ID: 1105258875

View in Genome Browser
Species Human (GRCh38)
Location 13:18763991-18764013
Sequence GGGGGTCTTAGCTAAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 2, 2: 5, 3: 20, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105258875 Original CRISPR GGGGGTCTTAGCTAAGATGA TGG (reversed) Intergenic
900892682 1:5460947-5460969 GGGGGTCAAAGCTGTGATGATGG + Intergenic
901221130 1:7584426-7584448 GGGGGTTTCTGCTAAGCTGACGG + Intronic
901322983 1:8350570-8350592 AGGGCTCTTAGCTCAGATGACGG + Intergenic
901726005 1:11242621-11242643 GGGTGTCTTCGCTAAGGCGAGGG - Intronic
901972514 1:12919233-12919255 GTGTGTCTAAGTTAAGATGATGG + Intronic
902012665 1:13282529-13282551 GTGTGTCTAAGTTAAGATGATGG - Intronic
915186175 1:154106736-154106758 GGTGGTCTTAGGTAAGATCCGGG - Intronic
917679935 1:177355337-177355359 GGGGGTCTGTGCCAAGCTGAAGG + Intergenic
918622387 1:186620471-186620493 GGGGGTATATGCAAAGATGAGGG + Intergenic
1069298377 10:66875820-66875842 GGGTGTCTTAGCTATGATAGTGG - Intronic
1071645900 10:87360760-87360782 GGGGGTCTGAGTTAAGACCAAGG - Exonic
1075060386 10:119252956-119252978 GGTGGTCTTAGGGAAAATGATGG + Intronic
1079352969 11:19708545-19708567 GGGGTCTTTAACTAAGATGAAGG + Intronic
1084025936 11:66449555-66449577 GGGTGTCTGAGTTAAGATGAAGG - Intronic
1085836918 11:79966734-79966756 GGGGATGTTTGCTAGGATGATGG - Intergenic
1091457077 12:615968-615990 GGGGGTTTTAGCTAGGGTGAGGG + Intronic
1093007971 12:14071525-14071547 GGGGGTCTTAACTGGGATGACGG - Intergenic
1096580235 12:52580399-52580421 GGGGGTCTGAGGTAAGGAGATGG - Intergenic
1096786264 12:54018813-54018835 GGGTGTCTTGGCTTAGATTAAGG - Intronic
1097517633 12:60624812-60624834 GAGGGTCTTGGTTAAGATAATGG + Intergenic
1101985438 12:109442410-109442432 TTGGGTATTAACTAAGATGATGG + Intronic
1103862749 12:124027465-124027487 GAGGGTTTTAGCTCAGAAGATGG - Intronic
1105258875 13:18763991-18764013 GGGGGTCTTAGCTAAGATGATGG - Intergenic
1105261542 13:18783295-18783317 GGGGGTCTTAGCCAAGATGATGG - Intergenic
1105263889 13:18799874-18799896 GTGGGTCTTAGCCAAGACGATGG - Intergenic
1105300583 13:19130668-19130690 GGTGGTTTTAGCTATGATGTGGG + Intergenic
1106654947 13:31733277-31733299 GGGTGTTTGAGCTCAGATGAGGG + Intergenic
1106922179 13:34575241-34575263 GCTGTTCTTAGCAAAGATGAAGG - Intergenic
1108283576 13:48883503-48883525 GGGGATTTTAGCTAAACTGATGG - Intergenic
1112305508 13:98269763-98269785 GGGGGTGTCAGCGAAGATGTTGG + Intronic
1112531540 13:100208533-100208555 GGGGGTATTTGCTGAGATAAAGG - Intronic
1112894308 13:104279692-104279714 GGGGGTATTAGCTAAAAATAAGG - Intergenic
1112938978 13:104837749-104837771 GGAGGAGTTAGCTAAGAGGAGGG - Intergenic
1113859825 13:113474140-113474162 TGGGTTCTTAGCGAAGGTGAAGG + Exonic
1114601550 14:23959451-23959473 GGGGGGCTGAGCCAAGAGGATGG + Intronic
1114605728 14:23994581-23994603 GGGGGGCTGAGCCAAGAGGATGG + Intronic
1114970077 14:28015849-28015871 GGGGGTCTGAGTTAACATTATGG - Intergenic
1119272018 14:73314689-73314711 AGGCGTCATAGATAAGATGAAGG - Intronic
1119435757 14:74596829-74596851 GGGGGAGTTAGCTCAGAGGAAGG + Intronic
1120657934 14:87217886-87217908 GGTGGTCTTAACTAGGCTGATGG - Intergenic
1121272807 14:92649291-92649313 GGGGGTCTCAGCTCACATGTGGG + Intronic
1202834551 14_GL000009v2_random:68142-68164 GGAGGTCTTAGTCAAGACGATGG + Intergenic
1128373039 15:67054789-67054811 GGGGGCCTGAATTAAGATGAAGG + Intergenic
1131247711 15:90810002-90810024 GGGGGTCTTCCCAAGGATGATGG + Intronic
1131472363 15:92708353-92708375 GGAGGTTAGAGCTAAGATGACGG - Intronic
1133227638 16:4349660-4349682 GGGGGTCTAAGGTAGGAGGATGG + Intronic
1133563168 16:6968235-6968257 GGGGGTCTTTGCTGAGTTAAAGG - Intronic
1138305093 16:55967019-55967041 CGGGGTCTTAACTGAAATGAGGG + Intergenic
1140181684 16:72726335-72726357 GTGAGTGTTAGCTAATATGATGG + Intergenic
1141063344 16:80895116-80895138 TGTGGTCATACCTAAGATGAGGG + Intergenic
1142312767 16:89323551-89323573 GGGGGTCTGAGCTAAGGGCACGG + Intronic
1143795102 17:9329973-9329995 GCTGGTCATAGCTAAGAGGAAGG + Intronic
1145907825 17:28525905-28525927 GGGGGCAGTAGCTGAGATGATGG - Intronic
1148690135 17:49522432-49522454 GGGGGTCTTGGATAAGACCATGG + Intergenic
1149896415 17:60431902-60431924 GATGGTCTTAGCTAACATGGTGG + Intergenic
1151843445 17:76634248-76634270 GGGGGCCTGAGATAAAATGAGGG - Intronic
1152049403 17:77960013-77960035 GGGGATCTTAGCAAAAATGAAGG + Intergenic
1152762295 17:82115153-82115175 GGGGCTCTTTGCTCAGATGAAGG - Intronic
1154424478 18:14261511-14261533 GGGGTTCTTAGCCAAGATGATGG + Intergenic
1154432174 18:14316741-14316763 GGGGGTCTTAGCCAAGATGATGG + Intergenic
1159650693 18:70974123-70974145 GGGGGTCCTCCCTAAGATTAGGG + Intergenic
1161577992 19:5065286-5065308 GGAGCCCTTAGCTACGATGACGG - Intronic
1163668420 19:18613693-18613715 GGGGCTCTTAGCTCTGAGGAGGG - Intronic
1202638143 1_KI270706v1_random:59550-59572 GGAGGTCTTAGCCAAGACGATGG - Intergenic
928044832 2:27919352-27919374 GGAGGTCTTAGCCAGGATGGAGG - Intronic
932173432 2:69577928-69577950 GGGTGCCTTAGTGAAGATGAAGG - Intronic
934493568 2:94778997-94779019 GGGGGTCTTAGCCAAGACGATGG - Intergenic
935316453 2:101839459-101839481 GGAGGTCTTTGATAAAATGAAGG - Intronic
937120037 2:119434682-119434704 CTGGGTCCTAGCTGAGATGAAGG - Intronic
941362018 2:164563095-164563117 GGTGGTCTTAGTTTAGATGGTGG - Intronic
948956064 2:241292557-241292579 GGTGGTGTTAGCTATGATGAAGG + Intronic
1169648580 20:7842024-7842046 GGGAACCTTAGCTCAGATGAAGG - Intergenic
1171359104 20:24574095-24574117 GGTGATCTCAGCAAAGATGATGG - Intronic
1171884722 20:30643612-30643634 GGGGGTTTTAGCCAAGACGATGG - Intergenic
1173170802 20:40722022-40722044 GGGTGGCTTAGCTGAAATGAGGG - Intergenic
1174519454 20:51118485-51118507 GAGGGTGTTTGCTAAGCTGAAGG - Intergenic
1175443411 20:59005811-59005833 GAGGCTCTTAGCAAAGAGGAAGG - Intronic
1176844869 21:13869013-13869035 GGGGGTCTTAGCCGAGATGATGG - Intergenic
1176847600 21:13888574-13888596 GGGGGTCTTAACCAAGATGATGG - Intergenic
1180079483 21:45480259-45480281 TGGGGTCTTGGCTGAGCTGAGGG + Intronic
1180363824 22:11922329-11922351 GGAGGTCTTAGCCAAGACGATGG + Intergenic
1183028932 22:35087516-35087538 AGGGGTCTTTGCTAGGCTGAGGG + Intergenic
1184292367 22:43504544-43504566 GGTGGTGATAGCAAAGATGATGG + Intronic
1184786067 22:46672565-46672587 GGGGGTCCTAGCAGAGCTGAGGG + Intronic
959002125 3:100976685-100976707 TGGGGTCTAAGCTAAGACCAAGG + Intronic
963430693 3:145197838-145197860 GGGGGTCTTAGGTAAGATCTAGG - Intergenic
964582782 3:158259348-158259370 GGTGGTCTTTGGTAAGATGCAGG + Intronic
967636726 3:191809690-191809712 GGTGGTCTTGGTTAAGATGAAGG - Intergenic
971499572 4:27303954-27303976 ATGGGTCTTAGCTAAAATCAAGG - Intergenic
973368365 4:49225897-49225919 GGGGGTTTTAGCCAAGACGATGG - Intergenic
973392682 4:49569528-49569550 GGGGGTTTTAGCCAAGACGATGG + Intergenic
977123733 4:93138075-93138097 GGGGGGCTCAGGTAAGAGGATGG - Intronic
980705351 4:136485803-136485825 GGGGTTGTTAGATAAGATGATGG + Intergenic
980873335 4:138635196-138635218 GGGGCTCTAAGTTTAGATGAAGG - Intergenic
984794868 4:183650269-183650291 GAGGGTGGTAGCTAAGATCATGG - Intronic
1202765473 4_GL000008v2_random:145408-145430 GGAGGTCTTAGCCAAGACGATGG - Intergenic
986081364 5:4398203-4398225 GGGGGTCTTCGCTAACACAATGG + Intergenic
986449264 5:7850103-7850125 GGGTGTCTTAGCTGCGATCAGGG - Intronic
988986194 5:36621293-36621315 GGGGATCCTGTCTAAGATGATGG + Intronic
991212536 5:64122531-64122553 GGGAATCTTAGCTAATAAGATGG - Intergenic
993230161 5:85225743-85225765 GGGGGACTTAGGAAAGATAAGGG + Intergenic
1007714780 6:43849442-43849464 GGGTGTCTGAGCAGAGATGAGGG + Intergenic
1010514297 6:76754051-76754073 GGTGGTCTTGGCTAAGATCTTGG - Intergenic
1011366281 6:86585594-86585616 GGGAGTCTGAGGTAAGAGGATGG + Intergenic
1011447060 6:87452193-87452215 GGTGGTCTTGGGTAAGATGTGGG - Intronic
1012477557 6:99631260-99631282 GGGTGTATTAGCTTGGATGAGGG + Intergenic
1018515931 6:164580310-164580332 GTGGGTTTTAGCTAAGATTCAGG - Intergenic
1021763088 7:23920388-23920410 GAGTGACTTAGCTAAAATGAGGG - Intergenic
1022503695 7:30897681-30897703 GGGGGTTGGAGCTCAGATGAGGG + Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024395316 7:48859603-48859625 GGTGGTCCTGGCTAAGAAGAAGG - Intergenic
1024399920 7:48912683-48912705 GGTGGTCCTGGCTAAGAAGAAGG + Intergenic
1026075669 7:67165481-67165503 GGTTGTCAAAGCTAAGATGATGG - Intronic
1026701189 7:72646816-72646838 GGTTGTCAAAGCTAAGATGATGG + Intronic
1027674837 7:81144057-81144079 GGTGGTCTTGGCTAAGATCCAGG - Intergenic
1028693117 7:93676395-93676417 TTGGCTGTTAGCTAAGATGAGGG + Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1031205484 7:118751800-118751822 AGGGGTCTTTGATAAGATAATGG - Intergenic
1037322030 8:17652944-17652966 GGTGGTCTAAGCTAAAAAGAAGG - Intronic
1043042191 8:75276778-75276800 GGTGGTCTTAGGTAAGATCCAGG - Intergenic
1045071826 8:98514179-98514201 GGTGGTCTTCTCTAAGATGTAGG + Intronic
1047075526 8:121397997-121398019 GTGGGTCTCAGTTAAGATGTTGG + Intergenic
1047219967 8:122911261-122911283 AGGGGGCTTTGCCAAGATGAGGG + Intronic
1048041244 8:130730625-130730647 GGGAGCCTCTGCTAAGATGAAGG + Intergenic
1053663512 9:40301033-40301055 GGGGGTCTTATCCAAGACGATGG + Intronic
1054375635 9:64447267-64447289 GGGGGTCTTATCCAAGACGATGG + Intergenic
1054521102 9:66075252-66075274 GGGGGTCTTATCCAAGACGATGG - Intergenic
1056715111 9:89022154-89022176 CTGGGTCTTGGCTAAGATCATGG - Intronic
1059536375 9:115084740-115084762 CTGGGTCTTAGCTCAGATGCAGG + Intronic
1203546218 Un_KI270743v1:130298-130320 GGAGGTCTTAGCCAAGATGATGG - Intergenic
1190393218 X:49953408-49953430 GGGAGTCTGAGGTAAGAGGATGG - Intronic
1190602580 X:52107949-52107971 GGTGGTCTTGGGTAAGATCATGG + Intergenic
1193953957 X:87835528-87835550 GGGGGTATTAGATCAGTTGATGG + Intergenic
1194045663 X:88998816-88998838 GAGTGTCTTAGTTAAGATTAGGG + Intergenic