ID: 1105257199

View in Genome Browser
Species Human (GRCh38)
Location 13:18751649-18751671
Sequence AAGATGCGCAGGTACAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 34, 2: 36, 3: 65, 4: 538}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105257199_1105257207 18 Left 1105257199 13:18751649-18751671 CCCAAGCTGTACCTGCGCATCTT 0: 1
1: 34
2: 36
3: 65
4: 538
Right 1105257207 13:18751690-18751712 GGACCTGGAGCTGGAGCCACAGG 0: 1
1: 1
2: 9
3: 96
4: 595
1105257199_1105257210 26 Left 1105257199 13:18751649-18751671 CCCAAGCTGTACCTGCGCATCTT 0: 1
1: 34
2: 36
3: 65
4: 538
Right 1105257210 13:18751698-18751720 AGCTGGAGCCACAGGGATGCAGG 0: 1
1: 0
2: 45
3: 309
4: 1359
1105257199_1105257205 3 Left 1105257199 13:18751649-18751671 CCCAAGCTGTACCTGCGCATCTT 0: 1
1: 34
2: 36
3: 65
4: 538
Right 1105257205 13:18751675-18751697 ATCATGGCTGGAGATGGACCTGG 0: 1
1: 0
2: 4
3: 27
4: 220
1105257199_1105257204 -3 Left 1105257199 13:18751649-18751671 CCCAAGCTGTACCTGCGCATCTT 0: 1
1: 34
2: 36
3: 65
4: 538
Right 1105257204 13:18751669-18751691 CTTTCAATCATGGCTGGAGATGG 0: 1
1: 1
2: 23
3: 112
4: 591
1105257199_1105257203 -9 Left 1105257199 13:18751649-18751671 CCCAAGCTGTACCTGCGCATCTT 0: 1
1: 34
2: 36
3: 65
4: 538
Right 1105257203 13:18751663-18751685 GCGCATCTTTCAATCATGGCTGG 0: 1
1: 1
2: 14
3: 59
4: 102
1105257199_1105257208 19 Left 1105257199 13:18751649-18751671 CCCAAGCTGTACCTGCGCATCTT 0: 1
1: 34
2: 36
3: 65
4: 538
Right 1105257208 13:18751691-18751713 GACCTGGAGCTGGAGCCACAGGG 0: 1
1: 0
2: 3
3: 58
4: 426
1105257199_1105257206 9 Left 1105257199 13:18751649-18751671 CCCAAGCTGTACCTGCGCATCTT 0: 1
1: 34
2: 36
3: 65
4: 538
Right 1105257206 13:18751681-18751703 GCTGGAGATGGACCTGGAGCTGG 0: 1
1: 0
2: 35
3: 120
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105257199 Original CRISPR AAGATGCGCAGGTACAGCTT GGG (reversed) Intergenic
900906437 1:5562897-5562919 CAGAGGCCCAGGTACAGCTTGGG - Intergenic
902540689 1:17152405-17152427 AAGGGGCCCAGGTACAGCTTGGG + Intergenic
904614055 1:31740335-31740357 ATGATGTGCAGGTACTGCCTAGG - Exonic
905002019 1:34680047-34680069 AAGGGGCCCAGGTACAGCTCGGG - Intergenic
906310880 1:44753460-44753482 AAGATGCATAGGAAGAGCTTGGG + Intronic
908539814 1:65111739-65111761 AAGGGCCCCAGGTACAGCTTGGG - Intergenic
909105182 1:71397953-71397975 ATGAAGCCAAGGTACAGCTTGGG + Exonic
909167424 1:72246983-72247005 CAGAAGCCCAGGTACAGCTCGGG - Intronic
909373487 1:74914094-74914116 AAAAGGCCAAGGTACAGCTTGGG - Intergenic
909439841 1:75685115-75685137 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
910414353 1:86982109-86982131 AAGGGGCCAAGGTACAGCTTAGG - Intronic
910512921 1:88025946-88025968 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
910649602 1:89551222-89551244 AAGATGAACAGGTATAGCTCAGG - Intronic
911235107 1:95404104-95404126 AAGAGGCCCAGGTAAAGCTCAGG + Intergenic
911790913 1:102014403-102014425 AAGAGGCCAAGGTACAGCTTGGG + Intergenic
912073145 1:105839339-105839361 AAAAGGCCAAGGTACAGCTTGGG + Intergenic
912084011 1:105976820-105976842 AAGGTGCCAAGATACAGCTTGGG + Intergenic
912113496 1:106372948-106372970 AAGAGGCCAAGGTACAACTTGGG - Intergenic
912178333 1:107187916-107187938 AAAATTCTCAGTTACAGCTTTGG + Intronic
912735915 1:112149468-112149490 AAGAGGCCAAGGTACAGCTTGGG + Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
912809492 1:112783163-112783185 AAGGTGCCCATGTACAGCTCAGG - Intergenic
913710010 1:121473319-121473341 AACAGGCCAAGGTACAGCTTGGG - Intergenic
914857381 1:151362620-151362642 AAGGGGCCCAGGTATAGCTTGGG + Intergenic
914954445 1:152148131-152148153 AAGGGCCCCAGGTACAGCTTGGG - Intergenic
915946487 1:160156039-160156061 ACGATGCTCAGGTAGAGCTGAGG - Exonic
916035847 1:160921948-160921970 AAGGTGCCAAGGTACAGCTCAGG + Intergenic
916477376 1:165183233-165183255 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
916736039 1:167607824-167607846 AAGAGGCCCAGGTACAACTCAGG + Intergenic
917002502 1:170375160-170375182 AAGGGGCCCAGGTACAGCTTGGG - Intergenic
917498047 1:175560129-175560151 AAGCTGAGCAGGTACAGACTGGG - Intronic
917777468 1:178352867-178352889 AAGGGACCCAGGTACAGCTTAGG - Intronic
918757698 1:188358114-188358136 AAGGAGCCCAGGTACAGCTTGGG - Intergenic
919156813 1:193776125-193776147 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
919291945 1:195643793-195643815 AAGGAGCCAAGGTACAGCTTGGG - Intergenic
921089252 1:211828022-211828044 AAAATGTGCAGGTGCAGCCTAGG + Intronic
921128022 1:212195412-212195434 AAGGAGCCCAGGTATAGCTTGGG + Intergenic
922224045 1:223629868-223629890 AAGATGCACAGGTAGGACTTTGG - Intronic
922530449 1:226341231-226341253 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
923878385 1:238075568-238075590 AAGGAGCCAAGGTACAGCTTTGG - Intergenic
924648669 1:245903759-245903781 AAGAGGCCAAGGTACAGCTCAGG - Intronic
1064057073 10:12106686-12106708 ACGGTGAGCAGGTACTGCTTCGG - Intronic
1064584179 10:16823017-16823039 AAGGGGCCCAGGTACAGCTTGGG + Intergenic
1065534208 10:26701497-26701519 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1066695877 10:38077118-38077140 AAGGGGCCCAGGTGCAGCTTGGG - Intergenic
1067206087 10:44215225-44215247 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1067456454 10:46422738-46422760 AAGATGCACAGGGAGAGGTTTGG + Intergenic
1067630746 10:47961901-47961923 AAGATGCACAGGGAGAGGTTTGG - Intergenic
1068011302 10:51455164-51455186 AAGAGGCCAAGGTAGAGCTTGGG - Intronic
1069380835 10:67842027-67842049 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1069562513 10:69440823-69440845 AAGATGCGCAGTTGCACCTGGGG + Intergenic
1071327774 10:84534091-84534113 AAGGTGCCAAGGTACAGCTCGGG + Intergenic
1071508227 10:86245725-86245747 AAGTGGGGCAGGGACAGCTTTGG - Intronic
1071859314 10:89656241-89656263 AAGAGGCCAAGGTACAGCTCAGG + Intergenic
1071981040 10:91004504-91004526 AAGAGGCCAAGGTACAGCTCGGG - Intergenic
1074640231 10:115370999-115371021 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1075281673 10:121144079-121144101 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1075465924 10:122650097-122650119 AAGCTGTCCAGGTACAGGTTAGG + Intergenic
1076235443 10:128860762-128860784 CAGGTGGGCAGGGACAGCTTAGG - Intergenic
1076662687 10:132065804-132065826 AAGGTGCACAGGGAGAGCTTGGG + Intergenic
1077426230 11:2479507-2479529 AAGGTGTCAAGGTACAGCTTGGG - Intronic
1077827449 11:5826446-5826468 AAGAGGCCAAGGTACGGCTTGGG + Intronic
1077937255 11:6801122-6801144 AAGGGGCCCAGGTACAGCTCAGG - Intergenic
1078698602 11:13659728-13659750 AAGGAGCCCAGGTGCAGCTTGGG + Intergenic
1079554323 11:21740404-21740426 AAAGTTCCCAGGTACAGCTTGGG - Intergenic
1079737328 11:24013147-24013169 AAGGAGCCCAGTTACAGCTTGGG + Intergenic
1079744398 11:24106827-24106849 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1079972992 11:27059185-27059207 AAGGGGCCCAGGTACAGGTTGGG + Intronic
1080982399 11:37424091-37424113 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1081238894 11:40679595-40679617 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1081354396 11:42095168-42095190 AAGAGGCCAAGGTACTGCTTGGG + Intergenic
1081376771 11:42368360-42368382 AAGAGACCAAGGTACAGCTTGGG + Intergenic
1082711738 11:56561096-56561118 AAAGTGCCAAGGTACAGCTTGGG + Intergenic
1082733148 11:56824777-56824799 AAGGGACCCAGGTACAGCTTGGG - Intergenic
1083136120 11:60678304-60678326 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1083713496 11:64562655-64562677 AAGATGGGCTGGCACAGCATTGG + Intronic
1085651518 11:78272912-78272934 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1086750700 11:90490142-90490164 AAGGAGCCAAGGTACAGCTTCGG + Intergenic
1087628314 11:100621797-100621819 AAAAAGCCCAGGTACAGCTTTGG - Intergenic
1087668951 11:101083134-101083156 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1088484732 11:110329584-110329606 AAGGGGCCCAGGTACAGCTCAGG - Intergenic
1088989429 11:114939046-114939068 AAGGTGCCCAGTTACAGCTCAGG + Intergenic
1089746165 11:120618693-120618715 AAGGGGCCCAGGTACAGCGTGGG + Intronic
1090319650 11:125831230-125831252 AAGGGGCTCTGGTACAGCTTGGG - Intergenic
1092593650 12:9975901-9975923 AAGAGGCTAAGGTACAGCTCAGG + Intronic
1093371890 12:18375848-18375870 AAGGGGCGCAGGTACCGCTTGGG + Intronic
1093570509 12:20661611-20661633 AAGAGGCCAAGGTACAGCTTGGG + Intronic
1094379879 12:29831258-29831280 AAGAGGCCCAGGTACAGCTTGGG - Intergenic
1094397625 12:30025075-30025097 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1094471374 12:30804560-30804582 AAGGGGCCCAGGTACAGCTCCGG - Intergenic
1095572821 12:43701773-43701795 AGGATGGGCAAATACAGCTTAGG + Intergenic
1096886902 12:54727180-54727202 AACAGGCCAAGGTACAGCTTGGG - Intergenic
1096904910 12:54926561-54926583 AAGAGGCCAAGGTACAGGTTGGG + Intergenic
1097411001 12:59253022-59253044 AAGAGGCCAAAGTACAGCTTGGG + Intergenic
1097467212 12:59941905-59941927 AAGATTCCCTGGTACTGCTTGGG + Intergenic
1098167374 12:67712117-67712139 AAGTTGAGGAGGTAGAGCTTTGG + Intergenic
1098630905 12:72720639-72720661 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1098774878 12:74600219-74600241 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1098830935 12:75361537-75361559 AACAGGCTGAGGTACAGCTTGGG - Intronic
1098939558 12:76518754-76518776 AAGGGGCCCAGGTACAGCTTGGG - Intronic
1099386432 12:82018769-82018791 AAGGGGCCCAAGTACAGCTTGGG + Intergenic
1099760281 12:86912291-86912313 AAGAGGCCAAGGTACAGCTCAGG + Intergenic
1099860717 12:88222441-88222463 AAGGTGCCCAGGTATAGCTTGGG + Intergenic
1099984653 12:89648890-89648912 AAGGGGCCCAGGAACAGCTTGGG + Intronic
1100060277 12:90566528-90566550 AAGGTGCTGAGATACAGCTTGGG - Intergenic
1100123405 12:91395119-91395141 AAGAGGTCAAGGTACAGCTTGGG + Intergenic
1100747503 12:97661861-97661883 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
1100787657 12:98095920-98095942 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1100933639 12:99638881-99638903 AAGGTGCCAAGGTACAGCTCGGG + Intronic
1101083751 12:101214654-101214676 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1101635914 12:106541208-106541230 AAGGTGCCCAGATACAGCTTAGG - Intronic
1103876514 12:124131658-124131680 AAGATGAGAAGTTACAGTTTAGG + Intronic
1104076494 12:125394352-125394374 AAGGTGGGCAGCGACAGCTTGGG + Intronic
1104830020 12:131743963-131743985 AAGGGGCCAAGGTACAGCTTAGG - Intronic
1105257199 13:18751649-18751671 AAGATGCGCAGGTACAGCTTGGG - Intergenic
1105259863 13:18771011-18771033 AAGATGCACAGGTACAGCTTGGG - Intergenic
1105262543 13:18790334-18790356 AAGATGCACAGGTACAGCTTGGG - Intergenic
1105264464 13:18803790-18803812 AAGATGCACAGGTACAGCTTGGG - Intergenic
1105321221 13:19324040-19324062 ATGGGGCTCAGGTACAGCTTGGG - Intergenic
1105650548 13:22372363-22372385 AAGAGGCCAAGGTACAGCTTGGG - Intergenic
1105657510 13:22456857-22456879 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1106440957 13:29769661-29769683 AAGATGATCAGCTAAAGCTTTGG - Intronic
1106614438 13:31313957-31313979 AAGAGGCCAAAGTACAGCTTGGG + Intronic
1106734772 13:32577931-32577953 AAGAGGCCCAGGTACAGCTCAGG + Intergenic
1107330691 13:39296493-39296515 AAGGGGCCAAGGTACAGCTTAGG + Intergenic
1107343847 13:39438722-39438744 AAGGGGCCCAGGTAAAGCTTAGG + Intronic
1108731657 13:53241758-53241780 CAGAAACGCAGGTGCAGCTTGGG + Intergenic
1109091506 13:58052149-58052171 AAACGGCCCAGGTACAGCTTGGG + Intergenic
1109252185 13:60032540-60032562 AAGTGGCCCTGGTACAGCTTGGG - Intronic
1109334874 13:60981312-60981334 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1109503618 13:63270241-63270263 AAGAGGCCCAGGTACAGCTTGGG - Intergenic
1110189480 13:72714685-72714707 AAGTGGCCCAGGTATAGCTTGGG + Intronic
1110892945 13:80713016-80713038 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1111336860 13:86836635-86836657 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
1111343098 13:86913902-86913924 AAGTGGCAAAGGTACAGCTTTGG + Intergenic
1111479928 13:88811073-88811095 TAGGGGCCCAGGTACAGCTTGGG + Intergenic
1111584041 13:90261534-90261556 AAGGGGCTCAGGTACAGCTCAGG - Intergenic
1111856996 13:93650798-93650820 AAGATGCACAAGTGCACCTTTGG + Intronic
1112451005 13:99509564-99509586 AAGAGGCTGAGGTACAGCTTGGG - Intronic
1112512230 13:100020143-100020165 AAGAGGCCAAGGTACAGCTCGGG + Intergenic
1113212593 13:108001116-108001138 AAGATGCCAAGGTACAGCTCTGG + Intergenic
1114140217 14:19901259-19901281 AAGGGTCCCAGGTACAGCTTGGG + Intergenic
1114564026 14:23614813-23614835 AAGGTGGGCAGGTACAGGTTAGG + Intergenic
1114651473 14:24287394-24287416 ATGATGCGAGGGAACAGCTTTGG - Intergenic
1114986727 14:28238852-28238874 AAGGGGCTAAGGTACAGCTTGGG + Intergenic
1115051872 14:29072715-29072737 AAGAGGCCAAGGTATAGCTTGGG - Intergenic
1115121378 14:29941729-29941751 AAGGGGGCCAGGTACAGCTTGGG + Intronic
1115134781 14:30095573-30095595 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1115340725 14:32290922-32290944 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1115473990 14:33796941-33796963 CAGATGCACAGGTGCACCTTGGG - Intronic
1115878765 14:37891792-37891814 AAGAGGCCAAGGTACAGCTTGGG + Intronic
1116369335 14:44109759-44109781 AACACGCCCAGGTACAGTTTGGG + Intergenic
1116630244 14:47321471-47321493 AAGCTGAGCAGGTAGAGGTTAGG - Intronic
1116811130 14:49541073-49541095 AAGGGGCTCAGGTACAACTTGGG + Intergenic
1117881820 14:60320038-60320060 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1117886722 14:60371817-60371839 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1118755259 14:68838488-68838510 CAGGAGCCCAGGTACAGCTTGGG + Intergenic
1119025760 14:71151049-71151071 AAGCAGCCCAGGTACAGCTCAGG + Intergenic
1119450158 14:74702425-74702447 AAGGAGCCAAGGTACAGCTTGGG - Intronic
1119561334 14:75592276-75592298 AATAGCCCCAGGTACAGCTTGGG - Intronic
1120270639 14:82309499-82309521 AAGAAGCCAAGATACAGCTTAGG + Intergenic
1120342932 14:83245068-83245090 AAGAGGCTGAGGTACAGCTTGGG + Intergenic
1120457764 14:84754428-84754450 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1120519877 14:85514092-85514114 AAGATTGGCATGTACAGCTAAGG + Intergenic
1120636964 14:86965008-86965030 AAGAGACCAAGGTACAGCTTGGG + Intergenic
1120808922 14:88782642-88782664 AAGAGGCCAAGGTACAGCTCAGG + Intronic
1120818107 14:88884203-88884225 AAGAGGCCAAGGTACAGCTTAGG - Intergenic
1121166500 14:91807002-91807024 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1121672555 14:95723993-95724015 AACAGCCCCAGGTACAGCTTGGG + Intergenic
1122379960 14:101295783-101295805 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1202833983 14_GL000009v2_random:64278-64300 AAGATGCACAGGTACAGCTTGGG + Intergenic
1125230772 15:37452788-37452810 AAGAGACCAAGGTACAGCTTGGG + Intergenic
1125407822 15:39371387-39371409 AAGAGGCCCAGATACAGTTTGGG - Intergenic
1127043446 15:55001923-55001945 AAGGGTCTCAGGTACAGCTTAGG - Intergenic
1128119791 15:65137179-65137201 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1128477020 15:68006087-68006109 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1128642760 15:69351885-69351907 AAGAAGCGCATGAACACCTTGGG + Intronic
1128747972 15:70127924-70127946 AGGATGCACAGGGACAGCTCTGG - Intergenic
1129692812 15:77723495-77723517 GAGAGGCGCAGGTAAAGCCTGGG - Intronic
1129900489 15:79144405-79144427 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
1129901064 15:79149819-79149841 AAGGAGCCAAGGTACAGCTTGGG - Intergenic
1131198870 15:90379612-90379634 AAGGGGCCCAAGTACAGCTTGGG - Intergenic
1131659503 15:94498822-94498844 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1132121965 15:99183978-99184000 AAGGGGCAAAGGTACAGCTTGGG + Intronic
1133504599 16:6399116-6399138 AAGAGGCCAAGGTACAGCTCAGG - Intronic
1138798858 16:60001797-60001819 AAGGGGCCAAGGTACAGCTTAGG + Intergenic
1141317812 16:82978546-82978568 AAGAGGCCAAGGTACAGCTCAGG + Intronic
1142681901 17:1554936-1554958 GAGAGGCACAGGGACAGCTTGGG - Intronic
1143455989 17:7068129-7068151 AAGGGGCCCAGGTACAGCTTGGG - Intergenic
1144538537 17:16115152-16115174 AAGGGGCCAAGGTACAGCTTGGG - Intronic
1149116040 17:53097624-53097646 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1149339689 17:55672597-55672619 AAGGGGCTCAGGTACAGCTTAGG - Intergenic
1149387069 17:56152998-56153020 AAGATGCTCAGTTGAAGCTTTGG - Intronic
1151415607 17:73960720-73960742 AAGGGGCCCAGGTACAGCTCTGG + Intergenic
1151902020 17:77022579-77022601 AAGGGGCCCAGGTACAGCTGGGG + Intergenic
1153455039 18:5271432-5271454 AAGAGGCCAAGATACAGCTTGGG - Intergenic
1153846057 18:9050914-9050936 AAGAGGCCAATGTACAGCTTGGG + Intergenic
1154087488 18:11321698-11321720 AAGATGGGCAAGAACAGGTTAGG + Intergenic
1154423925 18:14257771-14257793 AAGATGCACAGGTACAGCTTGGG + Intergenic
1154425259 18:14267224-14267246 AAGATGCACAGGAACAGCTTGGG + Intergenic
1154426159 18:14273790-14273812 AAGATGCACAGGTACAACTTGGG + Intergenic
1154427993 18:14286812-14286834 AAGATGCACAGGTACAGCTTGGG + Intergenic
1154428894 18:14293380-14293402 AAGATGCACAGGTACAGCTTGGG + Intergenic
1154431171 18:14309719-14309741 AAAATGCACAGGTACAGCTTGGG + Intergenic
1154432955 18:14322463-14322485 AAGATGCACAGGAACAGCTTGGG + Intergenic
1154433848 18:14329024-14329046 AAGATGCACAGGTACAGCTTGGG + Intergenic
1155182054 18:23356400-23356422 TAGATGCTCAGGGCCAGCTTGGG - Intronic
1155390349 18:25329204-25329226 AAGGTGACCAGGCACAGCTTGGG + Intronic
1155707857 18:28838374-28838396 AAGAGGCCAAGGTACAGCTTGGG - Intergenic
1155793013 18:29997698-29997720 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1155809066 18:30208573-30208595 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1156169374 18:34463560-34463582 AAGGAGTGAAGGTACAGCTTAGG - Intergenic
1156584476 18:38416435-38416457 TAGATGAGCAGGTGCAGTTTGGG - Intergenic
1156736228 18:40263122-40263144 AAGGACCCCAGGTACAGCTTGGG + Intergenic
1156892339 18:42204750-42204772 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1158129724 18:54139488-54139510 AAGAGGCCAAGGTACAGCTTGGG + Intergenic
1159282932 18:66310555-66310577 AAGAAGCCAAGGTACAGCTTGGG - Intergenic
1159508011 18:69360695-69360717 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1162002729 19:7757655-7757677 AAGGGGCCAAGGTACAGCTTAGG + Intergenic
1162596488 19:11633516-11633538 AAGGGGCGAACGTACAGCTTGGG + Intergenic
1163056816 19:14726161-14726183 AAGGGGCCCAGGTATAGCTTGGG - Intronic
1164550145 19:29203888-29203910 AAGATAAGAAGGGACAGCTTGGG + Intergenic
1166315358 19:41986213-41986235 ACGATGCCCAGGTACAGCTGTGG + Exonic
1166662267 19:44654650-44654672 AAGAGGCGGAGGACCAGCTTTGG - Intronic
1166751149 19:45164517-45164539 CAGAAGGGCAGGTACAGCCTGGG + Intronic
1168702419 19:58449123-58449145 AAGGAGCCAAGGTACAGCTTAGG + Intergenic
1202638699 1_KI270706v1_random:63414-63436 AAGATGCACAGGTACAGCTTGGG - Intergenic
925393116 2:3512513-3512535 AAAGGGCCCAGGTACAGCTTGGG + Intronic
925490852 2:4391070-4391092 AAGAGCCCCAAGTACAGCTTGGG - Intergenic
925554409 2:5114218-5114240 AAGAGGCCTAGGTAGAGCTTTGG + Intergenic
925724437 2:6859538-6859560 AAGAGGCCAAGGTACAGCTCAGG + Intronic
925738020 2:6980997-6981019 AAGAGGCCAAGGTACAGCTCAGG - Intronic
925821174 2:7801219-7801241 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
926868959 2:17391509-17391531 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
926938921 2:18115028-18115050 AAGGGGCCAAGGTACAGCTTGGG + Intronic
927438233 2:23088767-23088789 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
928709442 2:33987738-33987760 AAGAGCCCCAGGTACAGCTCAGG - Intergenic
930480591 2:51943767-51943789 AAGGGGCCCAGGTACAGCTCTGG + Intergenic
930627014 2:53709248-53709270 AAGGGGCCCAGGTACAGCTCAGG + Intronic
930812899 2:55561143-55561165 AAGGAGCCAAGGTACAGCTTGGG + Intronic
930960148 2:57251591-57251613 AAGGAGCCAAGGTACAGCTTGGG - Intergenic
931811849 2:65861920-65861942 TAGATGAGCAGACACAGCTTTGG - Intergenic
932518916 2:72386590-72386612 AAGGTGCATAGGTACAGCTCAGG + Intronic
933085093 2:78046007-78046029 AAGATGCCAAGGTACAGCTCGGG + Intergenic
933539081 2:83616085-83616107 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
933864164 2:86500703-86500725 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
934491819 2:94766344-94766366 AAGATGCACAGGTACAGCTTGGG - Intergenic
934492267 2:94769490-94769512 AAGATGCACAGGCACAGCTTGGG - Intergenic
934493682 2:94779739-94779761 AAGATGTACAGGTACAGCTTGGG - Intergenic
934494158 2:94782932-94782954 AAGATGCACAGGTACAGCTTGGG - Intergenic
935481423 2:103594749-103594771 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
936813658 2:116433260-116433282 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
936837230 2:116723069-116723091 AAGAGGGCAAGGTACAGCTTGGG - Intergenic
936897576 2:117445746-117445768 AAGAGGCCAAGGTACAGCTCAGG + Intergenic
937358086 2:121211054-121211076 AAGATGGACAGTTACAGCCTAGG + Intergenic
937730345 2:125222689-125222711 AAGAGGCCAAGGTAGAGCTTGGG - Intergenic
938165362 2:129021224-129021246 AAGGGGCTAAGGTACAGCTTGGG + Intergenic
938280119 2:130057853-130057875 ATGATGCACAGGTACAGCTTGGG - Intergenic
938331076 2:130448568-130448590 ATGATGCACAGGTACAGCTTGGG - Intergenic
938358872 2:130672935-130672957 ATGATGCACAGGTACAGCTTGGG + Intergenic
938435265 2:131279588-131279610 ATGATGCACAGGTACAGCTTGGG + Intronic
938718178 2:134039972-134039994 AAGGGGCAAAGGTACAGCTTGGG - Intergenic
939125375 2:138171938-138171960 AAGCGGCCCAGGTACAGCTTGGG + Intergenic
939506387 2:143052572-143052594 AAGGGGCCAAGGTACAGCTTGGG + Exonic
939835547 2:147125487-147125509 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
940288906 2:152058937-152058959 AAGGGGCGAAGGTACAGCTTGGG + Intronic
940729812 2:157375738-157375760 AAGGGGCCCAGGTACAGCTTGGG - Intergenic
942118188 2:172749445-172749467 AAGGGGCCGAGGTACAGCTTAGG - Intronic
943271553 2:185811792-185811814 AAGGGGCCCAGTTACAGCTTGGG + Intronic
943313211 2:186353359-186353381 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
943491144 2:188557860-188557882 AAGAGGCCCAGGTACAGCACAGG - Intronic
943776728 2:191774283-191774305 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
943788155 2:191901379-191901401 AAGAGGCCAAGGTACAGCTTGGG + Intergenic
944038295 2:195324413-195324435 AAGATCATCAGGTACATCTTGGG + Intergenic
944477932 2:200125983-200126005 AAGGGGCTAAGGTACAGCTTAGG - Intergenic
944479771 2:200144661-200144683 AAGGGGCCAAGGTACAGCTTTGG - Intergenic
945122120 2:206467948-206467970 AAGAGGCCCAGGTACAGCTCAGG - Intronic
945515898 2:210762901-210762923 AAGAGGCCCAGGTACAGCTAAGG - Intergenic
946544004 2:220716424-220716446 AAGAAGCAAAGGTACAGCATGGG - Intergenic
946575575 2:221071872-221071894 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
948209870 2:236185002-236185024 ACGGGGCCCAGGTACAGCTTGGG + Intergenic
1169322556 20:4645469-4645491 AAGTGGCCCAGGTACAGCTTGGG - Intergenic
1170318619 20:15069628-15069650 AAGGGCCCCAGGTACAGCTTGGG + Intronic
1170481878 20:16774239-16774261 AAGGTCCCCAGGTACAGCTTGGG + Intergenic
1171883905 20:30637707-30637729 AAGATGCACAGGTAGAGCTTGGG - Intergenic
1171885291 20:30647534-30647556 AAGATGTACAGGTACAGCTTGGG - Intergenic
1172183403 20:33017036-33017058 GAGATGCTCAGGCACAGCTGTGG - Exonic
1176657722 21:9602716-9602738 AAGGAGCCAAGGTACAGCTTGGG - Intergenic
1176843187 21:13856699-13856721 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176844096 21:13863293-13863315 AAGATGCACAGGTACAGCCTGGG - Intergenic
1176845875 21:13876045-13876067 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176846774 21:13882616-13882638 AAGATGCACATGTACAGCTTGGG - Intergenic
1176848610 21:13895600-13895622 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176849542 21:13902232-13902254 AAGATGCACAGGTACAGCTTGGG - Intergenic
1177085263 21:16695168-16695190 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
1177169590 21:17640650-17640672 AAGGGGCTAAGGTACAGCTTGGG - Intergenic
1177402455 21:20623529-20623551 AAGGGGTCCAGGTACAGCTTGGG - Intergenic
1177406348 21:20673289-20673311 AAGGGGCCCAGGTACAGCTCTGG + Intergenic
1177496157 21:21894868-21894890 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1178046196 21:28696893-28696915 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
1178224508 21:30699809-30699831 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1179384463 21:40929264-40929286 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1179527914 21:41995857-41995879 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1184270355 22:43377708-43377730 AAGATCCACAGGCCCAGCTTTGG + Intergenic
949662193 3:6292041-6292063 AAGGGGCAAAGGTACAGCTTGGG - Intergenic
949692992 3:6662237-6662259 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
950412196 3:12846258-12846280 AAGGGGCCAAGGTACAGCTTGGG + Intronic
950980398 3:17297963-17297985 CAGATGCGGAGGTAGAACTTGGG - Intronic
951237288 3:20250777-20250799 AAGCGGCCCAGGTACAGCTCTGG - Intergenic
951446166 3:22782728-22782750 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
951865120 3:27299261-27299283 AAGGGGCCAAGGTACAGCTTAGG + Intronic
951920848 3:27852721-27852743 AAGGAGCCAAGGTACAGCTTGGG - Intergenic
952221399 3:31327441-31327463 AAGGGGCCCAGGTACAGCTCAGG - Intergenic
952674292 3:36008472-36008494 AAGGGGTCCAGGTACAGCTTAGG - Intergenic
953184955 3:40629278-40629300 AAGGGGCCTAGGTACAGCTTGGG + Intergenic
955826283 3:62951330-62951352 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
957105668 3:75883770-75883792 AAAAGGCCAAGGTACAGCTTGGG - Intergenic
957148736 3:76457851-76457873 AAGGGGCCAAGGTACAGCTTGGG - Intronic
957160313 3:76601561-76601583 AAGGGGCCAAGGTACAGCTTGGG - Intronic
957477129 3:80739553-80739575 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
957576470 3:82014695-82014717 AAGGGGCCCAGGTACAACTTAGG + Intergenic
957843393 3:85699583-85699605 AAGAGGCCCAGGTAAAGCTCAGG - Intronic
957870330 3:86083278-86083300 AAGAGGCCAATGTACAGCTTGGG - Intergenic
958065928 3:88544912-88544934 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
958067605 3:88563926-88563948 AAAAGGCCAAGGTACAGCTTGGG - Intergenic
958128366 3:89386392-89386414 AAGAGGCCAAGGTATAGCTTGGG + Intronic
958157327 3:89771525-89771547 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
958563789 3:95781529-95781551 AAGAGGCCAAGGTACAGCTCAGG + Intergenic
958582544 3:96045176-96045198 AAGAGGCTAAGGTACAGTTTGGG - Intergenic
958650088 3:96927170-96927192 AAGAGGCCAAGGTACAGCTCCGG - Intronic
958672192 3:97219525-97219547 AAGGGGCCAAGGTACAGCTTGGG - Intronic
958710208 3:97708806-97708828 AAGAGGCCAAGGTACAGCTCGGG + Intronic
958831756 3:99098677-99098699 AAGGAGCCAAGGTACAGCTTAGG + Intergenic
958887188 3:99739628-99739650 AAGGGGCCAAGGTACAGCTTGGG - Intronic
958893458 3:99805248-99805270 AAGGGGCCCAGGTACAGCTTGGG - Intergenic
958933570 3:100233436-100233458 AAGATGAATAGGTACAGCATAGG + Intergenic
959769196 3:110072313-110072335 AAGAGGGCCAGGTACAGCTTGGG + Intergenic
960150639 3:114245589-114245611 GAGGTGCCCAGGTACAGCTTGGG + Intergenic
961029721 3:123591052-123591074 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
962343642 3:134604758-134604780 AGGATGCACACATACAGCTTGGG - Intronic
963475175 3:145794934-145794956 AAGAGGCCAAGGTACATCTTCGG - Intergenic
963777339 3:149452385-149452407 AAGGGGCCCAGGTAGAGCTTGGG - Intergenic
964026456 3:152080119-152080141 AAGAGGCCAAGGTACAGCTTGGG - Intergenic
964540278 3:157772026-157772048 AACATGGGCAGGTGCAGCTACGG - Intergenic
964638695 3:158885612-158885634 AAGGGCCACAGGTACAGCTTGGG + Intergenic
965057808 3:163744513-163744535 AAGGGGCACAGGTACATCTTGGG - Intergenic
965066612 3:163857967-163857989 AAGGGGCCAAGGTACAGCTTAGG + Intergenic
965074923 3:163963968-163963990 AAAGGGCCCAGGTACAGCTTGGG + Intergenic
965090016 3:164149839-164149861 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
965305556 3:167059427-167059449 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
965662107 3:171052799-171052821 AAGAGGCCAAAGTACAGCTTGGG + Intergenic
965838802 3:172880468-172880490 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
965957614 3:174389722-174389744 AAGGGGCCCAGGTAGAGCTTGGG - Intergenic
966164835 3:177006027-177006049 AAGAGGCCCAGATACAGCTCAGG + Intergenic
966241356 3:177758039-177758061 AAGTGGCCAAGGTACAGCTTGGG - Intergenic
966452590 3:180078683-180078705 AAGATGCCAAGGTACAGCTCAGG - Intergenic
966906455 3:184529691-184529713 AAGAAGGGCAGGTACTGCCTGGG + Intronic
967260245 3:187634733-187634755 AAGGGGCCCAGGTACAGCTTGGG - Intergenic
967509433 3:190292332-190292354 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
967542251 3:190681011-190681033 GGGATGCGCAAGGACAGCTTGGG + Intergenic
967564642 3:190959419-190959441 AAGAGACCAAGGTACAGCTTGGG + Intergenic
968014698 3:195319058-195319080 AAGAGGCCAAGGTACAGCTCGGG + Intronic
969121941 4:4917243-4917265 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
969163217 4:5279829-5279851 AAGGGGCAAAGGTACAGCTTGGG - Intronic
970307978 4:14752700-14752722 AAGAGGCCAAGGTACAGCTTGGG - Intergenic
970977364 4:22057137-22057159 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
971010656 4:22430911-22430933 AAGGGGCCAAGGTACAGCTTGGG + Intronic
971224402 4:24737774-24737796 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
971557859 4:28036879-28036901 AAGGAGCCCAGGTACAGCTCAGG - Intergenic
971741346 4:30525656-30525678 AAGAGGCTCAGGTATAGCTAAGG - Intergenic
971875314 4:32300927-32300949 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
972242094 4:37204197-37204219 AAGAGGCCAAGGTACAGCTCTGG - Intergenic
972413431 4:38815537-38815559 AAGTGGCCCAGGTACAGCTCAGG - Intronic
972744556 4:41920812-41920834 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
972829906 4:42802835-42802857 AAGGGGCCCAGGTACAACTTGGG - Intergenic
972890721 4:43553458-43553480 AAGAGGCCAAGGTACAGCTCAGG + Intergenic
973367568 4:49219978-49220000 AAGATGCACAGGTACAGCTTGGG - Intergenic
973393485 4:49575454-49575476 AAGATGCACAGGTACAGCTTGGG + Intergenic
974517460 4:62936098-62936120 AAGAGGCCAAGGTACAGCTCTGG + Intergenic
974733300 4:65897540-65897562 AAGGGGCCCAGGTACAGCTCAGG - Intergenic
974897591 4:67957927-67957949 AAGAGGCCAAGCTACAGCTTGGG + Intronic
975230218 4:71924106-71924128 AAGAAGCCAAGGTACAGCTCAGG + Intergenic
975729245 4:77321366-77321388 AAGAGGCCAAGGTACAGCTTGGG - Intronic
976672942 4:87674039-87674061 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
977050117 4:92119212-92119234 AAGGGTCCCAGGTACAGCTTGGG + Intergenic
977393913 4:96448580-96448602 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
978153407 4:105463725-105463747 AAGGGGCCAAGGTACAGCTTGGG + Intronic
979504882 4:121484888-121484910 AAGATGAGCAGGGACAGACTGGG + Intergenic
979703065 4:123689466-123689488 AAGGGGCCCAGGTACAGCTCAGG - Intergenic
979824910 4:125220955-125220977 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
980065735 4:128186883-128186905 AAGGGGCCCAGATACAGCTTGGG + Intronic
980266544 4:130524143-130524165 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
980293086 4:130870503-130870525 AAGAGGTCAAGGTACAGCTTGGG + Intergenic
980324461 4:131323974-131323996 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
980354032 4:131721995-131722017 AAGTGGCCCAGGTACAGCTCAGG - Intergenic
980850429 4:138374386-138374408 AAGGGTCGAAGGTACAGCTTGGG - Intergenic
981121016 4:141051125-141051147 AAGGGGCCAAGGTACAGCTTGGG - Intronic
981242373 4:142493040-142493062 AAGATGCCAATGTACAGCTCAGG + Intronic
981439204 4:144763389-144763411 AAACTGCGCAGGTACACCTAAGG + Intergenic
981693042 4:147530636-147530658 GAGATGAGCATGTACAGATTTGG - Intronic
981795361 4:148589467-148589489 AAGAGGCCAAGGTACAGCTCAGG + Intergenic
981990996 4:150920974-150920996 AAAATGCCCAGTCACAGCTTGGG - Intronic
982279125 4:153665977-153665999 AAGGAGCCAAGGTACAGCTTGGG + Intergenic
982524989 4:156466918-156466940 AAGAGGCCAAGGTACAGCTTGGG - Intergenic
982805238 4:159755084-159755106 AAGGGGCCAAGGTACAGCTTAGG + Intergenic
983015520 4:162607838-162607860 AAGGGGCTCAGGTACAACTTGGG + Intergenic
983105634 4:163682577-163682599 AAGGGGCCAAGGTACAGCTTGGG + Intronic
983874739 4:172862978-172863000 AAGGGGCCAAGGTACAGCTTGGG + Intronic
983889467 4:173015997-173016019 AAGGTGCCAAGGTACAGCTCAGG + Intronic
983952778 4:173661955-173661977 AAGGTGCCAAGGTACAGCTCAGG + Intergenic
983968514 4:173843610-173843632 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
984194174 4:176638757-176638779 ATGATGAGCAGGTACAGACTTGG + Intergenic
984353239 4:178622193-178622215 AAGGTGCCAAGGTACAGCTCTGG - Intergenic
985304297 4:188521935-188521957 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1202766037 4_GL000008v2_random:149273-149295 AAGATGCACAGGTACAGCTTGGG - Intergenic
985809542 5:2073011-2073033 AAGGTCCCCAGGTATAGCTTGGG + Intergenic
986144119 5:5061050-5061072 AAGATTCTGAGGTACTGCTTGGG + Intergenic
986455315 5:7912434-7912456 AAGAGGCCAAGGTACAGCTTGGG - Intergenic
986660118 5:10051998-10052020 AAGAGGCCCAGGTACAGCTCAGG - Intergenic
986869247 5:12028051-12028073 AAGCGGCCAAGGTACAGCTTGGG - Intergenic
987252259 5:16111896-16111918 AAGAAGCCAAGGTACAGCTTGGG + Intronic
987289540 5:16495547-16495569 AAGAGGCCAAGGTACAGCTCGGG + Intronic
987435238 5:17885636-17885658 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
987687505 5:21224606-21224628 AAGATGGGCTGGTAGAGTTTGGG - Intergenic
987773571 5:22336561-22336583 AAGTGGCCAAGGTACAGCTTGGG + Intronic
988804487 5:34727638-34727660 AAGGGGCCAAGGTACAGCTTGGG + Intronic
988911237 5:35845852-35845874 AAGAGGCCAAGGTACAGCTTAGG - Intergenic
989434665 5:41397318-41397340 AAGGGGCCTAGGTACAGCTTGGG + Intronic
989726872 5:44597474-44597496 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
990701081 5:58475509-58475531 AAGGTGCCAAGGTACAGCTTGGG - Intergenic
991042798 5:62193240-62193262 AAGGAGCCCAGGTACAGCTCAGG + Intergenic
991116868 5:62964515-62964537 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
991409365 5:66331426-66331448 AACAGGCCAAGGTACAGCTTGGG + Intergenic
991535897 5:67669159-67669181 AAGCGGCCAAGGTACAGCTTGGG + Intergenic
991776341 5:70089407-70089429 AAGGGGCCTAGGTACAGCTTGGG + Intergenic
991855628 5:70964854-70964876 AAGGGGCCTAGGTACAGCTTGGG + Intergenic
991869640 5:71097632-71097654 AAGGGGCCTAGGTACAGCTTGGG + Intergenic
992425212 5:76649977-76649999 AAGGGGCTCAGGTACAGCTAAGG - Intronic
992608203 5:78483495-78483517 AAGGTGAGGAGGTTCAGCTTAGG - Intergenic
993198555 5:84782290-84782312 AAGAGCCCCAGGTATAGCTTGGG - Intergenic
993253138 5:85553786-85553808 AAGGGGCAAAGGTACAGCTTAGG - Intergenic
993267109 5:85740272-85740294 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
994018967 5:95002039-95002061 AAGGGGCCAAGGTACAGCTTGGG + Intronic
994325700 5:98442543-98442565 AAGGGGCGAAGGTACAGCTGAGG - Intergenic
994689545 5:102999750-102999772 AAGAGGCCAAGGTATAGCTTGGG - Intronic
994749563 5:103721305-103721327 AAGGCGCCAAGGTACAGCTTGGG - Intergenic
994840912 5:104923956-104923978 AAGAGGCCCAGGTACAGCTTGGG + Intergenic
994910759 5:105903162-105903184 AAGCTGCGCTGCTACAGCTCCGG - Intergenic
995043361 5:107615462-107615484 AAAATGCGCACTTACAGTTTTGG + Intronic
995113496 5:108453856-108453878 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
995132739 5:108647587-108647609 AAGGGGCTCAGGTACAGCTCAGG + Intergenic
995703604 5:114962124-114962146 AACAGGCCAAGGTACAGCTTGGG - Intergenic
995925532 5:117369297-117369319 AAGGAGCCAAGGTACAGCTTGGG + Intergenic
996126121 5:119727500-119727522 AAGAGGCCAAGGTACAACTTGGG + Intergenic
996149995 5:120023389-120023411 AAGAGGCCAAGGTACAGCTCAGG + Intergenic
996236911 5:121141675-121141697 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
996251032 5:121332086-121332108 AAGAGGCCAAGGTACAGCTTAGG + Intergenic
996701045 5:126450724-126450746 AAGGGGCCCAGGTACAGCTCGGG + Intronic
997036854 5:130202952-130202974 AAGGTGCCAACGTACAGCTTGGG - Intergenic
997086457 5:130806035-130806057 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
997102091 5:130980639-130980661 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
997692846 5:135838659-135838681 AAGGGGCCAAGGTACAGCTTGGG + Intronic
998071789 5:139203490-139203512 AAGCTGCTCAGGTGCTGCTTGGG - Intronic
998551428 5:143081296-143081318 AAGATGGGAAGGAACAGCCTGGG + Intronic
998980543 5:147697643-147697665 AAGAGGCCAAGGTACAGCTCAGG + Intronic
999755884 5:154664005-154664027 AAGGGCCCCAGGTACAGCTTGGG - Intergenic
1000496365 5:161989802-161989824 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1000564915 5:162835056-162835078 AAGGGGCGAAAGTACAGCTTGGG - Intergenic
1000648449 5:163785868-163785890 AAGAGGCCAATGTACAGCTTGGG - Intergenic
1000777890 5:165442283-165442305 AAGGGGCCGAGGTACAGCTTGGG - Intergenic
1001040791 5:168333699-168333721 AAGCTGTGCAGGTAAAGCCTGGG - Intronic
1002002971 5:176208521-176208543 AACAGGCCCAGGTACAGCTTAGG - Intergenic
1002223539 5:177702734-177702756 AACAGGCCCAGGTACAGCTTAGG + Intergenic
1002794044 6:456504-456526 AAGGGGCCCAGGTATAGCTTGGG - Intergenic
1003230049 6:4243637-4243659 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1003550646 6:7099497-7099519 AAAATACCCAGCTACAGCTTCGG + Intergenic
1003690185 6:8346327-8346349 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1003763606 6:9210491-9210513 AAGATGCCCAGGGACATATTAGG + Intergenic
1003798311 6:9630816-9630838 ACGAGGCCAAGGTACAGCTTGGG + Intronic
1003979526 6:11376952-11376974 AAGGGGCCCAGGTACAGCTCTGG + Intronic
1004430215 6:15536447-15536469 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1005027455 6:21477106-21477128 AAGATGGGCATGTACAGCCAAGG - Intergenic
1005984148 6:30860067-30860089 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1006693239 6:35908818-35908840 AAGGGGCTAAGGTACAGCTTGGG + Intronic
1007021478 6:38526217-38526239 AAGTGGCCAAGGTACAGCTTGGG + Intronic
1008104679 6:47428865-47428887 AAGGGGCCCAGGTACAGCTTGGG - Intergenic
1008226181 6:48919840-48919862 AAGGGCCCCAGGTACAGCTTGGG + Intergenic
1008631473 6:53366323-53366345 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1008870957 6:56271802-56271824 AAGGAGCCAAGGTACAGCTTAGG + Intronic
1009554773 6:65148897-65148919 AAGGGGCCAAGGTACAGCTTGGG - Intronic
1009792369 6:68419975-68419997 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1009825042 6:68856962-68856984 AAGAAGCCAAGGTACAGCTTGGG + Intronic
1010517419 6:76790072-76790094 AAGGTGCCCAGGTACAGCTCAGG - Intergenic
1010835819 6:80586523-80586545 AAGGGGCTAAGGTACAGCTTGGG + Intergenic
1011011200 6:82705690-82705712 AAGGGGCAAAGGTACAGCTTGGG - Intergenic
1011347687 6:86389750-86389772 AAGGGGCCAAGGTACAGCTTTGG + Intergenic
1011348753 6:86399915-86399937 AAGGGGCCCAGGTACAGCTCAGG - Intergenic
1012141482 6:95631561-95631583 AAGGGGCCAAGGTACAGCTTAGG + Intergenic
1012161347 6:95888869-95888891 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1012485886 6:99722339-99722361 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1012617378 6:101293526-101293548 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1012756646 6:103240350-103240372 AAGAAGCCAAGGTACAGCTCAGG + Intergenic
1012940478 6:105409819-105409841 AAGATCCCCAGATACAGCTCAGG - Intergenic
1013829562 6:114255746-114255768 AAGAGGCCAAGGTACAGCTTGGG - Intronic
1015039838 6:128703612-128703634 AAGGAGCCAAGGTACAGCTTGGG + Intergenic
1015045198 6:128768292-128768314 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
1015137678 6:129891838-129891860 AAGAAGGGGAGGTATAGCTTGGG + Intergenic
1015351535 6:132225505-132225527 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1016128311 6:140434024-140434046 AAGAAACCAAGGTACAGCTTGGG + Intergenic
1016180427 6:141139932-141139954 AAAATGAACAGGTACAACTTTGG - Intergenic
1016537615 6:145126271-145126293 AAGCGGCCAAGGTACAGCTTGGG + Intergenic
1020597631 7:10228725-10228747 AAGATACTCTGGTACAGCTATGG + Intergenic
1022907661 7:34872211-34872233 AAGGGGCCAAGGTACAGCTTGGG - Intronic
1024015314 7:45308299-45308321 AAGTGGCCCAAGTACAGCTTGGG + Intergenic
1025721561 7:64020415-64020437 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1027405262 7:77854199-77854221 AACTTGTGCAGGTACTGCTTTGG + Intronic
1030559114 7:111063267-111063289 AAGGGGCCAAGGTACAGCTTGGG - Intronic
1031473147 7:122191322-122191344 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1031771318 7:125848005-125848027 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1031791966 7:126118048-126118070 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1032366752 7:131307100-131307122 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1033843507 7:145403698-145403720 AAGCGGCCCATGTACAGCTTGGG + Intergenic
1034876168 7:154726464-154726486 AAGAGGCCAAGGTACAGCTCAGG - Intronic
1035128593 7:156629897-156629919 AAGGGGTCCAGGTACAGCTTCGG + Intergenic
1037048814 8:14343006-14343028 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1037975617 8:23209081-23209103 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1038577320 8:28716510-28716532 CGGATGGGCAGGGACAGCTTGGG - Exonic
1039148695 8:34479258-34479280 AAGGGGCCTAGGTACAGCTTGGG - Intergenic
1039158997 8:34595879-34595901 AAGAGTCCCAGGTATAGCTTGGG - Intergenic
1039183735 8:34893708-34893730 AAGATGGGCAAGGACAGCTTGGG + Intergenic
1040102465 8:43517927-43517949 AAGATGCACATGTACAGCTTGGG + Intergenic
1040103822 8:43527927-43527949 AAGATGTACAGGTACAGCTTGGG + Intergenic
1040644993 8:49387889-49387911 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1040863447 8:52024120-52024142 AAGAGGCCAAGGTACAGCTTGGG + Intergenic
1041682410 8:60606747-60606769 AAAAGGCCCAGGTATAGCTTGGG - Intronic
1042071641 8:64941545-64941567 AAGTGGCAAAGGTACAGCTTGGG - Intergenic
1042529029 8:69795961-69795983 AAGAGTCCCAGGTACAGTTTGGG - Intronic
1043811980 8:84752689-84752711 AAGGGTCCCAGGTACAGCTTGGG + Intronic
1044220451 8:89663547-89663569 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1044877201 8:96681366-96681388 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1045736042 8:105297097-105297119 AAGAGGCCAAGGTACAGCTCAGG - Intronic
1046606071 8:116373548-116373570 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
1046628212 8:116597852-116597874 CAGATGGGCAGTTCCAGCTTTGG + Intergenic
1046656320 8:116899147-116899169 AAGAGGCCAATGTACAGCTTGGG + Intergenic
1047940438 8:129823522-129823544 AAGGGGCCCAGGTACAGCTTGGG + Intergenic
1048039025 8:130707093-130707115 AAGGGGCCCAGGTACAGCTCCGG - Intergenic
1048668363 8:136689654-136689676 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
1048839350 8:138551353-138551375 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1050288630 9:4130525-4130547 AAGGGGCCCAGGTACAGCTCAGG + Intronic
1050643384 9:7693051-7693073 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1050935177 9:11386980-11387002 AAAGGGCTCAGGTACAGCTTGGG + Intergenic
1051767466 9:20540528-20540550 AAGGGGCCAAGGTACAGCTTGGG - Intronic
1051920679 9:22260211-22260233 AAGGGGCCCAGGTACAGCTCTGG + Intergenic
1052004529 9:23330292-23330314 AAGGGGCCCAGGTACACCTTAGG + Intergenic
1052877764 9:33580237-33580259 AAGATGCACAGGTACAGCTTGGG + Intergenic
1052878206 9:33583328-33583350 AAGACGCACAGGTACAGCTTGGG + Intergenic
1052878650 9:33586424-33586446 AAGATGCACAGGTACAGCTTGGG + Intergenic
1052879081 9:33589509-33589531 AAGATGCACAGGTACAGCTTGGG + Intergenic
1052879515 9:33592625-33592647 AAGATGCACAGGCACAGCTTGGG + Intergenic
1052879959 9:33595686-33595708 AAAATGCACAGATGCAGCTTGGG + Intergenic
1052934171 9:34079183-34079205 AATAGGCCCAGGTACAGTTTGGG + Intergenic
1053371325 9:37564118-37564140 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1053496014 9:38548534-38548556 AAAATGCACAGATGCAGCTTGGG - Intronic
1053496463 9:38551607-38551629 AAGATGCACAGGCACAGCTTGGG - Intronic
1053496895 9:38554710-38554732 AAGATGCACAGGTACAGCTTGGG - Intronic
1053497327 9:38557785-38557807 AAGATGCACAGGCACAGCTTGGG - Intronic
1053497778 9:38560879-38560901 AAGACGCACAGGTACAGCTTGGG - Intronic
1053498221 9:38563968-38563990 AAGATGCACAGGTACAGCTTGGG - Intronic
1053627361 9:39888586-39888608 AAGTGGCCCAGGTACAGCTCAGG - Intergenic
1053663404 9:40300293-40300315 AAGATGTACAGGTACAGCTTGGG + Intronic
1053664347 9:40307137-40307159 AAGATGCACAGGTACAGCTTGGG + Intronic
1053664871 9:40310392-40310414 AAGATGCACAGGTACAGCTTGGG + Intronic
1053665745 9:40316421-40316443 AAGATGCACAGGTACAGCTCAGG + Intronic
1053666184 9:40319517-40319539 AAGATGCACAGGTACAGCTTGGG + Intronic
1053778629 9:41577439-41577461 AAGTGGCCCAGGTACAGCTCAGG + Intergenic
1053913419 9:42927605-42927627 AAGATGCACAGGTACAGCTTGGG + Intergenic
1053913915 9:42930834-42930856 AAGATGCACAGGTACAGCTTGGG + Intergenic
1053915328 9:42941467-42941489 AAGATGCACAGGTACAGCTCGGG + Intergenic
1053915768 9:42944564-42944586 AAGATGCACAGTTACAGCTTGGG + Intergenic
1054166591 9:61787679-61787701 AAGTGGCCCAGGTACAGCTCAGG + Intergenic
1054216526 9:62362117-62362139 AAGTGGCCCAGGTACAGCTCAGG + Intergenic
1054375527 9:64446527-64446549 AAGATGTACAGGTACAGCTTGGG + Intergenic
1054376901 9:64456451-64456473 AAGATGCACAGGTACAGCTCAGG + Intergenic
1054377337 9:64459545-64459567 AAGATGCACAGGTACAGCTTGGG + Intergenic
1054518425 9:66056766-66056788 AAGATGCACAGGTACAGCTTGGG - Intergenic
1054518868 9:66059863-66059885 AAGATGCACAGGTACAGCTCAGG - Intergenic
1054519743 9:66065892-66065914 AAGATGCACAGGTACAGCTTGGG - Intergenic
1054520267 9:66069148-66069170 AAGATGCACAGGTACAGCTTGGG - Intergenic
1054521210 9:66075992-66076014 AAGATGTACAGGTACAGCTTGGG - Intergenic
1054670957 9:67793226-67793248 AAGTGGCCCAGGTACAGCTCAGG - Intergenic
1055167882 9:73219175-73219197 AAGAGGCCAAGGGACAGCTTGGG + Intergenic
1056514639 9:87338386-87338408 AAGATACGCAGTTACAGAGTAGG + Intergenic
1056586123 9:87928345-87928367 AAAATGCACAGATGCAGCTTGGG - Intergenic
1056610759 9:88124598-88124620 AAAATGCACAGATGCAGCTTGGG + Intergenic
1057161393 9:92890845-92890867 AAGATGCACAGGTACAGCTTGGG - Intergenic
1057332493 9:94128879-94128901 AAGGAGCCCAGGTACAGCTCTGG + Intergenic
1057675943 9:97136052-97136074 AAAATGCACAGATGCAGCTTGGG - Intergenic
1057676804 9:97142267-97142289 AAGATGCACAGGTACAGCTTGGG - Intergenic
1057677243 9:97145364-97145386 AAGATGCACAGGTACAGCTTGGG - Intergenic
1057677686 9:97148452-97148474 AAGATGCACAGGTACAGCTTGGG - Intergenic
1059045458 9:110861654-110861676 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1059082603 9:111266113-111266135 AAGAGGCCAAGGTACAGGTTGGG - Intergenic
1059296232 9:113273633-113273655 AGGAGGCTCAAGTACAGCTTTGG + Intronic
1059601401 9:115783234-115783256 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1059917289 9:119117843-119117865 ATGGGGCCCAGGTACAGCTTGGG + Intergenic
1060622696 9:125082197-125082219 AAGGGGCCGAGGTACAGCTTGGG + Intronic
1203546786 Un_KI270743v1:134162-134184 AAGATGCACAGGTACAGCTTGGG - Intergenic
1203635450 Un_KI270750v1:106290-106312 AAGGAGCCAAGGTACAGCTTGGG - Intergenic
1188016411 X:25112207-25112229 AAGGGCCCCAGGTACAGCTTGGG - Intergenic
1188105628 X:26144186-26144208 AAGGGGCCCAGGTACAGCTCAGG - Intergenic
1188158903 X:26776343-26776365 GAGGTGCCAAGGTACAGCTTGGG + Intergenic
1188259720 X:28008345-28008367 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
1188392580 X:29639615-29639637 AAGAAGGGCAGGAACAGCCTTGG + Intronic
1188660416 X:32751850-32751872 AAGGGGCCGAGGTACAGCTTGGG + Intronic
1188719478 X:33505509-33505531 AAGGGGCCAAGGTACAGCTTAGG + Intergenic
1188807856 X:34613875-34613897 AAGAGGGCAAGGTACAGCTTGGG - Intergenic
1188962386 X:36508131-36508153 AAGGGGCCCAGGTACAGCTCTGG - Intergenic
1189431415 X:40950626-40950648 AAGGGGCCCAGGTACAGCTTGGG - Intergenic
1189869660 X:45368970-45368992 AAGGGGCCCAGGTACAGCTTGGG + Intergenic
1189886067 X:45546025-45546047 AAGGGGCCCAGGTACAGCTTGGG + Intergenic
1191738020 X:64407581-64407603 AAAATGCCCAGGCACAGCTCAGG - Intergenic
1192066605 X:67891598-67891620 AAGGGGCCAAGGTACAGCTTAGG + Intergenic
1192689680 X:73349256-73349278 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1193167688 X:78301023-78301045 AAGGAGCCGAGGTACAGCTTAGG - Intronic
1193210498 X:78801788-78801810 AAGGGGCAAAGGTACAGCTTGGG + Intergenic
1193271518 X:79534833-79534855 AAGGAGCACAGGTACAGCTCAGG - Intergenic
1193320387 X:80114801-80114823 AAGAGGCCAAGGTACAGCTCGGG + Intergenic
1193387324 X:80886585-80886607 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
1193585661 X:83318532-83318554 AAGGAGCCAAGGTACAGCTTGGG + Intergenic
1193627006 X:83834403-83834425 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1193770402 X:85581021-85581043 AAGAGCCCCAGGTACAGCTCAGG - Intergenic
1193996138 X:88367450-88367472 AATAAGCCCAGGTACAGCTCAGG - Intergenic
1194374010 X:93110290-93110312 AAGTGTCCCAGGTACAGCTTTGG - Intergenic
1194418086 X:93637893-93637915 AACAGGCTCAGGTATAGCTTGGG + Intergenic
1194495883 X:94616156-94616178 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
1194534268 X:95086191-95086213 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1194554239 X:95337699-95337721 AAGAGGCCAAGGAACAGCTTGGG - Intergenic
1194856227 X:98932776-98932798 AAGGGACACAGGTACAGCTTGGG + Intergenic
1194860971 X:98998800-98998822 AAGGTGCCAAGGTACAGCTGAGG + Intergenic
1194864901 X:99053830-99053852 AAGAGGCCAATGTACAGCTTGGG + Intergenic
1194895268 X:99432460-99432482 AAGGGGCCCAGGTACAGCTCGGG + Intergenic
1195154532 X:102109939-102109961 AAGGGGCTAAGGTACAGCTTGGG + Intergenic
1195330183 X:103790970-103790992 AAGATGCTCAGGTACAGAGAAGG + Exonic
1195525930 X:105889735-105889757 AAGGGGCCAAGGTACAGCTTGGG - Intronic
1195814233 X:108867818-108867840 AAGAGTCTCAGGTACAGCTCAGG - Intergenic
1195815287 X:108878371-108878393 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1196099096 X:111829623-111829645 AAGGTGCCCAGGTACAGCTTGGG + Intronic
1196391321 X:115210343-115210365 AAGGGGCCAAGGTACAGCTTGGG + Intronic
1196582561 X:117394108-117394130 AAGAGGCAAAGGTACAGCTCAGG - Intergenic
1196903545 X:120410037-120410059 AAGGGGCCTAGGTACAGCTTAGG - Intergenic
1197016578 X:121632702-121632724 AAGAGGCCAAGGTATAGCTTAGG - Intergenic
1197074767 X:122341170-122341192 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1197094308 X:122574938-122574960 AAGGGGCCCAGGTACAGCTTGGG - Intergenic
1197109577 X:122756586-122756608 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1197510234 X:127361814-127361836 AAGGGGCCAAGGTACAGCTTAGG - Intergenic
1197561253 X:128024783-128024805 AAGAGGCCAAGGTACAGCTCAGG - Intergenic
1197747325 X:129940364-129940386 AAGATGCTCAGGGGCAGCATTGG - Intergenic
1198019694 X:132645659-132645681 AATATGGGCAGGTACATTTTTGG + Intronic
1198020042 X:132648651-132648673 AAAAAGCGCAGGTATAGGTTAGG - Intronic
1198274656 X:135089404-135089426 AAGAGGCCAAGGTACAGCTCAGG + Intergenic
1198913411 X:141638620-141638642 AAGGGGCCAAGGTACAGCTTGGG - Intronic
1198951706 X:142079691-142079713 AATGTGCCAAGGTACAGCTTGGG - Intergenic
1198991038 X:142515104-142515126 AAGAGTCCAAGGTACAGCTTGGG - Intergenic
1199071147 X:143476953-143476975 AAGTGGCCAAGGTACAGCTTGGG + Intergenic
1199220345 X:145309666-145309688 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1199346514 X:146747024-146747046 AAGGGGCCAAGGTACAGCTTGGG - Intergenic
1199357162 X:146875710-146875732 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1199423611 X:147676112-147676134 AAGGGGCCCAGGTACAGCTCAGG + Intergenic
1199580759 X:149357852-149357874 AAGGGGCCAAGGTACAGCTTGGG + Intergenic
1199869771 X:151888023-151888045 AAGAGGCCAAGGTACAGCTTGGG + Intergenic
1199908773 X:152262073-152262095 AAGAGGCCAAGGTACAGCTCAGG - Intronic
1199928410 X:152493976-152493998 AAGAGGCCAAGGTACAGCTCGGG + Intergenic
1200295386 X:154914150-154914172 AAGAGGCCAAAGTACAGCTTGGG - Intronic
1200682039 Y:6224361-6224383 AAGTGTCCCAGGTACAGCTTTGG - Intergenic