ID: 1105255259

View in Genome Browser
Species Human (GRCh38)
Location 13:18740071-18740093
Sequence GTGCCATGCCTGACACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 3, 1: 1, 2: 3, 3: 27, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105255259 Original CRISPR GTGCCATGCCTGACACATGG TGG Intergenic
900080073 1:850011-850033 GGGCCATGCCTGGCACAGTGAGG - Intergenic
900483992 1:2912838-2912860 GAGCCAGGCCTGACTCATAGAGG + Intergenic
902255730 1:15187480-15187502 GTACCATGCCCGGCCCATGGGGG + Intronic
902264028 1:15248195-15248217 CTGCCATGCCTGACACATAGTGG - Intronic
902281799 1:15380141-15380163 GTGCCATGCTGGGCACAAGGAGG + Intronic
902365656 1:15972225-15972247 GCACAATGCCTGACACATGTTGG + Intronic
903154040 1:21431760-21431782 GTGCCAGGCTGGACACTTGGGGG - Intergenic
906551687 1:46671002-46671024 GGGCCATGCTTGACTCCTGGGGG - Intronic
906845456 1:49186546-49186568 ATACCAAGCCTGACACATTGCGG + Intronic
907662274 1:56404389-56404411 GTGCCACACCTGACACATAATGG + Intergenic
908460910 1:64347764-64347786 CTTCCGTGCCTGACTCATGGTGG - Intergenic
914493669 1:148172595-148172617 CTGCCATACATGAAACATGGAGG + Intergenic
916073746 1:161187909-161187931 GTTCCATCCATGACACATAGAGG + Exonic
916725930 1:167524276-167524298 GTACCATGCTTGGCACCTGGTGG - Intergenic
917725660 1:177825010-177825032 GTGCTCTGCCTGACACCTGAGGG + Intergenic
919800943 1:201354299-201354321 GTGCTATGTCTAGCACATGGAGG - Intergenic
921353632 1:214263718-214263740 GTGGCCTGGCTGTCACATGGTGG + Intergenic
922079231 1:222278704-222278726 GTGCCATGAATCATACATGGTGG - Intergenic
922707368 1:227796468-227796490 GTGCCCTGCATGGCGCATGGTGG + Intergenic
922973032 1:229759154-229759176 GTGGCATGCCTGGCAGAAGGAGG + Intergenic
923040549 1:230317164-230317186 GTGCCATGACTGAAACACGTTGG - Intergenic
923089515 1:230729145-230729167 GTGCCCTGCATGGCAGATGGTGG - Intergenic
923820291 1:237431774-237431796 GTGCAGTGCCTGACACTTAGTGG + Intronic
924736861 1:246765374-246765396 TTGCCATGCCTGGCCCACGGGGG + Intronic
1067694784 10:48527008-48527030 GTGAGTTGCCTGGCACATGGTGG - Intronic
1073456001 10:103637147-103637169 GTGCCATGCCTGGGTGATGGGGG - Intronic
1075933799 10:126322636-126322658 ATGCCATGCCCTACACATGCTGG - Intronic
1076487893 10:130836017-130836039 GGCCCATGCCTGGCCCATGGTGG + Intergenic
1076875771 10:133214818-133214840 GTGCCCTGCCTGACAGCAGGTGG - Intronic
1077164496 11:1129030-1129052 GTGCAACGCCTGCCACATCGGGG - Intergenic
1077446420 11:2593121-2593143 GTACCATGCCTAACCCATGGTGG + Intronic
1078982678 11:16554441-16554463 GTGTTGTGCCTGGCACATGGTGG - Intronic
1079397682 11:20079648-20079670 GTGCCATGCCTGCCTCATCTAGG - Intronic
1080915837 11:36657774-36657796 GTATCAGGGCTGACACATGGTGG + Intronic
1081761159 11:45577192-45577214 GTGCAGTGCCTGACACTCGGAGG + Intergenic
1081848513 11:46258752-46258774 GTACACTGCCTGACTCATGGTGG + Intergenic
1084450092 11:69231678-69231700 ACACCATGCCTGACACATTGGGG - Intergenic
1084969402 11:72762323-72762345 GTGTAATACCTGGCACATGGTGG - Intronic
1085996746 11:81926306-81926328 GTGCCATGCTGGACACAGGGAGG + Intergenic
1087043242 11:93821846-93821868 GTACAATGCCTGGCACATAGTGG + Intronic
1091129039 11:133128515-133128537 GAGCCATGCCCTACACATGAGGG - Intronic
1095195232 12:39306876-39306898 GTGCAATGCCTGACATATTTGGG + Intronic
1095521469 12:43071913-43071935 GTTCAATGCCTGGCACATCGTGG + Intergenic
1096281830 12:50261874-50261896 GAACAGTGCCTGACACATGGGGG + Intronic
1098730095 12:74025008-74025030 GTCCCACCCTTGACACATGGGGG - Intergenic
1100164577 12:91901668-91901690 GTCCCAATCCTGACGCATGGGGG - Intergenic
1101303529 12:103504765-103504787 CTGCCAGGCCTGAGACATGCTGG + Intergenic
1102053906 12:109881930-109881952 GTGCAGTGCATGACACATAGTGG - Intergenic
1104223648 12:126810551-126810573 GTCCCTTGCCTGTCACATAGAGG + Intergenic
1105255259 13:18740071-18740093 GTGCCATGCCTGACACATGGTGG + Intergenic
1108014725 13:46062694-46062716 GTGCAGTGCCTGGCACAAGGAGG - Intronic
1109438359 13:62336061-62336083 GTACATTGCCTGACACATAGTGG - Intergenic
1110144632 13:72175205-72175227 GCCCGATGCCTGACACACGGAGG + Intergenic
1111038965 13:82719394-82719416 GTGCCATGGCAGACACATTTAGG - Intergenic
1112136529 13:96584534-96584556 GGACCATGCCTGGCACATAGAGG + Intronic
1113445708 13:110364995-110365017 ATGCAGGGCCTGACACATGGTGG + Intronic
1113855979 13:113445665-113445687 GTGCCATTTCTGCCCCATGGAGG - Intronic
1117726711 14:58681860-58681882 GCACCTTGCCTGACACATGAAGG - Intergenic
1118054530 14:62065827-62065849 GTGCTATGCCCAGCACATGGAGG + Intronic
1120000152 14:79293742-79293764 GTGACATGCCTGACACGGAGTGG - Intronic
1122283363 14:100637333-100637355 GTCTCATGGCTGAGACATGGTGG - Intergenic
1124851647 15:33345252-33345274 GCTCCATGCCTGGCACATAGTGG - Intronic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1133509534 16:6444265-6444287 GCACAATGCCTGGCACATGGTGG + Intronic
1133686117 16:8166945-8166967 GCACAATGCCTGGCACATGGAGG + Intergenic
1134094794 16:11412221-11412243 GTGCCAAGGCTGAGACATGGAGG - Intronic
1134355857 16:13481641-13481663 GTACCATGCCCGGCACATAGAGG + Intergenic
1137558429 16:49488052-49488074 GTGCAGTGCCTGGCACCTGGGGG + Exonic
1139304777 16:65975728-65975750 GAGCGATGCTTGACACATGGGGG - Intergenic
1140682180 16:77395947-77395969 GTACCCTGCCTGACTCATAGTGG - Intronic
1140948893 16:79796985-79797007 GCACAATGCCTGGCACATGGTGG - Intergenic
1143031817 17:3972215-3972237 GTGCCATGCCTGGGGCATGCTGG - Intergenic
1144319840 17:14104049-14104071 GTGGGATGAGTGACACATGGAGG - Intronic
1144749014 17:17635354-17635376 GCCCCGTGCCTGACACATGGTGG - Intergenic
1145885534 17:28380162-28380184 GCACAATGCCTGGCACATGGAGG - Intronic
1146559885 17:33858811-33858833 GAACCATGCCAGACACAAGGAGG + Intronic
1148735046 17:49860568-49860590 GGGCCAGGCCTGAGTCATGGGGG - Intergenic
1152107380 17:78338617-78338639 GTTCCTGGCCTGACACATAGTGG - Intergenic
1152444997 17:80337325-80337347 GTGCCCCGGCTGGCACATGGGGG - Intronic
1154435762 18:14340531-14340553 GTGCCATGCCTGACACATGGTGG - Intergenic
1155056218 18:22185834-22185856 GGGCCATGCCATACACATGAAGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156516746 18:37686676-37686698 GTGCCATGACTGAAACACAGAGG + Intergenic
1157243343 18:46032151-46032173 GTACGATGCCTGGCACATGGTGG - Intronic
1160292268 18:77606051-77606073 GCCCCATGCCTGGCACACGGCGG - Intergenic
1160431019 18:78812578-78812600 GGGCTGTGCCTGACACATAGTGG + Intergenic
1160478693 18:79218380-79218402 GTTCCATGCCTGGCACAGGCTGG + Intronic
1160898836 19:1416590-1416612 GTGCCATGGCTGACTCAAGGTGG + Intronic
1162006371 19:7782831-7782853 CTGCCATGCCTGACCTATGCTGG - Intergenic
1162323117 19:9981906-9981928 ATGCAATGCATGACACATGTAGG - Intronic
1163325841 19:16602563-16602585 TTGCCATGGCTAAAACATGGTGG + Intronic
1163552121 19:17971289-17971311 CTCCCAGGCCTGGCACATGGGGG + Intronic
925369820 2:3336419-3336441 GGGCCCTGCCTTCCACATGGAGG - Intronic
927193956 2:20535097-20535119 GTCCCATGCCTGTTACAAGGTGG + Intergenic
934490274 2:94757609-94757631 GTGCCATGCCTGACACAAGGTGG + Intergenic
938062781 2:128265915-128265937 GTGCCAGGCTGGACACTTGGGGG + Exonic
942603689 2:177667765-177667787 GCTTCATGCCCGACACATGGAGG + Intronic
944229171 2:197376093-197376115 GTGCAGTGCCTGACACAGTGTGG - Intergenic
944664564 2:201949272-201949294 GGGCAATGCCTGACACTTAGTGG - Intergenic
945030557 2:205659426-205659448 GCGCACTGCCTGATACATGGTGG + Intergenic
946762246 2:223005986-223006008 GTCCCACCCTTGACACATGGGGG + Intergenic
947049229 2:226023552-226023574 GTGGCATGCCTACCACAAGGTGG + Intergenic
948200723 2:236128123-236128145 GTGCCCTGCCCTCCACATGGCGG + Exonic
948662284 2:239514984-239515006 CTGCCATACCTGTCACACGGGGG - Intergenic
949007194 2:241656361-241656383 GTGCCACGCCAAACACAGGGCGG - Intronic
1168966716 20:1903083-1903105 CTGCCATTCCTCCCACATGGAGG - Intronic
1170476010 20:16715187-16715209 CTGCCCTGCCACACACATGGGGG + Intergenic
1171162735 20:22942655-22942677 GAACAATGCCTGCCACATGGTGG - Intergenic
1171411985 20:24953650-24953672 GGGCCATGCCTGAGACAGGTAGG - Intronic
1171880086 20:30612050-30612072 GTGCCATGCTTGACACAAGGTGG + Intergenic
1174098233 20:48106582-48106604 CTGACATGACTGACATATGGAGG + Intergenic
1175173720 20:57096967-57096989 CGTCCATTCCTGACACATGGAGG + Intergenic
1175981782 20:62742373-62742395 GGGACACGCCTGACTCATGGTGG - Intronic
1176841274 21:13845103-13845125 GTGCCATGCCTGACACATGGTGG + Intergenic
1177146031 21:17407715-17407737 ATGCTTTGGCTGACACATGGAGG - Intergenic
1178429855 21:32509575-32509597 GTGCCATCCCTGGCACAGAGTGG - Intronic
1179499484 21:41798450-41798472 GTCCCATGCCGGACACAGCGAGG + Intronic
1179891336 21:44336563-44336585 GTGCCATGCCTGGCGTATGGTGG - Intronic
1180880850 22:19202537-19202559 GTGCCATGGATGACAGAAGGAGG - Intronic
1181690907 22:24559726-24559748 GAACCATGCCTGACCAATGGTGG + Intronic
1181777411 22:25169698-25169720 GGGCCAAGCCTGGCACACGGTGG - Intronic
1184658658 22:45955250-45955272 ATGCCATTCCTTCCACATGGAGG + Intronic
950131925 3:10553329-10553351 GTTCCATGCCTGACACAGAGAGG + Intronic
950500601 3:13361229-13361251 GAACCATGCCTGGCACATAGCGG + Intronic
950549685 3:13658721-13658743 GTCCTATGCCTGCCACAGGGTGG - Intergenic
950834555 3:15906546-15906568 GAGCCATGCCTGAGTGATGGAGG + Intergenic
951613290 3:24516417-24516439 GTGCAGTGACTGACACATAGTGG + Intergenic
952690040 3:36194731-36194753 GTGCCATGGCACACCCATGGCGG + Intergenic
952996633 3:38889464-38889486 GTGCAAGGCCTGTCACATGGTGG + Intronic
958170457 3:89933275-89933297 GTCCACAGCCTGACACATGGGGG + Intergenic
958546083 3:95552438-95552460 GTACCAAGCCTGACACATGAAGG - Intergenic
960212344 3:114985199-114985221 GTGCCAGGCATGACACCTAGGGG - Intronic
960569605 3:119172912-119172934 GTGCCATGTATAACACATGATGG + Intronic
961048397 3:123725631-123725653 ATGAGATGCCTGACACATAGGGG - Intronic
963392794 3:144689894-144689916 GTTCCACCCTTGACACATGGGGG - Intergenic
965024083 3:163276155-163276177 GTTCCATACTTAACACATGGTGG + Intergenic
966077570 3:175956684-175956706 GTCCCACCCTTGACACATGGGGG + Intergenic
967571352 3:191032468-191032490 ACACCATGCCTGACACATCGAGG - Intergenic
968677941 4:1895618-1895640 GTCCCATGCCTGGCTCCTGGAGG + Intronic
969648490 4:8448293-8448315 GTGCCAGCCCTAACACATGCTGG - Intronic
972930964 4:44071264-44071286 GTCCCTTGCCTGCCACATTGAGG - Intergenic
977932390 4:102762513-102762535 GTGACTTGCCTGTCACATAGTGG + Intergenic
978742491 4:112152919-112152941 GTAAAATGCCTAACACATGGAGG + Intronic
979223301 4:118254817-118254839 GTGCCTTGCCTGATAGATGCAGG + Intronic
979368818 4:119858557-119858579 GTCCCTTCCATGACACATGGGGG - Intergenic
983270308 4:165553352-165553374 GCACCATGCCTGGTACATGGTGG - Intergenic
984158156 4:176217701-176217723 GTGCAAAGCCTGGCACATGCTGG + Intronic
987241660 5:16006213-16006235 GTGCCATGCCTTAAACCTGCAGG - Intergenic
987433161 5:17861487-17861509 GGGAAATGCCTGATACATGGCGG - Intergenic
992384364 5:76269490-76269512 GTGAGGTGCCTGGCACATGGTGG + Intronic
997206073 5:132050930-132050952 GTGGCATGCCTGGAACCTGGGGG + Intergenic
997243633 5:132327491-132327513 GTGCAATGCCTGGTACATAGTGG - Intronic
997361865 5:133300297-133300319 CTGCCACCCCTGACACCTGGAGG - Intronic
997422040 5:133777050-133777072 GTGCAGTGCCTGGTACATGGTGG - Intergenic
998938255 5:147253960-147253982 GTGCCATGCTTAGCACTTGGAGG - Intronic
999114594 5:149151586-149151608 TTGCTATCCCTGACCCATGGAGG + Intronic
1000048311 5:157540124-157540146 ATGCCATGCCTGGCACAAAGTGG + Intronic
1000342857 5:160290779-160290801 TTGCCATTCCTGAAATATGGAGG - Intronic
1003796410 6:9610221-9610243 GTGCAATTCCTGAGGCATGGAGG + Intronic
1003834133 6:10049687-10049709 GTGTCATGCCAGGCACTTGGGGG - Intronic
1004349603 6:14879642-14879664 GTGCCCTGCCAAGCACATGGTGG + Intergenic
1006275227 6:32999996-33000018 CTGTAATGCCTGAAACATGGTGG - Intergenic
1006421244 6:33935512-33935534 GGGCCCTGCCTGACAGATGAGGG - Intergenic
1007286665 6:40752810-40752832 GTGCCTTCCATGAGACATGGTGG - Intergenic
1008761704 6:54859649-54859671 GTGTCATGCCTAACACTCGGGGG - Intronic
1009483297 6:64188611-64188633 CTGACATGACTGACAAATGGTGG + Intronic
1010433017 6:75800074-75800096 GTGCTATGCCTGACACATATTGG + Intronic
1010903194 6:81453179-81453201 GTACAATGCCTGACACATTGTGG + Intergenic
1011309350 6:85965028-85965050 CTGCCATCCCTGACACTAGGTGG + Intergenic
1011418546 6:87148688-87148710 GTTCAATGCCTGGCACATAGTGG - Intergenic
1012616466 6:101284374-101284396 GTGCCATCCCAGAGAGATGGAGG - Intergenic
1015923277 6:138286687-138286709 ATGCCACGCCTGGAACATGGAGG - Exonic
1017111991 6:150940988-150941010 GCACCGTGCCTGACACTTGGTGG + Intronic
1017433940 6:154398074-154398096 GGGCTCTGCCTGACACACGGAGG + Exonic
1017587798 6:155946679-155946701 GAGCAGTGCCTGGCACATGGAGG - Intergenic
1017700851 6:157069268-157069290 TTCCCATACCTGACACATGCAGG - Intronic
1018442749 6:163828235-163828257 TTGCCAGGCCTCACACTTGGAGG - Intergenic
1018656668 6:166043294-166043316 CTGCCATGACTGATACTTGGAGG + Intergenic
1019497195 7:1346182-1346204 CGGCCATGCCTGGCACATGAGGG + Intergenic
1019640669 7:2101854-2101876 GGCCCACGCCTGACACATGCTGG + Intronic
1019961822 7:4466791-4466813 ATGGAATGCCTGACCCATGGAGG - Intergenic
1020002778 7:4765222-4765244 GTACCATGCCTGGCTCATGCCGG + Exonic
1020673585 7:11151697-11151719 GGGCCATGCATGACTCCTGGGGG - Intronic
1021394961 7:20135944-20135966 GTGCTATGCCTTACACATAGAGG + Exonic
1022326355 7:29335620-29335642 GTGCCTTACCTGACACATGCAGG - Intronic
1022781004 7:33583170-33583192 GCACCATGCCTGACAAGTGGGGG + Intronic
1023287496 7:38634007-38634029 GTCCCTTGCCTGACAGAGGGAGG - Intergenic
1023850573 7:44147804-44147826 CTGCAATGCCTGCTACATGGAGG - Exonic
1025605539 7:63037758-63037780 GTTCCATGCCTGGCACATTGGGG - Intergenic
1025730252 7:64101840-64101862 GTGCAAGTCCTGACACATAGCGG - Intronic
1027226166 7:76244898-76244920 GCCCCATGCCTGCCACATTGTGG - Intronic
1029681857 7:102117065-102117087 GTGCCCTGCCTGCCACCTGCAGG - Intronic
1030288613 7:107850342-107850364 CTGCCATGCGTGATAAATGGTGG - Intergenic
1033646846 7:143311471-143311493 TTGCCATGCAAGATACATGGAGG - Intergenic
1034692761 7:153027168-153027190 GTGCCAAGCCAGACATATGTTGG - Intergenic
1034891563 7:154843974-154843996 GCACCATGCCTTGCACATGGTGG + Intronic
1035256019 7:157628127-157628149 TTGGTTTGCCTGACACATGGAGG - Intronic
1035263086 7:157674125-157674147 TTGCCATGGCTGACACGTGGGGG - Intronic
1035532087 8:361070-361092 GTGCTGTGACTGACACATGTGGG - Intergenic
1035696619 8:1602740-1602762 GAGCAGTGCCTGACACATGGAGG - Intronic
1036032490 8:4990067-4990089 GTGAGATGCTTGAGACATGGGGG + Intronic
1036779429 8:11635278-11635300 GCTCCATGCCTGGCACATTGGGG + Intergenic
1037706472 8:21319684-21319706 GTACAGTGCCTGGCACATGGTGG - Intergenic
1038028817 8:23618457-23618479 GTGTAATGTCTGTCACATGGTGG + Intergenic
1038058574 8:23886395-23886417 GTGCCATGCCTGGCATCTGCTGG + Intergenic
1039838829 8:41279164-41279186 GTGCAATGCCTGACATCAGGGGG + Intronic
1041759298 8:61346692-61346714 GCACCATGCCTTACACAGGGAGG - Intronic
1042625180 8:70749285-70749307 GCTCCATGCCTGCCACATTGTGG + Intronic
1042835845 8:73078575-73078597 GTGCCATGCCTGACTGCTAGAGG - Intronic
1044225760 8:89716434-89716456 GTCCCTTTCTTGACACATGGGGG - Intergenic
1044811185 8:96063913-96063935 GCACAATGCCTGGCACATGGTGG + Intergenic
1047108606 8:121763198-121763220 GTGCAATGCCTGACAGAGGAAGG + Intergenic
1047126556 8:121968638-121968660 GTGCCATTCCAAATACATGGTGG + Intergenic
1048318518 8:133380033-133380055 GTCCCTCCCCTGACACATGGGGG + Intergenic
1049003947 8:139843103-139843125 ATACCATGCCTGGCATATGGTGG + Intronic
1049081701 8:140448350-140448372 GAGCCATGCCTGGCATATGAAGG + Intronic
1049664009 8:143835148-143835170 GTGCCATGCCTGACACCTGCAGG + Exonic
1050098249 9:2090583-2090605 ATACCATGCCAGGCACATGGTGG + Intronic
1052078636 9:24176150-24176172 GTGCTAGGCCTTATACATGGGGG - Intergenic
1052915551 9:33922384-33922406 GAGGCATGGCTGACACATGTCGG + Exonic
1053363963 9:37509718-37509740 CTGCCATGTCTGACACGTGGTGG + Intergenic
1053667732 9:40328092-40328114 GTGCCATGCCTAACACAAGATGG - Intronic
1053917307 9:42953201-42953223 GTGCCATGCCTAACACAAGATGG - Intergenic
1054378876 9:64468131-64468153 GTGCCATGCCTAACACAAGATGG - Intergenic
1054516879 9:66048191-66048213 GTGCCATGCCTAACACAAGATGG + Intergenic
1054760298 9:68998841-68998863 GTGCCATTCATCACACTTGGGGG - Intronic
1056310257 9:85333770-85333792 CTACCATGCCTGGGACATGGAGG - Intergenic
1056690504 9:88804293-88804315 TGGCCATGGCTGCCACATGGTGG + Intergenic
1057394614 9:94668805-94668827 TTGCCATCCCTGGGACATGGAGG - Intergenic
1058771622 9:108239486-108239508 CTAGCATGCTTGACACATGGAGG - Intergenic
1059530372 9:115030128-115030150 TTGCAAGGCCTCACACATGGGGG + Intronic
1060505533 9:124195371-124195393 GAGCCAGGCCTCTCACATGGTGG + Intergenic
1060521609 9:124297217-124297239 GCCCCATGTCTGTCACATGGAGG + Intronic
1060739690 9:126090191-126090213 TTGCAATTCCTGACACATGGTGG - Intergenic
1061594682 9:131621256-131621278 GTGCCATGTCTGAAACAGAGTGG + Intronic
1061898200 9:133659399-133659421 GTACCACGCCTGGCACAGGGAGG - Intergenic
1062070642 9:134553428-134553450 GCGCCAGGCCTGGCACATGCTGG - Intergenic
1186796072 X:13047708-13047730 GCGCCATGGCTGGCACATGGTGG + Intergenic
1187782057 X:22838046-22838068 GTGAAGTGCCTGACACTTGGTGG - Intergenic
1187842698 X:23505381-23505403 GAGCAGTGCCTGACATATGGTGG - Intergenic
1188308003 X:28582477-28582499 GAACCATGCCTGGCACATAGTGG + Intergenic
1189926043 X:45956623-45956645 GAACCATTCCTGGCACATGGTGG - Intergenic
1192615613 X:72618457-72618479 ATACAATGCCTGGCACATGGTGG - Intronic
1194305655 X:92244809-92244831 GTGCTATGCCTGTCACATAGTGG + Intronic
1198122419 X:133607322-133607344 GCACAATGCCTGACACATAGTGG + Intronic
1198428208 X:136540706-136540728 CCACAATGCCTGACACATGGAGG + Intronic
1199415817 X:147582082-147582104 GTGCAGTGCCTGACACATTGTGG - Intergenic