ID: 1105255816

View in Genome Browser
Species Human (GRCh38)
Location 13:18743565-18743587
Sequence AGGGAGTCCCACTTCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 2, 2: 6, 3: 19, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105255816_1105255820 6 Left 1105255816 13:18743565-18743587 CCACATCTGAAGTGGGACTCCCT 0: 1
1: 2
2: 6
3: 19
4: 119
Right 1105255820 13:18743594-18743616 GCAGCCAAGAAATCTACAGATGG 0: 3
1: 0
2: 4
3: 9
4: 170
1105255816_1105255823 28 Left 1105255816 13:18743565-18743587 CCACATCTGAAGTGGGACTCCCT 0: 1
1: 2
2: 6
3: 19
4: 119
Right 1105255823 13:18743616-18743638 GAAGAATGCTCTGGTGAGATAGG 0: 2
1: 2
2: 9
3: 20
4: 193
1105255816_1105255822 19 Left 1105255816 13:18743565-18743587 CCACATCTGAAGTGGGACTCCCT 0: 1
1: 2
2: 6
3: 19
4: 119
Right 1105255822 13:18743607-18743629 CTACAGATGGAAGAATGCTCTGG 0: 4
1: 0
2: 2
3: 22
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105255816 Original CRISPR AGGGAGTCCCACTTCAGATG TGG (reversed) Intergenic
900265861 1:1756901-1756923 AGGAAGGCCCACGTCAGATGTGG + Intronic
902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG + Intronic
906622131 1:47291029-47291051 AGGGAGGCCGACTTAAGGTGAGG - Intronic
907175405 1:52516864-52516886 AGGGAGACCAACTTTAGATATGG + Intronic
908407464 1:63829437-63829459 AGGGATTCCTAATTCAGATGTGG + Intronic
909922667 1:81401209-81401231 AGGCAGTACCACTTCAGCTCAGG + Intronic
914902115 1:151716484-151716506 AGGGGGGCCCACTCCTGATGTGG + Exonic
917421706 1:174870327-174870349 ATGAAGTCCCTCTGCAGATGGGG - Intronic
921925566 1:220707577-220707599 AGGAAGTCACACCTTAGATGCGG - Intergenic
922332692 1:224591328-224591350 AGGGAGTCCCACTGAAGAGCTGG - Intronic
923337113 1:232979927-232979949 ATGGGGTCCCACTCCAGCTGGGG - Exonic
1062953106 10:1520006-1520028 TGGGAATTCCACTTCAGAAGAGG + Intronic
1062969175 10:1633019-1633041 AGGGAGGCCCACTCCAGCAGAGG - Intronic
1063007818 10:1990630-1990652 AAGAAGTCCCCCTTCTGATGTGG - Intergenic
1063552044 10:7042583-7042605 AGGCAGTCCAGCTTCAGCTGAGG - Intergenic
1067786846 10:49256469-49256491 CAGGAGCCCCACTCCAGATGGGG - Intergenic
1069875493 10:71560448-71560470 AGGAAGTCCCACTTGAGGAGGGG + Intronic
1075104456 10:119529126-119529148 ATGGAATGTCACTTCAGATGGGG + Intronic
1077534929 11:3119489-3119511 AAGGGGGCCCACTTCAGGTGGGG + Intronic
1079302528 11:19290931-19290953 GGGGAGTCCCGCTTTAGATAGGG - Intergenic
1080952262 11:37048555-37048577 AAGGACTTCCACTTCAGATGCGG + Intergenic
1081403077 11:42665338-42665360 AAGGAGGCTCTCTTCAGATGAGG - Intergenic
1090237865 11:125162986-125163008 AGGGAAGCCCTCTTCAGATAAGG - Intergenic
1101939466 12:109089328-109089350 AGGGAAGGTCACTTCAGATGGGG - Intronic
1102788602 12:115624372-115624394 TGGGAGTCACACTCCAGCTGTGG + Intergenic
1104645644 12:130495419-130495441 AGGGGGTGACACTTCAGCTGAGG - Intronic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1107658583 13:42616271-42616293 AGGTAGTGCCACTGCACATGTGG + Intergenic
1110699158 13:78526562-78526584 AGGTAGGCCCCCTTCAGCTGTGG - Intergenic
1112229879 13:97578780-97578802 AGGGGATGCCACTTGAGATGAGG + Intergenic
1115491100 14:33959010-33959032 ATGGAGTCAGACTTCTGATGAGG - Intronic
1118865546 14:69700644-69700666 AGGAAGTAGCACTTCAGATGGGG - Intronic
1120194492 14:81467408-81467430 ATGGTGGCCCTCTTCAGATGAGG - Intergenic
1120628517 14:86859437-86859459 AGGGAGACTCACTTCAGCTCAGG - Intergenic
1123067801 14:105627089-105627111 CTGGAGTCCCACTGCAGGTGGGG + Intergenic
1123071820 14:105645814-105645836 CTGGAGTCCCACTGCAGGTGGGG + Intergenic
1123091484 14:105744090-105744112 CTGGAGTCCCACTGCAGGTGGGG + Intergenic
1123097253 14:105772431-105772453 CTGGAGTCCCACTGCAGGTGGGG + Intergenic
1123098258 14:105776555-105776577 CTGGAGTCCCACTGCAGGTGGGG - Intergenic
1123120652 14:105914873-105914895 AGTGAGGCCCAGGTCAGATGAGG + Intergenic
1126344091 15:47674869-47674891 AGGAATTCCCACTTCTGCTGGGG - Intronic
1130385148 15:83404651-83404673 AGAGAGACCCAATTCAGAAGGGG - Intergenic
1133629103 16:7602256-7602278 GGGGAGTGCAAATTCAGATGTGG + Intronic
1136518527 16:30782188-30782210 AGGGCTTCCCACTTAAGAAGGGG + Exonic
1137017030 16:35387766-35387788 AGTGAAGCCCAATTCAGATGAGG - Intergenic
1138231424 16:55339692-55339714 AAGGAGCCCCACCTCAGTTGAGG - Intergenic
1138792354 16:59920798-59920820 AGGGAGACCCTCTTCCTATGAGG + Intergenic
1143511574 17:7398442-7398464 AGGGTGTGCCCCTTCAGATGTGG + Intronic
1147877177 17:43629891-43629913 ATGAAGTCCCACTTCAGGTGAGG + Intergenic
1148450071 17:47771701-47771723 AGTGTGTCACACTTAAGATGTGG + Intergenic
1148699286 17:49578264-49578286 AGGGAGTCCCCAGTCTGATGGGG - Intronic
1148836142 17:50466883-50466905 GGGGACTCCAACTTCAGCTGGGG + Intronic
1154203006 18:12312473-12312495 AGACAGTCCCACTTGTGATGAGG - Intronic
1154435209 18:14337109-14337131 AGGGAGTCCCACTTCAGGTGTGG + Intergenic
1160293658 18:77618044-77618066 AGGGAGGAGCACTTCTGATGTGG + Intergenic
1162783791 19:13021744-13021766 GGGGAGTCCCACTTCTGAGGGGG - Intronic
1165106558 19:33473197-33473219 TAGGAGTCCCACTTCCCATGTGG + Intronic
1165186583 19:34027589-34027611 AGGGAGACCAACTTCAGAAGAGG + Intergenic
1168713205 19:58513268-58513290 TCGGAGACCCACCTCAGATGTGG + Intergenic
925628160 2:5862699-5862721 ACGGAGTCCCTGTTCAGGTGAGG + Intergenic
928639963 2:33288066-33288088 AGTGAGTACCACTTGAGATAGGG - Intronic
928858718 2:35830091-35830113 GGGGATGTCCACTTCAGATGGGG + Intergenic
931592022 2:63894949-63894971 AGGGAATCGGACTGCAGATGGGG + Intronic
934219558 2:90069597-90069619 AGGCAGGACCACTTCAGATGTGG - Intergenic
934490816 2:94761124-94761146 AGGGAGTCCCATTTCAGGTGTGG - Intergenic
937225379 2:120365905-120365927 AGGGAGGCCTGCTTCAGATGGGG + Intergenic
938278739 2:130050274-130050296 AGGGAGTCCCCTTTCAGGTGTGG - Intergenic
938329713 2:130441133-130441155 AGGGAGTCCCCTTTCAGGTGTGG - Intergenic
938360233 2:130680370-130680392 AGGGAGTCCCCTTTCAGGTGTGG + Intergenic
938436636 2:131287078-131287100 AGGGAGTCCCCTTTCAGGTGTGG + Intronic
938745504 2:134274396-134274418 AGGCAGTCCCACTTCTTAGGCGG - Intronic
940168348 2:150800032-150800054 AGGAAGACCCACTTTAAATGTGG + Intergenic
942676282 2:178429671-178429693 AGGAAGTGTGACTTCAGATGAGG + Intergenic
948529554 2:238595638-238595660 AGGGACTCTCGCTGCAGATGAGG - Intergenic
1172441569 20:34970076-34970098 AGGCAGCCTCACTTTAGATGAGG + Intergenic
1172904995 20:38362718-38362740 AGGGAGTATCACTTCAGTTCAGG + Intronic
1173152962 20:40583537-40583559 AGTGAGTCCCACTTCCCAAGGGG + Intergenic
1175829503 20:61954377-61954399 AAGGGGTCCCACTGCAGCTGGGG + Intronic
1176841829 21:13848592-13848614 AGGGAGTCCCACTTCAGGTGTGG - Intergenic
1178000575 21:28158183-28158205 AGGAATTCCCATTTCAGATGTGG - Intergenic
1178890596 21:36517995-36518017 AGTGAGTCCCAAATCTGATGGGG - Intronic
1179023471 21:37659675-37659697 GGCAAGTCCCACATCAGATGGGG - Intronic
1179651922 21:42816726-42816748 AGGAAGGCCCTCATCAGATGTGG - Intergenic
1179710061 21:43208149-43208171 AGGGGGTCCCAGTTCAGCTGTGG + Intergenic
1182882782 22:33747811-33747833 AGGGTTTACCATTTCAGATGAGG - Intronic
1183106774 22:35620609-35620631 AGGGGGCCCCAGGTCAGATGTGG - Intronic
1183221602 22:36517548-36517570 AGGGAGACCCACTTTAGGAGAGG - Intronic
953126873 3:40099149-40099171 AGGGGGACCCACATCAGAAGAGG + Intronic
953800266 3:46017615-46017637 AGGGATTTCCACTCCAGTTGAGG + Exonic
954304292 3:49717365-49717387 AGGGAGTCCCATTTCACCAGAGG + Exonic
958549430 3:95594407-95594429 AGGTAGTCCCCCTTACGATGGGG + Intergenic
963593713 3:147298513-147298535 TGGGCCTCCCACTTCAGGTGTGG - Intergenic
964449967 3:156802583-156802605 AGGAAGTGCCATTTCAAATGAGG - Intergenic
969133601 4:5011828-5011850 AGCAAGTCCCGCTTCTGATGGGG + Intergenic
969511789 4:7622225-7622247 AGGGTGACCCACTTCAAAAGGGG + Intronic
969544475 4:7816066-7816088 AGAGAGACCCAGCTCAGATGGGG - Exonic
969965294 4:10987686-10987708 AAGGAGTCCCTCTTTAGATCTGG - Intergenic
975416649 4:74112568-74112590 ACAGAGTCCCTGTTCAGATGTGG + Intergenic
976437519 4:85034842-85034864 AGGAAGACCCACTTCAGAAAGGG - Intergenic
981114857 4:140977514-140977536 AGGTAGACTGACTTCAGATGTGG - Intronic
981588513 4:146330490-146330512 AGGGGTTCGCACTTTAGATGAGG - Intronic
981925213 4:150131819-150131841 AGGGAGGCTCACTTCTGCTGAGG - Intronic
984502103 4:180569447-180569469 AGGGATTCCCTCCTCAGATTTGG - Intergenic
985301858 4:188498547-188498569 AGGGAGTCCTGTTTCAGAAGGGG + Intergenic
985623318 5:967934-967956 GGGGAGTCCCCCTTCAGAGCAGG - Intergenic
987001393 5:13663678-13663700 AGGGCTTTCCTCTTCAGATGTGG - Intergenic
988789515 5:34594361-34594383 AGGAAGGCCCTCATCAGATGTGG + Intergenic
992877554 5:81072533-81072555 AGGGTTTCTCACTTTAGATGTGG - Intronic
997464485 5:134078269-134078291 AGGGAGACCCACTCCAGCTGTGG + Intergenic
1000023526 5:157339260-157339282 AGGGAGTCCCTGTGCAGAGGGGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1004532458 6:16465871-16465893 GGGGAGGCCCACTACAGGTGAGG + Intronic
1005811614 6:29520323-29520345 AAGGAATCCCCCTGCAGATGTGG + Intergenic
1006530960 6:34653451-34653473 TGGGAGGATCACTTCAGATGAGG - Intronic
1007334012 6:41138376-41138398 AGGGATTCAGACCTCAGATGGGG + Intergenic
1008036472 6:46750125-46750147 AGAGAGTGCCACTTGAGATGGGG - Intronic
1010645410 6:78381932-78381954 AGGGTGTCTCAGTTCATATGGGG - Intergenic
1012230350 6:96753830-96753852 GGGGAGTATCACTTGAGATGGGG - Intergenic
1019915842 7:4131941-4131963 AGGGAATCCGAGCTCAGATGAGG + Intronic
1023263961 7:38385921-38385943 AGGAAATTCCAGTTCAGATGAGG + Intronic
1024575872 7:50763811-50763833 GCTGAGTCCCAGTTCAGATGAGG - Intronic
1029412004 7:100419255-100419277 AGGGAAGCCTCCTTCAGATGAGG + Intronic
1029693964 7:102201306-102201328 AGGGCGGCCCCCTTCAGCTGGGG - Intronic
1033237282 7:139648406-139648428 AGGGAGTCACAGTTCAGACCAGG + Intronic
1033352197 7:140570582-140570604 AGCGTGTCCCTCTGCAGATGGGG - Intronic
1033995011 7:147334695-147334717 AGGGAGTCACACTGCAGAGAGGG - Intronic
1035044153 7:155953045-155953067 AGGGAGAGCCATGTCAGATGTGG + Intergenic
1036225283 8:6952824-6952846 TGGGAGTCACAGTTCAGATTGGG + Intergenic
1040105465 8:43539106-43539128 AGGGAGTCCCCCTGCAGGTTTGG + Intergenic
1043873343 8:85459589-85459611 AGGAAATCCTACTTTAGATGCGG - Intergenic
1048831522 8:138482138-138482160 AGGAAGTGCCACTTCAGCAGAGG + Intronic
1051152194 9:14094435-14094457 GTTGAGTTCCACTTCAGATGAGG + Intronic
1052764034 9:32622257-32622279 AGGGAGCACCAAGTCAGATGAGG + Intergenic
1052881305 9:33602387-33602409 AGGGAGTCCCATTTCAGGTGTGG + Intergenic
1053495014 9:38543455-38543477 AGGGAGTCCCATTTCAGGTGTGG - Intronic
1053667183 9:40324570-40324592 AGGGAGTCCCATTTCAGGTGTGG + Intronic
1053916763 9:42949675-42949697 AGGGAGTCCTATTTCAGGTGTGG + Intergenic
1054378327 9:64464598-64464620 AGGGAGTCCCATTTCAGGTGTGG + Intergenic
1054517427 9:66051713-66051735 AGGGAGTCCCATTTCAGGTGTGG - Intergenic
1054712428 9:68524676-68524698 GATGAGTCCCACATCAGATGAGG - Intronic
1056175640 9:84032381-84032403 TGGGAGTGCCACTTCAGCAGAGG - Intergenic
1059124805 9:111674293-111674315 AGTGAGTCCCACCTCAAAAGAGG - Intergenic
1060657977 9:125385875-125385897 AGGAAGACCCACTGCAGGTGAGG - Intergenic
1061677645 9:132227470-132227492 TGGGACCCCCACTTCAGGTGAGG + Intronic
1062638764 9:137506054-137506076 AGGCAGTGCCACTTCTGATCTGG - Exonic
1192336113 X:70221262-70221284 TGGGAGTCCTATTTCAGCTGGGG + Intergenic
1193267832 X:79494335-79494357 AGGCAGTCCTACTTGAGCTGCGG - Intergenic