ID: 1105252728

View in Genome Browser
Species Human (GRCh38)
Location 13:18715139-18715161
Sequence TCTTCCAGGCTGAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 2, 1: 1, 2: 0, 3: 19, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105252720_1105252728 20 Left 1105252720 13:18715096-18715118 CCCGTTACGAAGCTGATTTATCA 0: 1
1: 0
2: 1
3: 3
4: 80
Right 1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG 0: 2
1: 1
2: 0
3: 19
4: 247
1105252721_1105252728 19 Left 1105252721 13:18715097-18715119 CCGTTACGAAGCTGATTTATCAC 0: 1
1: 1
2: 0
3: 4
4: 81
Right 1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG 0: 2
1: 1
2: 0
3: 19
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105252728 Original CRISPR TCTTCCAGGCTGAAAGTGGG AGG Intergenic
900110642 1:1004075-1004097 TCTTCTAGGCTGGACCTGGGGGG + Intergenic
900117371 1:1034357-1034379 TCCTCCAGGCTCATCGTGGGAGG - Intronic
901025626 1:6277372-6277394 CCTTCAAAGCTGATAGTGGGGGG - Intronic
901322148 1:8346317-8346339 TCTTCCACCCTGAAGCTGGGGGG + Intergenic
902202017 1:14840646-14840668 TCATCCAGGCAGAAAGAGCGTGG + Intronic
903293685 1:22330318-22330340 TGTTGCAGGCGGAAGGTGGGTGG + Intergenic
903844599 1:26271000-26271022 TCTTGCAGGCTGAAAGACAGTGG - Exonic
904392116 1:30192883-30192905 CCTGCGAGGCTGAAAGAGGGGGG + Intergenic
906151173 1:43588544-43588566 ACTTCTAGGCTGGAAGTGGGTGG + Intronic
906318724 1:44803949-44803971 TCTACCAGGCTGACAGGGGCTGG - Exonic
906676312 1:47696045-47696067 TCTTACAGGCTGAAATTTGTAGG + Intergenic
906785355 1:48610862-48610884 TCTTCCAGGCTGTGTGTGTGTGG - Intronic
908000139 1:59671511-59671533 TCTCCCAGGCTCAGAGTAGGTGG + Intronic
910721142 1:90287412-90287434 TCTTCCAGGCTGAAAGTGGAAGG - Intergenic
910840741 1:91558967-91558989 TCTTCCAGGATGAATCTGGAAGG + Intergenic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
911015417 1:93326740-93326762 TCTTACAGGCTGGGCGTGGGTGG + Intergenic
913334478 1:117696456-117696478 TGTTCCAGATTGAGAGTGGGTGG - Intergenic
915135930 1:153731542-153731564 TAAATCAGGCTGAAAGTGGGAGG + Intronic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
916651963 1:166840975-166840997 TCTTTCAGGCTCAAATTGAGAGG - Exonic
916828672 1:168468576-168468598 TCTTTCAGGCAGAAAGAGGAGGG + Intergenic
917044139 1:170838022-170838044 TGTTACAGGCTGAAAGAGTGAGG + Intergenic
917475344 1:175364729-175364751 TCTTCTAAGCTGGTAGTGGGAGG + Intronic
917562645 1:176175392-176175414 TCTTCCAGACTGAAGGGAGGTGG + Intronic
917886432 1:179389887-179389909 GCTTTAAGGCTGAAAGTGGCAGG - Intronic
917996422 1:180443541-180443563 TTTTCCAGGCTGCAAGGAGGGGG - Intronic
922143670 1:222916841-222916863 TGTTTCAGGCTGAAAGAGTGAGG + Intronic
922805548 1:228386311-228386333 CCTTGCAGGCTGAAAGAGAGTGG + Intergenic
923011345 1:230090350-230090372 TCTTCCAGTCTGAAGTGGGGTGG + Intronic
924771582 1:247085171-247085193 TGTGCCAGGCTGGAGGTGGGAGG - Intergenic
1063708776 10:8457004-8457026 TGTTCCAAGCAGAAAGTGTGTGG - Intergenic
1063826488 10:9904259-9904281 TCTTCAAGGCTGACATTGGCAGG + Intergenic
1063960217 10:11300459-11300481 TCTTCCAGGCTGGGAGTGTGAGG + Intronic
1065365347 10:24929879-24929901 TCTATCAGGGTGGAAGTGGGAGG - Intronic
1065737321 10:28765850-28765872 ACTTCAAGGCATAAAGTGGGAGG + Intergenic
1067213673 10:44282383-44282405 TCTTCCAGCCAGTAAGTGGCTGG + Intergenic
1067353060 10:45494701-45494723 TATTCCAGGCTGGATGAGGGAGG - Intronic
1068702935 10:60039138-60039160 TCTGCCTGGCTTAAAGTGGAAGG - Intronic
1069565583 10:69461433-69461455 TCTCCCAGGCAGGAAGTGGGAGG - Intronic
1069663094 10:70136851-70136873 TGTTCCAGGCTGAGAGTGGCAGG - Intergenic
1071923696 10:90380479-90380501 GCTTCCATGCTCAAAGTGTGAGG + Intergenic
1072737904 10:97891576-97891598 CCCTCCAGGCTGGCAGTGGGCGG - Intronic
1074126068 10:110530014-110530036 TCTTCCAGGATTAAAGAGAGAGG + Intergenic
1076662885 10:132067261-132067283 TCTCCAAGGCTGAGGGTGGGGGG + Intergenic
1078344557 11:10534948-10534970 TTTTCCAGGCAGAAAATGTGAGG - Intronic
1078431882 11:11294367-11294389 GCTTCCAGAAGGAAAGTGGGTGG + Intronic
1083793231 11:64999430-64999452 TCTTCCTGGCTGGAAGATGGTGG + Intergenic
1084866266 11:72060601-72060623 TCTTCCAGGCTGGAATGTGGTGG - Intronic
1084934730 11:72580804-72580826 TCTCCCAGCCTGAAGATGGGTGG - Intronic
1088174769 11:107039984-107040006 TATTACAGGGTGAGAGTGGGAGG + Intergenic
1089227293 11:116936217-116936239 TCATCCAGGCTGAAGCGGGGTGG + Intronic
1091386808 12:101164-101186 GCTTGCAGGCTGAGAGTGGATGG - Intronic
1091842214 12:3629400-3629422 TCTTCCTGGCTAGAAGTGGAGGG + Intronic
1094181497 12:27596967-27596989 TCTTCCAGGGAGGAGGTGGGTGG - Intronic
1094816712 12:34193880-34193902 TTCTCCAGGCGGAAAGGGGGAGG - Intergenic
1096568413 12:52500892-52500914 TGTTGCAGGCTGAAAGAGTGAGG - Intergenic
1096866400 12:54566222-54566244 TCTTCCAGGATAAAAGTGGTGGG - Intronic
1099385562 12:82008839-82008861 CCTTCCAGGATTGAAGTGGGTGG - Intergenic
1099930284 12:89066310-89066332 TCTCCCAGGCTGAAAGGCAGTGG - Intergenic
1100385486 12:94101651-94101673 TCTTCCACGGGGAAAGTAGGAGG + Intergenic
1101595633 12:106162390-106162412 TTATCCAGCCTTAAAGTGGGAGG - Intergenic
1102024653 12:109707391-109707413 TCTCCCAGGCTGTGAGTGGCAGG - Intergenic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1102785452 12:115600554-115600576 TCCTCCAGGTGGAAAGTGGGGGG + Intergenic
1102901664 12:116643274-116643296 TATTTCAAGCTGAAAGGGGGAGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104455789 12:128911233-128911255 GCATCCAGGCAGAAGGTGGGTGG - Intronic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1108342022 13:49506552-49506574 TCTTCCAGTCTTCAAGTGGAAGG - Intronic
1109401611 13:61837521-61837543 TCACACAGGCTGAAAGAGGGTGG - Intergenic
1110296480 13:73872253-73872275 TTACCCAGGGTGAAAGTGGGTGG - Intronic
1113649514 13:112026174-112026196 GCTTCCAGGCTGAATATGTGAGG - Intergenic
1115236188 14:31210390-31210412 TCTTGCGGGCAGGAAGTGGGTGG - Intergenic
1115342585 14:32308123-32308145 TCTTCCAGGCTGAAACAGGTTGG - Intergenic
1115961726 14:38841639-38841661 TCTGCCATGCTGAAAGCTGGAGG + Intergenic
1116868244 14:50048633-50048655 TCTCCCAGGCTGATTCTGGGAGG + Intergenic
1117550438 14:56830800-56830822 TCTCCCAGGATGAAATTGTGGGG - Intergenic
1117815277 14:59591673-59591695 TGTTGCAGGCCGAAAGTGTGAGG + Intergenic
1117973873 14:61279804-61279826 TCTTCAAGTCTGAGAGTGGAAGG - Exonic
1118410238 14:65470481-65470503 TGTCTCAGGCTGAAAGGGGGCGG - Intronic
1119303789 14:73591205-73591227 TCATCCAGGCTGCAAGGCGGTGG - Intergenic
1119659541 14:76440391-76440413 TCTTCCAGGCTGGAAGGCAGTGG - Intronic
1120144552 14:80965346-80965368 TGTTGCAGGCTGAAAGAGTGAGG - Intronic
1121991245 14:98559788-98559810 TCTGCCATACAGAAAGTGGGGGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1123933533 15:25183220-25183242 TCTTCGAGCCTGAAGGGGGGCGG + Intergenic
1125930635 15:43597482-43597504 TCTTACATGCTGAACATGGGGGG - Intronic
1126184394 15:45817226-45817248 TCTTCCAGGTTTAATGTAGGAGG + Intergenic
1127067419 15:55255243-55255265 GCTTCCAGGGTGAGAGTGGAAGG - Intronic
1127090497 15:55462073-55462095 TCTTCCTGGCTTAATCTGGGAGG - Intronic
1127791644 15:62403735-62403757 TCTTCCTGGCTTAAAGTTGGGGG + Intronic
1128564345 15:68690687-68690709 TCATCCAGGCTGGAAGAGAGTGG + Intronic
1129277200 15:74453917-74453939 TCCTCCAGGTAGAAGGTGGGAGG + Intronic
1132009560 15:98263946-98263968 TCTGCCAGGCTGTTAGTGTGAGG - Intergenic
1132163405 15:99564083-99564105 TCTTCCAGGGTGACAGCAGGTGG + Intergenic
1132493653 16:249187-249209 GCTTCCAGGCTGGCTGTGGGGGG + Intronic
1132584211 16:699288-699310 GCCTCCAGTCTGTAAGTGGGTGG + Intronic
1132592154 16:730759-730781 TCCACCAGGCTGGGAGTGGGAGG - Intronic
1133195954 16:4170461-4170483 TTCTCCAGGCAGACAGTGGGTGG + Intergenic
1135062640 16:19284049-19284071 TCTTGCAAGCTGAAATTTGGGGG - Intergenic
1135229024 16:20687497-20687519 TCTTCAAGACTGAGAGAGGGGGG + Intronic
1135949528 16:26901041-26901063 TCTCCCTCTCTGAAAGTGGGAGG - Intergenic
1136027240 16:27476536-27476558 TCATCCACGCTGAAAGAGAGGGG + Exonic
1137250545 16:46737677-46737699 TCTTCCAGGCTGGGTGAGGGAGG - Intronic
1138356645 16:56386420-56386442 TCTCCCAGGCTGAGCGTGTGAGG - Intronic
1138905753 16:61330177-61330199 ACTTACAGGCTGAAAGTGAATGG - Intergenic
1141874345 16:86812297-86812319 GCTTCCATTCTCAAAGTGGGAGG + Intergenic
1146748297 17:35352127-35352149 TCTTCCAGCCAGAAAGATGGTGG - Exonic
1149455696 17:56786326-56786348 TCTTCCAGGTGGAAAAGGGGAGG - Intergenic
1149467853 17:56893708-56893730 TCGTCCAACCTGGAAGTGGGTGG - Intronic
1149816605 17:59731137-59731159 TCTTCCAGATTGAAATTTGGAGG - Intronic
1150819050 17:68420242-68420264 TCTTCCAGGTTGAAAATCAGAGG - Exonic
1152551243 17:81031412-81031434 GCTGCCAGGCAGAAGGTGGGAGG + Intergenic
1154026196 18:10709506-10709528 ATTTCCAGGCTGAACGTGGTAGG + Intronic
1154325892 18:13390207-13390229 TCAGCCAGGCTGACACTGGGGGG - Intronic
1155156163 18:23159282-23159304 TCTTCTAGGCTGGGAGTGGGAGG + Intronic
1156628345 18:38937349-38937371 GTTTCCAGGCTGAGACTGGGAGG - Intergenic
1157152504 18:45232310-45232332 TCTGACTGGCTGAAAGTGTGTGG - Intronic
1158338398 18:56438219-56438241 TCTTCCTGGCTTAAATCGGGAGG + Intergenic
1163191896 19:15683047-15683069 TCTTACAGGGTGAAAGAGAGAGG + Intronic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1165441579 19:35831371-35831393 CCTTCCAGGATGAAGGTGTGGGG + Exonic
1166128084 19:40728343-40728365 TCACCCAGGCTGAAATTGAGTGG - Intronic
1166228427 19:41411514-41411536 TCTTCCAGGCAGGAAGTAGAGGG + Intronic
1167432441 19:49462220-49462242 ACTCCCAGGCTGAACCTGGGAGG - Intronic
925901287 2:8511105-8511127 TCTTCCAGGGTGAAAAAGGGAGG + Intergenic
926841468 2:17085415-17085437 TCTTCTTAGGTGAAAGTGGGTGG - Intergenic
927043445 2:19253408-19253430 TCTCCCAGGCTGAAAGTCTCAGG + Intergenic
927055853 2:19364789-19364811 TGGTCTAGGCTGGAAGTGGGGGG + Intergenic
928361920 2:30670516-30670538 TCTGCCAGGCTGTTAGTGTGGGG + Intergenic
928409070 2:31040384-31040406 TCATCCAGCCTTGAAGTGGGAGG + Intronic
928601819 2:32910883-32910905 TCTTCCAGGCTGACTCTGGCTGG + Intergenic
928908090 2:36389691-36389713 TCTGCCAGCCTGAAGGTGGAAGG - Intronic
929317412 2:40496630-40496652 TTTACCAGGCTCAAAGTGAGGGG - Intronic
929941499 2:46337401-46337423 TATTCCAGGCAGGGAGTGGGAGG + Intronic
930327585 2:49939642-49939664 TTTTCCTGGCTGAAAATTGGTGG - Intronic
932446153 2:71782770-71782792 GCTTCCAGGCTGAAAGTTTCAGG - Intergenic
932467039 2:71930543-71930565 TCTCCCATGCTGAAAGGGGAGGG - Intergenic
932770275 2:74497213-74497235 TCTCCCAGGCAGACAGTAGGTGG + Intergenic
933370171 2:81405114-81405136 TCTTAGAATCTGAAAGTGGGTGG + Intergenic
933682335 2:85113286-85113308 TCATCTTGGCAGAAAGTGGGTGG - Intergenic
934066252 2:88344810-88344832 TCTTCCAAGCTGGCAGTGGCAGG - Intergenic
936974660 2:118207113-118207135 TCATCCATGCTGAAAGGGGCAGG + Intergenic
937433945 2:121864578-121864600 TCTTTCAGGCTGTAACGGGGTGG + Intergenic
938376058 2:130807602-130807624 TCTTCCAGTGCTAAAGTGGGTGG + Intergenic
939260949 2:139807978-139808000 TCTTTCAGACTGAAAGTGTAGGG + Intergenic
939598687 2:144161347-144161369 TCTTACAAGATGTAAGTGGGTGG - Intronic
940316306 2:152330971-152330993 TATTCCAGGCAGAAAGCAGGGGG - Intergenic
945954255 2:216070976-216070998 TGTTGCAGGCTGAAAGAGTGAGG - Intronic
948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG + Intergenic
1170061955 20:12268568-12268590 TGATCCAGGTTGAAATTGGGAGG - Intergenic
1170561063 20:17558936-17558958 TTTTCCATGCTGGAAGTGGAAGG - Intronic
1171393187 20:24814668-24814690 TCTGCCAGGGTGAAGGTGGTGGG - Intergenic
1172185697 20:33029796-33029818 TGTGCCAGGCAGAAAGAGGGAGG + Intergenic
1172949579 20:38714258-38714280 CCTTGCAGGCTGAGGGTGGGGGG + Intergenic
1172970393 20:38869196-38869218 TCACCCAGGCTGAATGCGGGTGG + Intronic
1175602557 20:60286860-60286882 TCTGCCATGCAGAAAGGGGGTGG - Intergenic
1176173881 20:63708566-63708588 TCGTCCATGCTGAGAGAGGGAGG - Exonic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1180151432 21:45950268-45950290 TCTACCATGCTGTGAGTGGGCGG + Intergenic
1180771569 22:18391037-18391059 TTTGGCAGGCTGAAAGTGTGGGG + Intergenic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1181077317 22:20389601-20389623 TGTTGCAGGCCGAAAGAGGGAGG - Exonic
1182418783 22:30238521-30238543 TCTCCCAGGCTGAGAGAGGCAGG + Intergenic
1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG + Intronic
1183278602 22:36918925-36918947 TCTTCCAGCCTGCAACTTGGAGG - Intronic
1183791894 22:40078630-40078652 TCATCCAGGCTGAAATAAGGTGG + Intronic
1183908292 22:41059589-41059611 TTTGGGAGGCTGAAAGTGGGAGG - Intergenic
1184610890 22:45602383-45602405 GCCCCCAGGCTGCAAGTGGGCGG - Intergenic
1184616348 22:45640881-45640903 TCTTCCAGGGTGGAAGGGGAGGG - Intergenic
1184667719 22:45997414-45997436 TCTTTCAGGCTTAAAATGGCAGG - Intergenic
1185210830 22:49569643-49569665 TCTTCCAGGCTGGCAGGGGAAGG + Intronic
953334306 3:42080763-42080785 TCTTCAAGCTAGAAAGTGGGTGG + Intronic
954596392 3:51829322-51829344 TTTTCCAGGCTCAAAGTTGATGG - Exonic
957343702 3:78934679-78934701 TATTCCAAGCTCAAAATGGGGGG + Intronic
957391474 3:79577870-79577892 TCTTCCAGGCTGGAGGGCGGTGG - Intronic
962167594 3:133065800-133065822 TTTTCAAGGCTTAAAATGGGTGG + Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
963914088 3:150841564-150841586 TCTGCCACGCAGAAAGTTGGGGG - Intergenic
964727399 3:159828131-159828153 TCTGACAGCCTGAAAGTGGGCGG + Intronic
966723250 3:183085702-183085724 TCTTACAGGAAGAAAGTGGTAGG - Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
971942821 4:33237635-33237657 TCATCCAGGCTGAAGTTTGGTGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972726002 4:41746748-41746770 TCTTCCAGGCTCAAAGGCCGGGG - Intronic
973192326 4:47399849-47399871 TCTTCCAGACAGAAAGTGCAAGG - Intronic
974091294 4:57314222-57314244 TGTTCCAGGCTGGGAGTGAGTGG + Intergenic
975879973 4:78893600-78893622 TCTTCCAGGCTGGAATGGAGTGG + Intronic
976505559 4:85842330-85842352 TCACCCAGGCAGAAAGTGGCAGG - Intronic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977962909 4:103105511-103105533 TCCTCCAGGCTGGGAGTGAGGGG + Intergenic
980263338 4:130482609-130482631 TCTTTCTGACTGAAAGTAGGAGG - Intergenic
983546122 4:168966485-168966507 TCGTCCAGGCTGAAAGGCAGTGG - Intronic
985097073 4:186423434-186423456 CCTTCCATGCTAAGAGTGGGTGG - Intergenic
985365391 4:189226559-189226581 TATTCAATGCTGGAAGTGGGAGG - Intergenic
985643684 5:1075175-1075197 TCGGCCTGGCTGGAAGTGGGAGG + Intronic
986431159 5:7682568-7682590 TCTTCAAGACTGAATCTGGGAGG + Intronic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
991304053 5:65158026-65158048 ACCTCCAGGTTGAATGTGGGTGG - Intronic
991653903 5:68883667-68883689 TCTTTCAGGGAGAAGGTGGGAGG - Intergenic
992371504 5:76148828-76148850 TATTCCTGGGAGAAAGTGGGTGG + Intronic
996696118 5:126397262-126397284 TCATCCAGGCTGAAACAGAGTGG + Intronic
996734413 5:126745524-126745546 TCATCCAGGCTGGAATTCGGTGG + Intergenic
996734709 5:126748041-126748063 GCTTTTAGGCAGAAAGTGGGAGG + Intergenic
997883495 5:137611359-137611381 TCCCCCAGGCTGGCAGTGGGAGG + Intergenic
998785102 5:145700389-145700411 TCTTCCATGTTGAGAGTGGTGGG - Intronic
999476546 5:151904916-151904938 TCTTCTAGGGTCAGAGTGGGTGG - Intronic
1000150417 5:158495254-158495276 TCTTCCAGGTTCAAGATGGGGGG + Intergenic
1002146609 5:177188018-177188040 TCTTCCAGGCTTAGACTGGCAGG - Intronic
1002207478 5:177573489-177573511 TCTTTTAGGTAGAAAGTGGGAGG + Intergenic
1002429162 5:179193046-179193068 TCTCCCAAGTGGAAAGTGGGAGG - Intronic
1004093565 6:12530118-12530140 AGTTCCAGGGTGTAAGTGGGAGG - Intergenic
1004457147 6:15801650-15801672 CCTTTCAGGATGAAGGTGGGGGG + Intergenic
1007463478 6:42035083-42035105 TCATCCAGGCTGAAAGTTCAAGG + Intronic
1008135007 6:47764818-47764840 TCTTAGAGGGTGAAGGTGGGTGG + Intergenic
1008601323 6:53098800-53098822 TGTTCCAGTATGAAAGTTGGGGG + Exonic
1016399150 6:143659522-143659544 TCTTGCTGGCTGTGAGTGGGAGG + Intronic
1017820854 6:158048228-158048250 TCTCCCAGGCTGAGGGTGTGGGG + Intronic
1018174580 6:161167682-161167704 TCCTCCAGGCTGGAAGCTGGAGG + Intronic
1018639225 6:165891447-165891469 TCTCCCTGGCTGAACCTGGGAGG - Intronic
1019676607 7:2317161-2317183 CATTCCAGGCTAAAAGTGTGGGG + Intronic
1019764119 7:2837098-2837120 TCTTCCAGGCAGAGAATGGGAGG - Intronic
1020016455 7:4834658-4834680 TGTGCCCGGCTGGAAGTGGGTGG + Exonic
1021413445 7:20354685-20354707 TGTTCCAGGCAGAAAGAGGCAGG + Intronic
1022611249 7:31875645-31875667 GACTCCAGGCTTAAAGTGGGAGG - Intronic
1023615736 7:42017505-42017527 CCTCCCAGGCTGAAAGGGGAGGG + Intronic
1024272861 7:47655596-47655618 TCTGCCAGGCTGGAAGGAGGAGG + Intronic
1026063915 7:67052250-67052272 TCTTCTAGGAAGCAAGTGGGTGG - Intronic
1026714439 7:72775210-72775232 TCTTCTAGGAAGCAAGTGGGTGG + Intronic
1029471996 7:100760437-100760459 TCTTCCTGGGTGCAAGCGGGCGG + Exonic
1032407387 7:131666546-131666568 TCATCCAGGCTTGAGGTGGGAGG - Intergenic
1033010684 7:137619389-137619411 CCTTCCAGGTTGGAAGTGGCAGG + Intronic
1035011953 7:155727194-155727216 TATTCCAGGCCGAAAGGAGGAGG + Intronic
1035389432 7:158495776-158495798 TCTGCCAGGCTGGGCGTGGGAGG + Intronic
1036720230 8:11167454-11167476 TCATCCAGGCTGGAAGTGGTTGG + Intronic
1038214591 8:25550082-25550104 TCTTTCAGGCGGACAGTGGGTGG - Intergenic
1038612069 8:29067135-29067157 TTTTCCAGACTGAGACTGGGAGG - Intergenic
1042190314 8:66179002-66179024 TTTTCCAGGCAGAAAGATGGTGG - Intergenic
1042793343 8:72633201-72633223 GCTTCCTGGCTGGCAGTGGGTGG + Intronic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1044210437 8:89543932-89543954 TCCTCCAGGCTGAAGGAGGGCGG - Intergenic
1044494704 8:92862903-92862925 TCTTCCATCCTGTAAGAGGGAGG - Intergenic
1048660861 8:136599776-136599798 GCCTCCAGGCTTATAGTGGGAGG - Intergenic
1049280065 8:141739787-141739809 CCTTCCAGGCTGCCTGTGGGTGG + Intergenic
1049477313 8:142802747-142802769 TGGTCCAGGCTGCAAGTGGGAGG + Intergenic
1050536154 9:6632727-6632749 GCTTGCAGGCAGAATGTGGGTGG + Intronic
1050807458 9:9698790-9698812 TCTTCCAGGCACCAAGTAGGTGG - Intronic
1051101186 9:13523820-13523842 TCTTCCAGTTAGAAAGTAGGAGG + Intergenic
1053014183 9:34652594-34652616 TCTGCCAGCGTGAGAGTGGGTGG + Intronic
1054716523 9:68562355-68562377 TCTTCCAGGCTGGAAGGTAGTGG - Intergenic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1055591917 9:77825500-77825522 TCTTCCAGTCTGAAAGATGGTGG - Intronic
1057168522 9:92947123-92947145 TCCTCCAGGCTTAGAGAGGGTGG - Intergenic
1059516924 9:114904526-114904548 TCTTCAATGCTGAAAGCTGGAGG + Intronic
1060488105 9:124062406-124062428 TCTCCCAGGCCACAAGTGGGCGG + Intergenic
1060963124 9:127695371-127695393 TGTTGCAGGCTGAAAGAGTGAGG + Intronic
1062186014 9:135218924-135218946 TCTTCCAGGCAGGCAGTGCGTGG + Intergenic
1187625917 X:21113616-21113638 TGTTCCAGGATGATTGTGGGGGG - Intergenic
1189039280 X:37525292-37525314 TCCTCCAGACTGAAAGATGGAGG + Intronic
1189207092 X:39250993-39251015 TCTTCCAGCCTAAAATAGGGAGG - Intergenic
1193581089 X:83263749-83263771 TCTTCCTGGTTGAATCTGGGAGG - Intergenic
1196935187 X:120723313-120723335 TCTTCCTGGCTTAATCTGGGAGG + Intergenic
1198817234 X:140604796-140604818 TGTTTGAGGCTGCAAGTGGGAGG - Intergenic
1199666161 X:150098174-150098196 TCCTCTAGGTGGAAAGTGGGTGG + Intergenic
1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG + Intergenic
1200908127 Y:8506754-8506776 TCTTCAAGGTACAAAGTGGGAGG - Intergenic