GGCTGTCCCCTGCAAACTGGGGG + Intronic
980753278 4:137120794-137120816 GGATCTTCCCTGAAAAACGGTGG + Intergenic
984328167 4:178280262-178280284 GGGGCTCTCCTGAGAACTGTTGG + Intergenic
986064123 5:4219399-4219421 GCAGCCCTGCTGAAAACTGGAGG - Intergenic
986894232 5:12346426-12346448 GGATTTCTCATGAAATTTGGTGG + Intergenic
987916288 5:24218843-24218865 GGATTTCTCATGAGATCTGGTGG + Intergenic
991413425 5:66367508-66367530 GGATTTCTCCTGGGAATTGGTGG + Intergenic
994204206 5:97015074-97015096 GGATCTGGCCTCAAGACTGGTGG + Exonic
994365971 5:98917934-98917956 GAATCTCTCCCTAAAACTAGTGG + Intronic
998415576 5:141944028-141944050 GGGTCTCTCCTGGACACTGCAGG - Exonic
999935388 5:156480555-156480577 GGATCTTTCCTTGACACTGGTGG + Intronic
1001736626 5:174009228-174009250 GTATCTCTCCAGGACACTGGAGG - Intergenic
1003276955 6:4661375-4661397 GGTTCTCTCCTGATAGCTGATGG - Intergenic
1005842082 6:29750194-29750216 GGATGTCACCAGAAAAATGGGGG - Intergenic
1005953751 6:30649389-30649411 CCATCTCTACTGAAAACAGGAGG - Intronic
1007206844 6:40159564-40159586 ACTTCTCTCCTGAAAACTGGAGG - Intergenic
1007504358 6:42323498-42323520 GTATCCCTAATGAAAACTGGGGG - Intronic
1009673806 6:66790061-66790083 AAATCTTTCCTGAAAACTGAGGG + Intergenic
1015141328 6:129936616-129936638 TTATCTCTCCTGTAAAATGGAGG + Intergenic
1021789832 7:24193832-24193854 GTATCTCTCCTCAAATCTGAAGG - Intergenic
1022681530 7:32551866-32551888 GGATCTCTCTTGGATTCTGGTGG + Intronic
1023091176 7:36618878-36618900 GGAGCTGTCTTGCAAACTGGAGG - Intronic
1026925761 7:74192083-74192105 GGATCTCTCATCAAATCTGTTGG - Intronic
1030320093 7:108157560-108157582 GGATCTGTTCTAAAAAATGGAGG - Intronic
1032322837 7:130900253-130900275 GGGTCTCTCCTGAATACCTGGGG + Intergenic
1032328549 7:130955494-130955516 AGATGTCTGCTGAAAAATGGTGG - Intergenic
1033038141 7:137894283-137894305 GGATCTGTCCTGGCACCTGGGGG + Intronic
1035264185 7:157681509-157681531 GACCCTCTCCAGAAAACTGGAGG + Intronic
1035826843 8:2654008-2654030 GGTTTTCTCCTGAAAACTGTGGG - Intergenic
1036530567 8:9582521-9582543 TGATGTCTCCTGTAAGCTGGTGG - Intronic
1038480834 8:27900981-27901003 GTCTCTGTTCTGAAAACTGGTGG + Intronic
1041318004 8:56583910-56583932 TGATCTTGCCTGACAACTGGAGG - Intergenic
1041844571 8:62312976-62312998 TATTCTCTCCTGAAAACTGTAGG - Intronic
1043255277 8:78128573-78128595 GCATGTCTCATGAAAAATGGTGG - Intergenic
1046013447 8:108577540-108577562 AGATCTCTCCAGAAATGTGGAGG - Intergenic
1046263375 8:111800126-111800148 GGATGTCTCCTCAAAACTTGAGG + Intergenic
1047431643 8:124798305-124798327 GGATGTCTCCTGATGACTGAGGG + Intergenic
1048029300 8:130615858-130615880 GGATGTTTCCTGAACACTCGGGG - Intergenic
1051203121 9:14652599-14652621 AGAGCTCTCCTGAAAACAGAAGG + Intronic
1056716512 9:89035438-89035460 GGAACTCTCCTAACATCTGGTGG - Intronic
1056815273 9:89796595-89796617 TGAACTCTCCAGAAAACTTGGGG - Intergenic
1056904247 9:90631745-90631767 GGACCTCTCCCTAAAACTGCCGG + Intronic
1057572329 9:96214123-96214145 GGATCTCTGTTTAAAACTGTGGG + Intergenic
1059216688 9:112571081-112571103 AGATCTCGCCTGAATATTGGCGG - Intronic
1059997849 9:119930542-119930564 GGATCCCTCCTGTAATTTGGGGG + Intergenic
1060743287 9:126113505-126113527 GGAGCTCTCTTGGGAACTGGGGG + Intergenic
1062421815 9:136486248-136486270 GGCTCTTTGCTGACAACTGGCGG + Intergenic
1187851111 X:23592678-23592700 AGATCTCTCATGAGATCTGGTGG - Intergenic
1189757429 X:44285225-44285247 GGAGCTCACTGGAAAACTGGTGG - Intronic
1191184492 X:57594102-57594124 GGAGCTCTGCTGAAAACCAGTGG - Exonic
1191212897 X:57908357-57908379 GGAGCTCTGCTGAAAACCAGTGG + Exonic
1193180987 X:78456391-78456413 GGTTCTGTCCAGAAAAGTGGTGG + Intergenic
1197203745 X:123772137-123772159 GTATCTCTCTTAAAACCTGGGGG - Intergenic
1197448223 X:126579204-126579226 AGTTCTCTCCTTTAAACTGGAGG + Intergenic
1198224101 X:134629817-134629839 GGAATTCACCTGCAAACTGGAGG + Intronic
1199823065 X:151470539-151470561 GGAGTTCTCATGAAAGCTGGTGG - Intergenic