ID: 1105260688

View in Genome Browser
Species Human (GRCh38)
Location 13:18777144-18777166
Sequence TGTGCTCGGGATGTGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 6, 2: 5, 3: 29, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105260688_1105260695 -6 Left 1105260688 13:18777144-18777166 CCAGATCCCACATCCCGAGCACA 0: 1
1: 6
2: 5
3: 29
4: 284
Right 1105260695 13:18777161-18777183 AGCACAAGAGTATGTGGCCTGGG 0: 1
1: 0
2: 6
3: 15
4: 154
1105260688_1105260696 3 Left 1105260688 13:18777144-18777166 CCAGATCCCACATCCCGAGCACA 0: 1
1: 6
2: 5
3: 29
4: 284
Right 1105260696 13:18777170-18777192 GTATGTGGCCTGGGCTCCCAAGG 0: 1
1: 6
2: 4
3: 51
4: 287
1105260688_1105260697 9 Left 1105260688 13:18777144-18777166 CCAGATCCCACATCCCGAGCACA 0: 1
1: 6
2: 5
3: 29
4: 284
Right 1105260697 13:18777176-18777198 GGCCTGGGCTCCCAAGGCCTTGG 0: 7
1: 45
2: 219
3: 544
4: 1301
1105260688_1105260694 -7 Left 1105260688 13:18777144-18777166 CCAGATCCCACATCCCGAGCACA 0: 1
1: 6
2: 5
3: 29
4: 284
Right 1105260694 13:18777160-18777182 GAGCACAAGAGTATGTGGCCTGG 0: 1
1: 0
2: 7
3: 14
4: 194
1105260688_1105260698 10 Left 1105260688 13:18777144-18777166 CCAGATCCCACATCCCGAGCACA 0: 1
1: 6
2: 5
3: 29
4: 284
Right 1105260698 13:18777177-18777199 GCCTGGGCTCCCAAGGCCTTGGG 0: 8
1: 69
2: 263
3: 566
4: 1418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105260688 Original CRISPR TGTGCTCGGGATGTGGGATC TGG (reversed) Intergenic
900338032 1:2174416-2174438 TGCTGTGGGGATGTGGGATCTGG + Intronic
900395929 1:2453232-2453254 TGTGCTCGAGATGTGGTCTGTGG + Intronic
901187443 1:7384150-7384172 TGTGCCAGGGATGTGGGAAAAGG + Intronic
902866238 1:19281781-19281803 TGTGCCCAGGATGTGGGATATGG + Intergenic
904283408 1:29437231-29437253 TGTGCCCGGGATGCAGGACCTGG + Intergenic
904887720 1:33753773-33753795 TGTGCCCAGGATGTGGGATATGG + Intronic
906017134 1:42591885-42591907 TGTGCCCTGGATGTGGGACATGG + Intronic
906813780 1:48856388-48856410 TGTGCTAAGGTTGTGGGATTAGG + Intronic
906932817 1:50186411-50186433 AGTGCCTGGGATCTGGGATCAGG + Intronic
908176967 1:61565616-61565638 TGTGCCCAGGATGTGGGACATGG - Intergenic
908616748 1:65930553-65930575 TGTGCCCTGGATGTGGGACATGG + Intronic
909455602 1:75845547-75845569 TGTGCCCCTGATGTGGGATATGG - Intronic
911056280 1:93711041-93711063 TGTTCTCAGGATGTGGAAGCTGG + Intronic
911644151 1:100320658-100320680 TGTGCCCTGGATGTGGGACATGG + Intergenic
912099266 1:106185303-106185325 TGTGACCTGGATGTGAGATCTGG + Intergenic
915473777 1:156140628-156140650 TGTGCTCAGGTTGGGGGATTGGG + Intergenic
915787034 1:158624414-158624436 TGTGCCCTGGATGTGGGACATGG + Intronic
917002419 1:170374694-170374716 TGTGCCCTGAATGTGGGATATGG - Intergenic
917235559 1:172888418-172888440 TGTGCCCAGGATGTGGGACATGG - Intergenic
917839180 1:178963687-178963709 TGTGCTCTGGCTGTGGGGTCAGG + Intergenic
919521978 1:198600125-198600147 TATGCTCTGGATGTGAGATATGG + Intergenic
920092351 1:203463719-203463741 TGGGCTCCGGATGAGGGATGGGG + Intergenic
920961227 1:210665731-210665753 TGGGCTTGGGATGTGGACTCTGG + Intronic
921271496 1:213474255-213474277 TCTGCTTGGGAACTGGGATCCGG - Intergenic
921465020 1:215477255-215477277 TGTGCCCTGGATGTGGGACATGG - Intergenic
921794963 1:219332210-219332232 GGAGCTGGGGATGTGGGATAAGG + Intergenic
923197917 1:231686001-231686023 TGTGACCTGGATGTGAGATCTGG - Intronic
923205240 1:231752930-231752952 TGTGCTCTGGATGTGAGACATGG - Intronic
1066132724 10:32409728-32409750 TGTGCCCAGGATGTGGGACATGG + Intergenic
1067751789 10:48976507-48976529 TGTGGTTGGGGAGTGGGATCTGG + Intronic
1067783037 10:49222946-49222968 TGTGCCCAGGATATGGGATATGG - Intergenic
1068070195 10:52185344-52185366 TGTGCACTGGATGTGGGATGTGG - Intronic
1068117553 10:52751398-52751420 TGTGCTGGGGGTGAGGGATCAGG - Intergenic
1069106075 10:64384920-64384942 TGTGCCCTGGATGTGGGACATGG - Intergenic
1070688807 10:78509683-78509705 TGTGCTGGGGCTGGGGGATGAGG - Intergenic
1071509387 10:86251592-86251614 TGGCCTGGGGATCTGGGATCAGG + Intronic
1071667002 10:87568226-87568248 TGTGCCCTGGATGTGGGAAATGG + Intergenic
1071766861 10:88676550-88676572 TGTGCTGGGGATCTGGGATATGG - Intronic
1071990075 10:91093038-91093060 TGTGCCCTGGATGTGGGACATGG - Intergenic
1072295958 10:94009779-94009801 TGTGCTCTGAATGTGGGACATGG - Intronic
1073251418 10:102122028-102122050 TGTGCTTAGGATGGGGGATAGGG + Intergenic
1074803985 10:117029111-117029133 TGTGCCCTGGATGTGGGACGTGG + Intronic
1075891166 10:125952540-125952562 GGTGCTGGGGCTGGGGGATCTGG + Intronic
1076035800 10:127197239-127197261 TGTGCTCTGGATGGGGGGTAGGG - Intronic
1077273088 11:1690946-1690968 TGTGCTCAGGCTGTGGGAGGTGG + Intergenic
1078754791 11:14199115-14199137 TTTGCTGGGCATGTGGGATTCGG + Intronic
1078994705 11:16685539-16685561 TGTGCCAGGGATGTGGGACATGG - Intronic
1079903929 11:26222276-26222298 TGTGCACTGGATGTGGTATATGG - Intergenic
1080136137 11:28857317-28857339 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1082780577 11:57284371-57284393 TGTGCTCTGGATGTGGGACATGG + Intergenic
1083622273 11:64055149-64055171 TGTGCTGGGCATGGTGGATCTGG - Intronic
1085086518 11:73671546-73671568 TGTGCCCTGGATGTGGGATATGG - Intergenic
1085145517 11:74192159-74192181 TGTGCCCTGGATGTGGGACATGG + Intronic
1089108056 11:116031649-116031671 TGACCTAGGGATGAGGGATCGGG + Intergenic
1090504706 11:127298502-127298524 TGTGACCTGGATGTGAGATCTGG + Intergenic
1090728799 11:129551833-129551855 TGTGCCCTGGATGTGGGACATGG + Intergenic
1090931141 11:131299143-131299165 TGTGCTGGGGAGGTGGGGTAGGG - Intergenic
1091669596 12:2443347-2443369 TGTGCCCTGGATGTGGGACACGG - Intronic
1093333953 12:17878327-17878349 TGTGCTCTGGATGTGAGACATGG - Intergenic
1093371956 12:18376260-18376282 TGTGCTTGGAATGTGGGATATGG + Intronic
1095564342 12:43603743-43603765 TGTGCTAGGGATGGGGTGTCAGG + Intergenic
1096561800 12:52440839-52440861 TGTGCCCGAGATGGGGCATCTGG - Intergenic
1097286234 12:57879591-57879613 TGGGCTATGGATGTGGGATATGG + Intergenic
1097286242 12:57879624-57879646 TGGGCTACGGATGTGGGATATGG + Intergenic
1097286267 12:57879731-57879753 TGGGCTATGGATGTGGGATATGG + Intergenic
1097286276 12:57879770-57879792 TGGGCTATGGATGTGGGATATGG + Intergenic
1097286300 12:57879873-57879895 TGGGCTATGGATGTGGGATATGG + Intergenic
1097302688 12:58035447-58035469 TGTGCCCTGGATGTGGGATGTGG - Intergenic
1097903879 12:64900506-64900528 TGTGCTCGGGTTGTGTGCACAGG - Intergenic
1098644337 12:72880095-72880117 TGTGCCCTGGATGTGGGACATGG - Intergenic
1099460918 12:82919780-82919802 TGTGCTCAGGATATGGGACATGG - Intronic
1103987717 12:124778663-124778685 TCTGCTGGGGATGTGGGTACAGG - Intronic
1105257116 13:18751216-18751238 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1105258031 13:18757839-18757861 TGTGCTCTGAATGTGGGATCTGG - Intergenic
1105259788 13:18770580-18770602 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1105260688 13:18777144-18777166 TGTGCTCGGGATGTGGGATCTGG - Intergenic
1105262468 13:18789903-18789925 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1105262979 13:18793550-18793572 TGTGCTCTGGATGTGGGATCTGG - Intergenic
1106383648 13:29264225-29264247 TGTGCCCTGGATGTGGGACATGG - Intronic
1107240725 13:38231138-38231160 GGTGCTGTGGATGTGGGACCTGG - Intergenic
1108896461 13:55334787-55334809 TGTGCTCTAGATGTAGGATATGG + Intergenic
1109169218 13:59075385-59075407 TGTGATCTGGATGTGAGATGTGG - Intergenic
1111479999 13:88811541-88811563 TGTACACTGGATGTGGGATATGG + Intergenic
1113107613 13:106788468-106788490 TGTGGTCGGGAGTGGGGATCAGG + Intergenic
1115876436 14:37867075-37867097 TGTGCTGGGGATATGGGACCAGG + Intronic
1115936536 14:38559320-38559342 TGTGCCCTGGATTTGGGACCTGG - Intergenic
1117210394 14:53492201-53492223 TGTGCTCCGGAATTGGGGTCTGG - Intergenic
1118671336 14:68131345-68131367 TGTGCTTGTGATGTGGGCTTTGG + Intronic
1118691462 14:68344300-68344322 TGTGCCCTGGATGTGGGACATGG + Intronic
1120392875 14:83930199-83930221 TGTGACCTGGATGTGAGATCTGG + Intergenic
1120525235 14:85569422-85569444 TGTGCTGGGACTGTGGGACCAGG + Intronic
1121672641 14:95724461-95724483 TGTGCTCAGGATGTGGAACATGG + Intergenic
1122831973 14:104402639-104402661 TGTGGTCTGGATGTGGGACATGG + Intergenic
1202834514 14_GL000009v2_random:67836-67858 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1123775489 15:23575140-23575162 TGTGCCCAGGATGTGGGACATGG + Intronic
1125590928 15:40854104-40854126 TGTGGTGGGGATGGGGGATGGGG - Intronic
1125919610 15:43517741-43517763 TGTGATAGGGAGGTGGGATGGGG + Intronic
1129264126 15:74384894-74384916 TGTGGACTGGATGTGGGCTCTGG - Intergenic
1131038885 15:89244067-89244089 GGTGCTCGGGCTGTGGGACTGGG + Intronic
1131105527 15:89731534-89731556 TGTGCTCACGCTGTGGGACCTGG + Exonic
1132009910 15:98266818-98266840 TGAGGACGGGATGTGGGGTCAGG - Intergenic
1133089944 16:3396360-3396382 TGTGCACGGGCTGTGGGAAGAGG - Intronic
1133969925 16:10560231-10560253 TGTTCCCAGGATGTGGGACCTGG - Intronic
1136364429 16:29802943-29802965 TGTTTTAGGGATGTGGGAGCTGG + Intronic
1143465112 17:7131332-7131354 TGTGCTGGGGAAGAGGGAGCAGG + Intergenic
1144040232 17:11403966-11403988 TGTGCTTGGGGTGTGGCCTCAGG - Intronic
1147037949 17:37695647-37695669 TGTGCCCAGGATGTGGGACATGG + Intronic
1148438246 17:47698484-47698506 TGGGCTTGGGATGTGTGACCTGG + Intronic
1151357348 17:73567677-73567699 TGTGCCCAGGATGTGGGACATGG + Intronic
1152095194 17:78268450-78268472 GGTGCACGGGATCGGGGATCAGG - Intergenic
1152257653 17:79249517-79249539 GGGGCTTGGGGTGTGGGATCTGG - Intronic
1152514211 17:80812855-80812877 TGTGCACGTGATTTGGAATCTGG + Intronic
1152893596 17:82896830-82896852 TGAGCTCGGGGTCCGGGATCTGG + Intronic
1153928748 18:9859359-9859381 AGTGCACAGGATGTGGGCTCTGG - Exonic
1154372176 18:13774330-13774352 TGTGCCCTGGATGTAGGATATGG - Intergenic
1154425328 18:14267648-14267670 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1154426235 18:14274221-14274243 TGTGCCCTGGATGTGGGACAGGG + Intergenic
1154428060 18:14287233-14287255 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1154428977 18:14293809-14293831 TGTGCCCTGGATGTGGGACAGGG + Intergenic
1154432136 18:14316435-14316457 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1154433023 18:14322887-14322909 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1154433925 18:14329457-14329479 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1155499405 18:26471909-26471931 TGGGCTAGGGAGGTGGGATGAGG + Intronic
1156047905 18:32897848-32897870 TGTGCCCAGGATGTGGGACATGG + Intergenic
1156386135 18:36606907-36606929 TGTGCCCAGGATGTGGGACATGG - Intronic
1157034384 18:43953548-43953570 TGTGCCCTGGATGTGGGACATGG + Intergenic
1158012378 18:52743707-52743729 TGTGCTCGGAATGTCGGATGTGG + Intronic
1159759606 18:72408283-72408305 TGTGCCCTGGATGTGGGACACGG + Intergenic
1159944727 18:74435837-74435859 TGTGTTGGGGATGTGGGTTAGGG - Exonic
1160010099 18:75100857-75100879 TGTGCCCAGGATATGGGATATGG - Intergenic
1160396320 18:78574817-78574839 TGTGCCCTGGATGTGGCATATGG + Intergenic
1160817744 19:1043851-1043873 GGTGCTGGGGAGGTGGGATGTGG + Intronic
1160951375 19:1669134-1669156 TGTGCTGGCGAGGGGGGATCAGG - Intergenic
1161810845 19:6470404-6470426 TGGGATGGGGAGGTGGGATCTGG - Intronic
1164559254 19:29277322-29277344 AGTGGTCGGGGTGTGGGCTCTGG + Intergenic
1165411883 19:35666955-35666977 TGAGCTCGGGGTGGGGGATGAGG + Intronic
1165800264 19:38545225-38545247 TGTGCTCTGACTGTGGGATGGGG + Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166171095 19:41028041-41028063 TGGGCTTTGGATTTGGGATCTGG + Intergenic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1166887551 19:45971437-45971459 TGTGCTGGGGGTGGGGGAGCAGG + Intronic
1167684779 19:50949682-50949704 TGGGTTGGGGATGTGGGAGCAGG - Intronic
1167716290 19:51144581-51144603 GGTGCTGGGGCTGTGGGATGAGG - Exonic
1168149789 19:54439620-54439642 TGTGCTTGGGAAATGGGCTCAGG - Intergenic
1202638179 1_KI270706v1_random:59856-59878 TGTGCCCTGGATGTGGGACAAGG - Intergenic
925170649 2:1748326-1748348 TGTGCCTGGCCTGTGGGATCAGG + Intergenic
926749291 2:16185814-16185836 TGGGCTGGGGCTGTGGGATGAGG + Intergenic
926886315 2:17602072-17602094 GGTGATCTGGATTTGGGATCTGG + Intronic
929447169 2:42010720-42010742 GGTGCTTGGGATCTGGGATTTGG - Intergenic
929625630 2:43403812-43403834 TGTGTTGGGGGTGTGGGGTCAGG - Intronic
934096721 2:88613758-88613780 TGGGATTTGGATGTGGGATCCGG - Exonic
934492768 2:94773057-94773079 TGTGCTCTGGATGTGGGATCTGG - Intergenic
934493606 2:94779303-94779325 TGTGCCCTGGATGTGGGACAAGG - Intergenic
934736980 2:96694464-96694486 GGTGCTGGCGATGTGGGATGGGG + Intergenic
935448930 2:103187641-103187663 TGTGATCTGGATGTGAGACCTGG + Intergenic
935625904 2:105172193-105172215 TGTGATCTGGATGTGAGACCTGG - Intergenic
935931608 2:108132995-108133017 TGTGCCCTGGATGTGGGACATGG - Intergenic
936160513 2:110081056-110081078 TGTGTTCTGGATGTGAAATCTGG + Intergenic
936184151 2:110290298-110290320 TGTGTTCTGGATGTGAAATCTGG - Intergenic
938279732 2:130055506-130055528 TGTGCCCTGGATGTGGGACAAGG - Intergenic
938330683 2:130446220-130446242 TGTGCCCTGGATGTGGGACAAGG - Intergenic
938359261 2:130675283-130675305 TGTGCCCTGGATGTGGGACAAGG + Intergenic
938435663 2:131281932-131281954 TGTGCCCTGGATGTGGGACAAGG + Intronic
939445922 2:142310198-142310220 TGTGCCCTGGATGTGAGATATGG - Intergenic
939518764 2:143203233-143203255 TGGAGTGGGGATGTGGGATCTGG - Intronic
942550903 2:177117969-177117991 TGTGCTCAGGGTGTCGGCTCAGG - Intergenic
943571781 2:189581956-189581978 TGTGCTCAAGGTGTGGCATCTGG - Intronic
943876231 2:193071321-193071343 TGTGCCTGGGATGTGGGACATGG + Intergenic
946055775 2:216900830-216900852 TGTGCCCTGGATGTGGGACATGG - Intergenic
946055969 2:216902098-216902120 TGTGCCCTGGATGTGGGACATGG + Intergenic
946193111 2:218017887-218017909 TGTGCTCTGGCTGAGGGCTCTGG - Intergenic
948376759 2:237525835-237525857 TGGGCTCGGCATGGGGGAGCAGG + Intronic
1169193303 20:3670927-3670949 TCTGCTGGGGCTGTGGGAGCTGG - Intronic
1171883837 20:30637283-30637305 TGAGCTCTGGATGTGGGATCTGG - Intergenic
1171884756 20:30643919-30643941 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1173314761 20:41933047-41933069 TGTGCTCTGGATGTGGGACATGG + Intergenic
1175841779 20:62032562-62032584 AGTGCTGGGGATGTGGTTTCAGG - Intronic
1175981694 20:62741874-62741896 GGAGCTCAGGCTGTGGGATCAGG + Intronic
1176043937 20:63082840-63082862 TGTGTTTGGGATGTGAGACCAGG - Intergenic
1176843107 21:13856266-13856288 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1176844025 21:13862868-13862890 TGTGCTCTGAATGTGGGATCTGG - Intergenic
1176844906 21:13869319-13869341 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1176845793 21:13875614-13875636 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1176846705 21:13882192-13882214 AGTGCTCTGGATGTGGGATCTGG - Intergenic
1176848528 21:13895168-13895190 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1177206653 21:18017934-18017956 TGTGCCCTGGATGTGGGACATGG + Intronic
1177288367 21:19079192-19079214 TGTGCCTGGGATGTGGGACATGG + Intergenic
1177835673 21:26184207-26184229 TGTGCCCTGGATGTGGGACATGG - Intergenic
1178029205 21:28505393-28505415 TGTGCCCTGGATGTGGGACATGG - Intergenic
1178218194 21:30625089-30625111 TGTGCCCTGGATGTAGGATATGG - Intergenic
1180183125 21:46126793-46126815 TGTGCTCGGCATGTGGCCACTGG + Intronic
1180363789 22:11922023-11922045 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1181049053 22:20230150-20230172 TCTGCTCCGGCTGTGGGCTCCGG + Intergenic
1181161673 22:20963497-20963519 GGTGCTTGGGAAGTGGGGTCGGG - Intergenic
1181358360 22:22316192-22316214 TGTGCCCTGGATGTGGGAGACGG - Intergenic
1182347868 22:29679440-29679462 TGTGGTTGGGATCCGGGATCAGG + Intronic
1183228962 22:36569018-36569040 TGTGTTTGGGCTGGGGGATCAGG - Intronic
1184568609 22:45308693-45308715 GGTGCTCTGTATGTGGGGTCAGG - Intergenic
1184582632 22:45427967-45427989 GGTGCTGGGGAGGTGGGAGCAGG - Intronic
949311252 3:2700972-2700994 AGTGGTTGAGATGTGGGATCAGG + Intronic
953149994 3:40316027-40316049 TGGACTCGGGATGTGGGGTCTGG - Intergenic
954591639 3:51788298-51788320 TGTGATCTGGATGTGCGATCTGG + Intergenic
954710775 3:52504183-52504205 TGTGCTGGGGGTGAGGGGTCGGG - Intronic
955599825 3:60633236-60633258 TGCAATCGGGATGTGGAATCAGG - Intronic
957576544 3:82015177-82015199 TGTGCCCTGGATGTGGGACATGG + Intergenic
958445565 3:94210666-94210688 TGTGCCCAGGATGTGGGAGATGG + Intergenic
958678558 3:97296334-97296356 TGTGCTCAGGAACTGGGATGGGG + Intronic
959459183 3:106604033-106604055 TTTGCTGGGGATGTGGGTGCTGG + Intergenic
959804356 3:110533203-110533225 TGTGCCCTGGATGTGGGACATGG + Intergenic
959935355 3:112023036-112023058 TGTGCCCTGGATGTGGGACATGG + Intergenic
960341824 3:116484218-116484240 TGTGCTGGGGAGGTTGGATGGGG + Intronic
961056039 3:123789553-123789575 TGGGCACGGGAAGAGGGATCTGG + Intronic
962368967 3:134805105-134805127 TGAGCTGGGGATGGGGGATTGGG + Intronic
963511796 3:146256531-146256553 TGTGCCCTGGATGTGGGACATGG - Intergenic
965298436 3:166978121-166978143 TGTGCCTTGGATGTGGGATATGG + Intergenic
965865365 3:173199055-173199077 TGTGCCCTGGATGTGGGACATGG - Intergenic
965891480 3:173519521-173519543 TGTGCCCTGGATGTGGGACATGG + Intronic
967260162 3:187634204-187634226 TGTGCCCCAGATGTGGGATATGG - Intergenic
967304718 3:188049437-188049459 TGTGTTCTGGATCTGGGTTCTGG - Intergenic
967479071 3:189953649-189953671 AGTGCTCTGGATGTGGGAACAGG + Intergenic
968350707 3:198049710-198049732 TGTGCCCTGGATGTGGGACAAGG - Intergenic
969130401 4:4986941-4986963 GGTGGTTGGGGTGTGGGATCTGG - Intergenic
969457070 4:7306263-7306285 TGTGCTGGGGCAGTGGGCTCCGG + Intronic
970665641 4:18333463-18333485 TGTGCCCTGGATGTGGGACATGG - Intergenic
971175633 4:24279820-24279842 TGTGCTCAGGATGTGCAATTTGG + Intergenic
972903769 4:43718867-43718889 TGAGCTCGGGTTGTAGGTTCTGG + Intergenic
973194291 4:47422107-47422129 TTTGCTGGGGATTTGAGATCAGG - Intronic
973367495 4:49219553-49219575 TGTGCTCTGGATGTGGGATCTGG - Intergenic
973542328 4:51946783-51946805 TGTGCCCTGGAGGTGGGACCAGG + Intergenic
973780327 4:54282947-54282969 TGTGCTCTGGACATGGGATATGG - Intronic
973822555 4:54675811-54675833 TGGGCTGTGGATGTGGGCTCCGG + Intronic
974540386 4:63225923-63225945 TGTGCCCTGGATGTGGGACACGG + Intergenic
975609931 4:76193544-76193566 TGTGCTCTGGATGTGAGACACGG + Intronic
978408585 4:108405400-108405422 TGTGCCCAGGATGTGGGACATGG - Intergenic
979860425 4:125686639-125686661 TGTGCCCAGGATGTGGGATATGG - Intergenic
979951270 4:126896942-126896964 TGTGCTCTGGATGTGAGACATGG - Intergenic
980614026 4:135194799-135194821 TGTGCCCTGGAAGTGGGATTTGG + Intergenic
980830735 4:138127238-138127260 TGTGCCCTGGATGTGGGACATGG + Intergenic
981516283 4:145613249-145613271 TGTGCCCAGGATGTGGGATATGG + Intergenic
983547519 4:168979164-168979186 TGTGCTTGGGGTGTGGGAGCAGG - Intronic
1202765509 4_GL000008v2_random:145714-145736 TGTGCCCTGGATGTGGGACAAGG - Intergenic
986662727 5:10073802-10073824 TCTGCTCAGGATTTGGGATTTGG - Intergenic
987870877 5:23615060-23615082 TGTGCCCTGGATGTGGGATATGG + Intergenic
988310259 5:29548219-29548241 TGTGCCCTGGATGTGGGACATGG - Intergenic
992666220 5:79012293-79012315 TGTGCCCTGGATGTGAGATATGG - Intronic
993781193 5:92066882-92066904 TGTGCTCTGGATGTGGGACATGG + Intergenic
994073673 5:95628520-95628542 TGTGCTCTGGATGTGGGACATGG - Intergenic
995683517 5:114745962-114745984 TGTGCCCTGGATGTGGGACATGG + Intergenic
996126203 5:119727961-119727983 TGTGCTCTGGATGTGAGATGTGG + Intergenic
997415737 5:133727083-133727105 TTAGCTCTGGATGTGGGATGTGG - Intergenic
999842971 5:155449232-155449254 TGTGCTCTGAATGTGGGACATGG - Intergenic
1000226605 5:159267240-159267262 TGTGACCTGGATGTGAGATCTGG + Intronic
1000546632 5:162610801-162610823 TGTGTCCGGGATGTGGGACATGG + Intergenic
1002466529 5:179411524-179411546 TGTGGCTGGGATTTGGGATCTGG - Intergenic
1005908119 6:30283622-30283644 TGTGCCCTGGATGTGAGATATGG - Intergenic
1006933537 6:37701813-37701835 TCTGCTGGGGGTGTGGGATGAGG - Intergenic
1008099111 6:47372256-47372278 TGTGCCCAGGATATGGGATATGG + Intergenic
1010498553 6:76566715-76566737 TGTGCCCTGGATGTGGGACATGG - Intergenic
1013590883 6:111618903-111618925 TGTACCCGGGATGTGGGTTTTGG - Intergenic
1015252644 6:131142880-131142902 TGTGCCCTGGATGTGGGACATGG + Intronic
1016284900 6:142462387-142462409 TGTGCCCTGGATGTGAGATATGG - Intergenic
1018662534 6:166101704-166101726 TGTGCCCTGGATGTGGGACATGG - Intergenic
1019809949 7:3158024-3158046 TGTGCTGGGGAGATGGGAGCAGG - Intronic
1020565286 7:9787588-9787610 TATGCTCTGGATGTGGGACATGG - Intergenic
1022441386 7:30436254-30436276 TGTGCTCTGTGTGTGGGCTCTGG - Intronic
1024548030 7:50538649-50538671 TCTGCTAGGGATGAGGTATCAGG + Intronic
1027479999 7:78683664-78683686 AGTGCCTGGGATGTGGGATAAGG - Intronic
1027528561 7:79301375-79301397 TGTGCCCTGGATGTGGGACATGG + Intronic
1030834442 7:114265384-114265406 TGTGCCCTGGATGTGGGACATGG - Intronic
1031055829 7:116991986-116992008 TGTGACCGGGATGTGAGACCTGG - Intronic
1032477638 7:132223337-132223359 TGTGCTGGGACTGTGGGTTCTGG - Intronic
1034174518 7:149090469-149090491 TCTGCTGGGGATGTGGATTCCGG - Intronic
1035028909 7:155844755-155844777 TGTGCTCGGGCTGGGGCATGGGG - Intergenic
1035862753 8:3047460-3047482 TGTGCTCTGAATGGGGCATCAGG - Intronic
1037364113 8:18104181-18104203 TGTGCCCTAGATGTGGGATATGG + Intergenic
1039022467 8:33223028-33223050 TTTGGTTGTGATGTGGGATCGGG - Intergenic
1039168496 8:34714333-34714355 TGTGCCCTGGATGTGGGACTTGG - Intergenic
1041020281 8:53631881-53631903 TGTGATTGGGGTGTGGGCTCTGG + Intergenic
1041642147 8:60214675-60214697 TGTGCTCAGCCTGTGGGATCTGG - Intronic
1044559915 8:93602868-93602890 TGTGCTCTGGATTTGGCATTAGG + Intergenic
1044945352 8:97384202-97384224 TGTGCTCTGGATGCAGGATACGG - Intergenic
1045079020 8:98604289-98604311 TGTGCCCTGGATGTGGGACATGG - Intronic
1047194987 8:122713031-122713053 TGTGATCTGGATGTGAGACCTGG + Intergenic
1048416728 8:134235198-134235220 TGTGCTCTGGATGTGAGACATGG - Intergenic
1049986062 9:952758-952780 TCTACTTGGAATGTGGGATCAGG + Intronic
1051021377 9:12547776-12547798 TGTGCTCAGTATGTGGGATCGGG - Intergenic
1052878282 9:33583761-33583783 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1052879591 9:33593057-33593079 TGTGTTCTGGATGTGGGATTTGG + Intergenic
1053496390 9:38551176-38551198 TGTGTTCTGGATGTGGGATTTGG - Intronic
1053497700 9:38560446-38560468 TGTGCCCTGGATGTGGGACAAGG - Intronic
1053663478 9:40300727-40300749 TGTGCCCTGGATGTGGGACAAGG + Intronic
1053913986 9:42931268-42931290 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1053914523 9:42935881-42935903 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1054375601 9:64446961-64446983 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1054521136 9:66075558-66075580 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1055334916 9:75223915-75223937 TGTGCTCTGGATGTGAGATATGG - Intergenic
1055623453 9:78149560-78149582 TGTGCTTGGAAAGTGGGAGCTGG + Intergenic
1056527210 9:87454704-87454726 TGTGCCCTGGATGTGGGACATGG - Intergenic
1056586046 9:87927911-87927933 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1056610836 9:88125032-88125054 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1057222563 9:93265087-93265109 TATGCTCTGGACCTGGGATCTGG - Intronic
1057642295 9:96836090-96836112 TGTGCTGAGGATGTGGGACATGG + Intronic
1057675868 9:97135618-97135640 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1057677167 9:97144929-97144951 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1058169443 9:101662476-101662498 AGTGCTCGGCATGTGGGAAATGG + Intronic
1059232278 9:112732009-112732031 TGTGCTTGGGATCTGGCATTTGG + Intergenic
1060149377 9:121278454-121278476 TCTGCTCTGGAGGTGGGATGGGG - Intronic
1062167511 9:135115333-135115355 TGTGCTGGGGAAGTGGGGCCTGG - Intronic
1203546254 Un_KI270743v1:130604-130626 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1187471709 X:19575548-19575570 GGTGCTTGGCATGAGGGATCAGG - Intronic
1188957317 X:36448874-36448896 TGTGCCCTGGATGTGAGATATGG - Intergenic
1189871939 X:45393479-45393501 TGTGCTCTGGATGTGGAACATGG - Intergenic
1190415035 X:50172560-50172582 TGTGCTTGGGCTGTGGGATGTGG + Intergenic
1191735451 X:64384175-64384197 TGTGCCCTGGATGTGGGACATGG - Intronic
1193058776 X:77182306-77182328 TGTGCTCTGGATGTGTGACAAGG + Intergenic
1193195974 X:78631854-78631876 TGTGCCCTGGATGTGAGACCTGG + Intergenic
1193772573 X:85605412-85605434 TGTGCCCTGGATGTGGGACATGG - Intergenic
1194038791 X:88914831-88914853 TGTGCTCTGGATGTGAGACATGG - Intergenic
1194082845 X:89489813-89489835 TGTGCTCTGGATGTGAGACATGG - Intergenic
1195814154 X:108867352-108867374 TGTGCCCTGGATGTGGGACATGG - Intergenic
1196935480 X:120726375-120726397 TATGCTGGGGCTGTGGGATTTGG + Intergenic
1198873995 X:141203696-141203718 TGTGCCCTGGATGTGGGACATGG - Intergenic
1199423698 X:147676579-147676601 TGTGCCCTGGATGTGGGACATGG + Intergenic
1200242661 X:154506058-154506080 TCTGCTCGGGCTGTGGGAGCAGG + Intergenic
1200435497 Y:3145694-3145716 TGTGCTCTGGATGTGAGACATGG - Intergenic