ID: 1105261542

View in Genome Browser
Species Human (GRCh38)
Location 13:18783295-18783317
Sequence GGGGGTCTTAGCCAAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 2, 1: 6, 2: 10, 3: 7, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105261542 Original CRISPR GGGGGTCTTAGCCAAGATGA TGG (reversed) Intergenic
901322983 1:8350570-8350592 AGGGCTCTTAGCTCAGATGACGG + Intergenic
903441797 1:23393884-23393906 AGGGCTTATAGCCAAGATGACGG - Exonic
906203816 1:43976232-43976254 TGGGGTCTTAGGCATGCTGAGGG + Intronic
909920800 1:81378309-81378331 GGGAGTCTGAGGCAAGAGGATGG + Intronic
916824728 1:168432455-168432477 GGGGTTCTAAGCCAATAGGAAGG + Intergenic
916982478 1:170153878-170153900 GGTGCTAATAGCCAAGATGATGG + Intronic
917679935 1:177355337-177355359 GGGGGTCTGTGCCAAGCTGAAGG + Intergenic
918622387 1:186620471-186620493 GGGGGTATATGCAAAGATGAGGG + Intergenic
923516070 1:234698872-234698894 GGGGATCTTAACCAGGGTGACGG + Intergenic
1063686538 10:8242151-8242173 TGCGGTCTTATCCCAGATGAAGG - Intergenic
1063702960 10:8403526-8403548 GGGGGTGTTTGCCAACATGGTGG + Intergenic
1070495274 10:77015702-77015724 GTTGATCTTAACCAAGATGAGGG - Intronic
1074298811 10:112214833-112214855 GGGGTTCTGAGCCAGGATGGAGG + Intronic
1075060386 10:119252956-119252978 GGTGGTCTTAGGGAAAATGATGG + Intronic
1076889674 10:133277373-133277395 GGGGGTCCCAGCCCAGGTGATGG + Intergenic
1077169665 11:1160575-1160597 GGGGGGCTGAGCCCAGATGCAGG - Intronic
1077593692 11:3513408-3513430 GGTCGTCTTAGACAAGTTGATGG + Intergenic
1083707985 11:64529802-64529824 GAGGGGCTTAGCCAAGGTCACGG - Intergenic
1083874861 11:65516862-65516884 GGGGGTCTGGGCCACGATGGGGG + Intergenic
1084025936 11:66449555-66449577 GGGTGTCTGAGTTAAGATGAAGG - Intronic
1084823297 11:71709353-71709375 GGTGGTCTTAGACAAGTTTATGG - Intergenic
1086492949 11:87373944-87373966 GGTGTTCCTAACCAAGATGAGGG - Intergenic
1089202992 11:116736086-116736108 AGGGGGCTGAGCCAAGATAATGG + Intergenic
1090324397 11:125872063-125872085 GGGGGTCTTATCCCTGATGCAGG + Intergenic
1091457077 12:615968-615990 GGGGGTTTTAGCTAGGGTGAGGG + Intronic
1092108711 12:5944259-5944281 GAGGATCTTAGACAAGGTGAAGG - Intronic
1092584074 12:9878422-9878444 CGGAGTTTGAGCCAAGATGATGG + Intergenic
1093007971 12:14071525-14071547 GGGGGTCTTAACTGGGATGACGG - Intergenic
1105258875 13:18763991-18764013 GGGGGTCTTAGCTAAGATGATGG - Intergenic
1105261542 13:18783295-18783317 GGGGGTCTTAGCCAAGATGATGG - Intergenic
1105263889 13:18799874-18799896 GTGGGTCTTAGCCAAGACGATGG - Intergenic
1106922179 13:34575241-34575263 GCTGTTCTTAGCAAAGATGAAGG - Intergenic
1111146086 13:84182379-84182401 GGGAGTCTTAGGCAGGAGGATGG - Intergenic
1112305508 13:98269763-98269785 GGGGGTGTCAGCGAAGATGTTGG + Intronic
1113859825 13:113474140-113474162 TGGGTTCTTAGCGAAGGTGAAGG + Exonic
1114601550 14:23959451-23959473 GGGGGGCTGAGCCAAGAGGATGG + Intronic
1114605728 14:23994581-23994603 GGGGGGCTGAGCCAAGAGGATGG + Intronic
1114688177 14:24554912-24554934 AGTGCTCATAGCCAAGATGACGG + Intergenic
1119854968 14:77892821-77892843 GGTTGTGTTAGCCAGGATGATGG + Intronic
1121126358 14:91409412-91409434 GGGGGTCTGAGGCAGGAGGATGG - Intronic
1121203440 14:92140358-92140380 GGGAGGCTGAGGCAAGATGATGG + Intronic
1121410503 14:93745579-93745601 GGGGGCCTGAGCCAGGAGGAAGG - Intronic
1122818042 14:104323672-104323694 CGGAGTCTGAGCCAAGGTGAGGG - Intergenic
1202834551 14_GL000009v2_random:68142-68164 GGAGGTCTTAGTCAAGACGATGG + Intergenic
1125134639 15:36327637-36327659 GGGGGGCTGAGGCAAGAGGATGG - Intergenic
1130362862 15:83207354-83207376 CCTGGTCTTCGCCAAGATGAAGG - Exonic
1131247711 15:90810002-90810024 GGGGGTCTTCCCAAGGATGATGG + Intronic
1136176527 16:28520906-28520928 GTGGGTGTGAGCCAGGATGAGGG - Intergenic
1139876216 16:70148218-70148240 AGGAGTTTTAGCCAAGCTGATGG - Intronic
1140359573 16:74332880-74332902 AGGAGTTTTAGCCAAGCTGATGG + Intergenic
1143589638 17:7874550-7874572 GGGCTTCTTACACAAGATGAGGG + Intronic
1152049403 17:77960013-77960035 GGGGATCTTAGCAAAAATGAAGG + Intergenic
1152115734 17:78385959-78385981 GTGGGTCTTCCTCAAGATGATGG + Intronic
1152762295 17:82115153-82115175 GGGGCTCTTTGCTCAGATGAAGG - Intronic
1153922040 18:9800449-9800471 GGCCGTCTGAGCCAAGAGGAAGG - Intronic
1154424478 18:14261511-14261533 GGGGTTCTTAGCCAAGATGATGG + Intergenic
1154432174 18:14316741-14316763 GGGGGTCTTAGCCAAGATGATGG + Intergenic
1157500962 18:48190440-48190462 GAGGGTTGTAGACAAGATGACGG + Intronic
1158056526 18:53286733-53286755 GGGCATCATAGCCATGATGAAGG + Intronic
1160928079 19:1556388-1556410 GGGGGTCTTGGCCCAGAGGCTGG + Exonic
1162270720 19:9612898-9612920 GGGGGACTGAGGCAGGATGATGG - Intronic
1163078276 19:14916004-14916026 GGGGGTTGTTGGCAAGATGATGG + Intergenic
1166008065 19:39920709-39920731 AGAAGTCTTAGCCAAGAGGATGG + Intronic
1166078378 19:40427191-40427213 GGGGGTCTGAGGCAGGAGGATGG - Intergenic
1166226315 19:41397812-41397834 GTGGTTGTTAGCCAAGATGGCGG + Exonic
1167714636 19:51134336-51134358 GGTGGTCTTGGCCAACATGGTGG - Intronic
1168582306 19:57565844-57565866 GGGGGTCTTAGGCAAGTTTTTGG - Intergenic
1202638143 1_KI270706v1_random:59550-59572 GGAGGTCTTAGCCAAGACGATGG - Intergenic
925100237 2:1237978-1238000 GGCGGTCTCAGCCAACATCAGGG + Exonic
928044832 2:27919352-27919374 GGAGGTCTTAGCCAGGATGGAGG - Intronic
932173432 2:69577928-69577950 GGGTGCCTTAGTGAAGATGAAGG - Intronic
932777260 2:74535721-74535743 GGGGGCCGCAGCCAACATGAGGG - Exonic
934493568 2:94778997-94779019 GGGGGTCTTAGCCAAGACGATGG - Intergenic
935239695 2:101167940-101167962 AGTGCTCATAGCCAAGATGAAGG + Intronic
940916248 2:159259126-159259148 GGGAGTCTGAGGCAAGAGGATGG - Intronic
946168457 2:217879480-217879502 GGGTGTCTTGGCCAATCTGAGGG + Intronic
948956064 2:241292557-241292579 GGTGGTGTTAGCTATGATGAAGG + Intronic
949031143 2:241798085-241798107 GGGGGGCTTTGCCCAGAGGATGG + Intronic
1170086837 20:12543745-12543767 GATGGTCTTAGACAAGATGCAGG + Intergenic
1171359104 20:24574095-24574117 GGTGATCTCAGCAAAGATGATGG - Intronic
1171884722 20:30643612-30643634 GGGGGTTTTAGCCAAGACGATGG - Intergenic
1172178732 20:32987789-32987811 GGGGGTCTCAGCCAAGCAGCCGG + Intronic
1173501929 20:43560069-43560091 GGGGGTCACAGTCAAGGTGATGG + Intronic
1174099171 20:48114056-48114078 GGGGATCTTCTCCAAGATAAAGG + Intergenic
1175443411 20:59005811-59005833 GAGGCTCTTAGCAAAGAGGAAGG - Intronic
1176411813 21:6453296-6453318 GGGGGACTTGGCCATGCTGAGGG + Intergenic
1176844869 21:13869013-13869035 GGGGGTCTTAGCCGAGATGATGG - Intergenic
1176847600 21:13888574-13888596 GGGGGTCTTAACCAAGATGATGG - Intergenic
1177249717 21:18577109-18577131 AGAGGTCTTAGCCTTGATGAAGG + Intergenic
1179687307 21:43061618-43061640 GGGGGACTTGGCCATGCTGAGGG + Intronic
1180363824 22:11922329-11922351 GGAGGTCTTAGCCAAGACGATGG + Intergenic
1180742816 22:18065517-18065539 GAGGTTCTTAGCCAGCATGATGG + Intergenic
1180963181 22:19771782-19771804 GGGGGTCTCAGCCTAACTGAAGG + Intronic
1182005578 22:26956752-26956774 CGAGGTATTACCCAAGATGAAGG - Intergenic
1182302142 22:29342904-29342926 GGAGGTGTTGGCCAGGATGAGGG - Intronic
1182519015 22:30874871-30874893 CGGGGTCCCAGCCAAGAGGACGG - Intronic
1184292367 22:43504544-43504566 GGTGGTGATAGCAAAGATGATGG + Intronic
1184786067 22:46672565-46672587 GGGGGTCCTAGCAGAGCTGAGGG + Intronic
1185273174 22:49937863-49937885 GGGGGCCATAGCCTAGTTGACGG - Intergenic
950708775 3:14800618-14800640 GGGGGTCTGAGCCAAGCACAGGG - Intergenic
952955216 3:38552726-38552748 GGGGGTCTCAAGCAGGATGAGGG - Intronic
954031457 3:47822986-47823008 GGGGGGCTGAGCCAGGATAATGG + Intronic
961289615 3:125835277-125835299 GGTGGTCTTAGACAAGTTTATGG - Intergenic
962043656 3:131733401-131733423 GGGGGCTTTAGCCAAGTGGAAGG - Intronic
963430693 3:145197838-145197860 GGGGGTCTTAGGTAAGATCTAGG - Intergenic
963825513 3:149948921-149948943 GGGGGACTGAGGCAAGAGGATGG + Intronic
966707711 3:182934638-182934660 GGGGGACTAAGGCAAGAGGATGG + Intergenic
967636726 3:191809690-191809712 GGTGGTCTTGGTTAAGATGAAGG - Intergenic
968631990 4:1656575-1656597 GGGGCTCTGAGCCAGGATGGAGG + Intronic
969276508 4:6139438-6139460 GTGGGCCTTAACCAATATGATGG + Intronic
973368365 4:49225897-49225919 GGGGGTTTTAGCCAAGACGATGG - Intergenic
973392682 4:49569528-49569550 GGGGGTTTTAGCCAAGACGATGG + Intergenic
980658691 4:135826943-135826965 GGGGGTGGGAGCCAAGGTGAGGG + Intergenic
980705351 4:136485803-136485825 GGGGTTGTTAGATAAGATGATGG + Intergenic
984500137 4:180548056-180548078 TGGGCTTTTAGCCAAGATGTAGG - Intergenic
1202765473 4_GL000008v2_random:145408-145430 GGAGGTCTTAGCCAAGACGATGG - Intergenic
988544684 5:32144349-32144371 GGGAGGCTGAGCCAAGACGATGG + Intronic
990656226 5:57959185-57959207 AGTGGTTTTAGCCAAGATGTGGG - Intergenic
992752200 5:79871996-79872018 GTGGGTCTGAGCCAAGAGCATGG + Intergenic
993230161 5:85225743-85225765 GGGGGACTTAGGAAAGATAAGGG + Intergenic
996031155 5:118705174-118705196 GGTGGTTTTAGACATGATGATGG - Intergenic
1003721188 6:8704277-8704299 GGGGGTGGGAGCCAAGAGGAGGG - Intergenic
1006228536 6:32561799-32561821 GGGTATCTTAGCCAAGAACATGG + Intronic
1007714780 6:43849442-43849464 GGGTGTCTGAGCAGAGATGAGGG + Intergenic
1010357344 6:74949294-74949316 GGGAGTTTTATCCAAGCTGAAGG - Intergenic
1011634977 6:89363158-89363180 GGTGGTCTAAACCAAGATAATGG + Intergenic
1019762109 7:2820841-2820863 GGGAGTCTGAGGCAAGAGGATGG - Intronic
1021966834 7:25928328-25928350 GGGGGTATCAGGCAAGGTGAAGG - Intergenic
1022221958 7:28322534-28322556 GGGGGTTAAAGCCTAGATGATGG - Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024501670 7:50116218-50116240 GGGGGGCTGAGGCAGGATGATGG - Intronic
1028621865 7:92835194-92835216 GGGGGTCTGAGCCAGGTCGAGGG + Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1032901587 7:136315668-136315690 GGGGGTCATGGGCAAGAGGAGGG - Intergenic
1036368455 8:8141690-8141712 GGTCGTCTTAGACAAGTTGATGG - Intergenic
1036882432 8:12523952-12523974 GGTCGTCTTAGACAAGTTGATGG + Intergenic
1039489615 8:37937615-37937637 GTTAGTCTTACCCAAGATGAGGG - Intronic
1041554100 8:59133741-59133763 GGGGTTCTTGATCAAGATGATGG - Intergenic
1047219967 8:122911261-122911283 AGGGGGCTTTGCCAAGATGAGGG + Intronic
1049532324 8:143160570-143160592 GGGGATCTCAGCCAAGCAGAGGG - Exonic
1053663512 9:40301033-40301055 GGGGGTCTTATCCAAGACGATGG + Intronic
1054375635 9:64447267-64447289 GGGGGTCTTATCCAAGACGATGG + Intergenic
1054521102 9:66075252-66075274 GGGGGTCTTATCCAAGACGATGG - Intergenic
1054808116 9:69412420-69412442 GGGGGTCCCAGCCAATCTGATGG - Intergenic
1203546218 Un_KI270743v1:130298-130320 GGAGGTCTTAGCCAAGATGATGG - Intergenic
1185619972 X:1447980-1448002 GTGGTTCTTATCCAAGATGGCGG - Intronic
1185619980 X:1448034-1448056 GTGGTTCTTATCCAAGATGGCGG - Intronic
1190070215 X:47273340-47273362 GTGGCTCCTAGCCAAGATGTTGG - Intergenic
1194205710 X:91008884-91008906 GGGGGTGCTGTCCAAGATGAAGG + Intergenic
1196789578 X:119451889-119451911 TGGGTTCCTGGCCAAGATGATGG - Intronic
1197286608 X:124602570-124602592 GGGAGTCTTAGGCAGAATGAAGG + Intronic
1200551469 Y:4583695-4583717 GGGGGTAATGTCCAAGATGAAGG + Intergenic