ID: 1105263518

View in Genome Browser
Species Human (GRCh38)
Location 13:18797170-18797192
Sequence CAGTACAGAAGGAGAGTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 2, 1: 4, 2: 18, 3: 33, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105263518_1105263528 26 Left 1105263518 13:18797170-18797192 CCCTATACTCTCCTTCTGTACTG 0: 2
1: 4
2: 18
3: 33
4: 256
Right 1105263528 13:18797219-18797241 CTGCCTCTTGGAAAAGCTTCTGG 0: 12
1: 5
2: 5
3: 19
4: 239
1105263518_1105263526 14 Left 1105263518 13:18797170-18797192 CCCTATACTCTCCTTCTGTACTG 0: 2
1: 4
2: 18
3: 33
4: 256
Right 1105263526 13:18797207-18797229 TACCATGAGGCTCTGCCTCTTGG 0: 12
1: 41
2: 9
3: 27
4: 163
1105263518_1105263524 1 Left 1105263518 13:18797170-18797192 CCCTATACTCTCCTTCTGTACTG 0: 2
1: 4
2: 18
3: 33
4: 256
Right 1105263524 13:18797194-18797216 CCCAGAAGAGGTTTACCATGAGG 0: 1
1: 3
2: 16
3: 235
4: 1777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105263518 Original CRISPR CAGTACAGAAGGAGAGTATA GGG (reversed) Intergenic
906464157 1:46061168-46061190 AAGTACATGAGGAGAGTTTAGGG - Intronic
908969756 1:69813421-69813443 CAGAACAGAGGGAGAGTCAATGG - Intronic
909612248 1:77563819-77563841 CATAACAGAAGGAAAGTAAATGG - Intronic
911473604 1:98348957-98348979 CAGTAAATAAGGAGAGCATTAGG - Intergenic
911686249 1:100780622-100780644 CAGTACAGAAGGGAAATGTAGGG - Intergenic
912634029 1:111274448-111274470 CAATTCTGAAGGAGAGTTTAGGG + Intergenic
917514645 1:175697570-175697592 CAGTAAAGAAGGAAAGGATGGGG - Intronic
917784920 1:178444660-178444682 CAATCCAGAAGGATAGCATAAGG - Intronic
918580743 1:186125620-186125642 AAGTACAGAAGGACACTACACGG + Exonic
918752445 1:188289842-188289864 CAGTACAGAAGGGGAATGTGGGG - Intergenic
919909928 1:202104752-202104774 CATCACAGAAGAAGAGTGTAGGG - Intergenic
922988939 1:229888553-229888575 CTGGACTGAAGGAGAGTTTATGG + Intergenic
923121893 1:230999606-230999628 CAGGACCTAAGGAGAGCATAAGG - Intronic
923285733 1:232493123-232493145 CAGGACAGAGAGAGAGTAAAGGG - Intronic
1063295720 10:4803739-4803761 CAGAAAGGAATGAGAGTATATGG + Intronic
1063857747 10:10273571-10273593 AGGTAAAGAAGGAGAGTCTAGGG + Intergenic
1065027829 10:21555577-21555599 CAGTACAAAAGAAGAGTTCAAGG - Intronic
1066399782 10:35064958-35064980 CAGTGCAGAAGTACTGTATATGG - Intronic
1069106126 10:64385178-64385200 CAGTACAGAGGGAGAATGTGGGG - Intergenic
1072145966 10:92637569-92637591 GAGTACAGAAAGAGAGTTTTAGG + Intronic
1075476679 10:122741397-122741419 CTGTAGAGCAGGAGAGAATAGGG + Intergenic
1075988510 10:126810680-126810702 CACTACAGAAGGATAGGATGAGG + Intergenic
1076667979 10:132103557-132103579 CAGCACAGAAGGAAAGTGTGAGG + Intergenic
1077792104 11:5452162-5452184 CAGTGCAGACTGAGAGTATGAGG + Intronic
1079559406 11:21803764-21803786 CAGTACAGAAGGAAAATGTGAGG - Intergenic
1080129786 11:28780750-28780772 CAGTGCAGAAGGAAAATGTAGGG - Intergenic
1081736089 11:45405368-45405390 CAGTACTGAGGGAAAGTCTAGGG - Intergenic
1082139313 11:48589483-48589505 CTGTACAGAAGAAGAGTTAAAGG - Intergenic
1082142576 11:48627269-48627291 CTGTACAGAAGAAGAGTTAAAGG - Intergenic
1082254582 11:50019464-50019486 CAGCACAGAAGGACAGTGGAAGG + Intergenic
1082569780 11:54724637-54724659 CTGTACAGAAGAAGAGTTAAAGG - Intergenic
1082613007 11:55325489-55325511 CTGTACAGAAGAAGAGTTAAAGG - Intergenic
1084121939 11:67074522-67074544 CAGTACAGTTGGAGAATATTTGG + Intergenic
1085194307 11:74658992-74659014 CAGTACAGAAGGGAAGTGTGAGG - Intronic
1086852884 11:91831819-91831841 CAGCACAGAAGCAAAGTAGAGGG - Intergenic
1087341825 11:96916227-96916249 CAGTTCAGAAGGAAAATATGGGG + Intergenic
1087678837 11:101195023-101195045 CAGAAAAGAAGTAAAGTATAAGG + Intergenic
1088590395 11:111397991-111398013 CAGGGCAGAAGCAGAGGATAAGG - Intronic
1088966138 11:114723327-114723349 AAGTAAAGAAGGAGAGAAGAAGG + Intergenic
1091811835 12:3405952-3405974 CAGTACAGAAGGAAAATAGGGGG - Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1095847213 12:46759090-46759112 CAGTCCAGAAGGAGAATGTTGGG + Intergenic
1096510206 12:52123653-52123675 GAGGAGAGAAGGAGAGTCTAAGG - Intergenic
1096571421 12:52525509-52525531 CAGTACAGAAGGTGGTAATATGG + Intergenic
1096953516 12:55501408-55501430 CAGTAGAGCAGGAGGATATATGG - Intergenic
1097133904 12:56835695-56835717 CAGGATAGAAGGAAAGTAAAAGG - Intergenic
1097326040 12:58277730-58277752 CAGTACAGAAGGAAAATGTGGGG + Intergenic
1097464671 12:59907779-59907801 CATAACAGAAGGAGAGTAGTAGG - Intergenic
1098822360 12:75248946-75248968 CAAAAGAGAAGGAAAGTATAAGG + Intergenic
1100427673 12:94502169-94502191 CAGTACAGAAGGAAAATGTGGGG - Intergenic
1102684685 12:114715486-114715508 CAGTATAGAAAAAGAGAATAAGG + Intergenic
1102755787 12:115339097-115339119 CAGTTGAGAATGAGAGTGTAAGG + Intergenic
1103160557 12:118725771-118725793 CAGCACAGAAGAAGAATAAAGGG + Intergenic
1105256735 13:18748317-18748339 CAGTACAGAAGGAACATATAGGG - Intergenic
1105257167 13:18751436-18751458 CAGTGCAGAAGGAAAGTATGGGG - Intergenic
1105257663 13:18754977-18754999 CAGTACAGAAGGATAATATAGGG - Intergenic
1105258952 13:18764514-18764536 CAGTGCAGAAGGAAAATATGGGG - Intergenic
1105259405 13:18767678-18767700 CAGTACAGAAGGAACATATGGGG - Intergenic
1105260313 13:18774285-18774307 CAGTACAGAAGGATAATATAGGG - Intergenic
1105260724 13:18777363-18777385 CAGTACAGAAGGAACATATGGGG - Intergenic
1105261193 13:18780576-18780598 CAGTACACAAGGAGAGTATAGGG - Intergenic
1105263023 13:18793770-18793792 CAGTACAGAAGGAACATATAGGG - Intergenic
1105263518 13:18797170-18797192 CAGTACAGAAGGAGAGTATAGGG - Intergenic
1108950635 13:56087993-56088015 CAGTACAGAGGGAAAATATGAGG + Intergenic
1109056061 13:57550733-57550755 AAGTACAGAAGAAGAGAAGAGGG + Intergenic
1109069216 13:57741995-57742017 CAGTAGAGAAGGAAACTAAACGG - Intergenic
1109718377 13:66246238-66246260 CAGTACAGAAGGGAAATATGGGG + Intergenic
1109876066 13:68405764-68405786 CAGTACAGAAGGGGAATATGGGG - Intergenic
1110541896 13:76715307-76715329 GAGTACAGAATGAGAGGAGAGGG + Intergenic
1110740070 13:78984457-78984479 CAGCAAGGAAGGAGAGTAGAGGG - Intergenic
1111441381 13:88286026-88286048 CAGTGCAGAAGGAAAATATGGGG - Intergenic
1113499260 13:110760383-110760405 CAGTACAGGAGGACAGAATTGGG + Intergenic
1114450824 14:22824121-22824143 CAGAACAGAAGGAGGCTATTTGG + Intronic
1115134818 14:30095788-30095810 CAGTACAGAAGGGAAATGTAGGG + Intronic
1116602129 14:46939117-46939139 TAGTTGAGAAGGAGAGAATAGGG + Intronic
1117261159 14:54034959-54034981 CAGAAGAGAGAGAGAGTATAGGG - Intergenic
1117940756 14:60961405-60961427 CAGTACATATTGAGAATATAGGG - Intronic
1120481409 14:85054039-85054061 CAGTGCAGAAGGAAAATATGGGG - Intergenic
1202834918 14_GL000009v2_random:70870-70892 CAGTACAAAAGGAAAGTATAGGG + Intergenic
1202835329 14_GL000009v2_random:73952-73974 CAGTACCGAAGGAGAATTTAGGG + Intergenic
1124504417 15:30261062-30261084 CAGTACTGAAGGAAAGCATTAGG - Intergenic
1124656707 15:31515082-31515104 CAGCACAGGGGGAGAGAATATGG + Intronic
1124739134 15:32277573-32277595 CAGTACTGAAGGAAAGCATTAGG + Intergenic
1126059318 15:44764325-44764347 CTGTATAGAGGGAGAGTATATGG - Intronic
1129444579 15:75607997-75608019 CTGAACAGAAGGTGGGTATAAGG + Intronic
1130823189 15:87516726-87516748 CAGAACACAAGGAGAGTTTTGGG - Intergenic
1130920324 15:88338433-88338455 CAGGAGAGAAGCAGAGGATAGGG + Intergenic
1131802442 15:96085031-96085053 AAGGATAGAGGGAGAGTATAGGG + Intergenic
1132158682 15:99515998-99516020 CAGGAAAGAAGAAGAGTATCAGG - Intergenic
1133604317 16:7371130-7371152 AAGGGCAGAAGGAGAGTAAAAGG - Intronic
1134815261 16:17200401-17200423 CAATGCAGAAGGAGGGTATCAGG + Intronic
1138616081 16:58168421-58168443 TAGTACACAAGGAAAGTAGACGG - Intronic
1138903418 16:61301966-61301988 AATTTCATAAGGAGAGTATATGG + Intergenic
1147181945 17:38692033-38692055 AAGGACAAAAGGAAAGTATAAGG + Intergenic
1148725250 17:49784614-49784636 CAGTAAACAAGGACAATATAAGG - Intronic
1150322885 17:64231189-64231211 CAGTACAGAAGGTGACTGTGAGG + Intronic
1154424398 18:14260985-14261007 CAGTGCAGAAGGAAAATATGGGG + Intergenic
1154425289 18:14267429-14267451 CAGTACAGAAGGAACATATAGGG + Intergenic
1154425705 18:14270510-14270532 CAGTACAGAAGGACAATATAGGG + Intergenic
1154426603 18:14277118-14277140 CAGTACAGAAGGAACATATAGGG + Intergenic
1154428021 18:14287015-14287037 CAGTACAGAAGGAACATATAGGG + Intergenic
1154428442 18:14290096-14290118 CAGTACAGAAGGAGAATACAAGG + Intergenic
1154429345 18:14296710-14296732 CAGTACAGAAGGAACATATAGGG + Intergenic
1154430244 18:14303104-14303126 CAGTACAGAAGGAGAGTATAGGG + Intergenic
1154430732 18:14306525-14306547 CAGTACAGAAGAAACATATAGGG + Intergenic
1154432088 18:14316214-14316236 CAGTGCAGAAGGAAAATATGGGG + Intergenic
1154432518 18:14319454-14319476 CAGTACACAAGCAGAGTATAGGG + Intergenic
1154432985 18:14322668-14322690 CAGTACAGAAGGAACATATAGGG + Intergenic
1154433394 18:14325751-14325773 CAGTACAGAAGGACAATATAGGG + Intergenic
1154434307 18:14332361-14332383 CAGTACAGAAGGAACATATAGGG + Intergenic
1155725861 18:29082342-29082364 AAACACAGAAGGAGAGAATAGGG + Intergenic
1157001417 18:43530126-43530148 CAGAGCAGAAGTACAGTATAAGG + Intergenic
1157421623 18:47552231-47552253 CAGGAAAGAAGGAGAGCAAAAGG - Intergenic
1159332952 18:67024970-67024992 CATTACAGAAGAAGAGCACAAGG + Intergenic
1159375589 18:67588402-67588424 CAGCACAGAAGAAGACCATAAGG - Intergenic
1162809216 19:13154146-13154168 CAGTCCAGAAGGAGAGCGAAAGG - Exonic
1165273531 19:34730860-34730882 CAGAAAAGAAGGAAAGAATAGGG + Intergenic
1166886776 19:45966233-45966255 CAGTACAGAAGGACATAAAAGGG - Intronic
1167968982 19:53174203-53174225 AAGCACAGAAGGAGAGACTAAGG + Intronic
1202637294 1_KI270706v1_random:53397-53419 CAGTACAGAAGGAGAATTTAGGG - Intergenic
1202637785 1_KI270706v1_random:56822-56844 CAGTACAAAAGGAAAATATAGGG - Intergenic
1202638218 1_KI270706v1_random:60076-60098 CAGTGCAGAAGGAAAATATGGGG - Intergenic
925516901 2:4692801-4692823 CAGTACAGAAGGAGGGTGGATGG - Intergenic
925560224 2:5183543-5183565 CAGTGCAGAAGGGAAGTGTAGGG + Intergenic
927383369 2:22504649-22504671 TAGTACAGAAGGAGAGAAAGAGG + Intergenic
931827158 2:66013170-66013192 TGGTACAGAAAGAGAATATATGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
934492809 2:94773274-94773296 CAGTACAGAAGGAATATATAGGG - Intergenic
934493203 2:94776314-94776336 CAGTACAGAAGAAGAGTATAGGG - Intergenic
937311246 2:120904710-120904732 CAGTACAGAAGCAGACTCTCTGG - Intronic
937936511 2:127249609-127249631 CAGTACATCAGGAGAATAAAGGG + Intergenic
938279777 2:130055726-130055748 CAGTACAGAAGGAAAATATGGGG - Intergenic
938330729 2:130446440-130446462 CAGTGCAGAAGGAAAATATGGGG - Intergenic
938359215 2:130675063-130675085 CAGTGCAGAAGGAAAATATGGGG + Intergenic
938435619 2:131281712-131281734 CAGTACAGAAGGAAAATATGGGG + Intronic
939023535 2:136985644-136985666 CAGTACAGAAGGAAAGTGTGAGG + Intronic
939742843 2:145931320-145931342 CTGTGCAGTAGGAGAGTAAAAGG - Intergenic
939749388 2:146022877-146022899 CTTTACAGAAGGATAATATATGG - Intergenic
940146365 2:150548848-150548870 AAGCACAAAAGGAGAGTTTATGG + Intergenic
941057623 2:160806738-160806760 CAGTACAGAAGGAAAATGTGGGG - Intergenic
941057776 2:160807918-160807940 CAGTACAGAAGGAAAATGTGGGG + Intergenic
942210132 2:173661729-173661751 CAGTTCAGGAGGAGAGTCTGGGG + Intergenic
942468704 2:176236926-176236948 CAGTACAGAAGATGAGGAAAAGG - Intergenic
943219851 2:185090683-185090705 CAGTGCAGAAGGAAAATATGGGG + Intergenic
943238054 2:185347855-185347877 CAGTGCAGAAGGCGAATGTAGGG + Intergenic
943372126 2:187028446-187028468 CAGTACAGAAGGAAAATGTGGGG + Intergenic
945484784 2:210382227-210382249 CAGTACAGAAGGGAAATGTAGGG + Intergenic
945677074 2:212868518-212868540 CAGAACAGAAGGAGCATTTATGG + Intergenic
948509415 2:238453532-238453554 CAGTACACATGCAGAGTATTAGG + Intergenic
1170418143 20:16166381-16166403 CAGCACAGATGGAGAAGATAGGG - Intergenic
1171883462 20:30634421-30634443 CAGTACAGAAGAAGAATATAGGG - Intergenic
1171883876 20:30637502-30637524 CAGTACAGAAGGAACATATAGGG - Intergenic
1171884359 20:30640914-30640936 CAGTACACAAGGAAAGTATAGGG - Intergenic
1171884802 20:30644140-30644162 CAGTGCAGAAGGAAAATATGGGG - Intergenic
1172672093 20:36641648-36641670 CAGGACTGAAGGAGAGGAGAGGG - Intronic
1173242793 20:41312719-41312741 CTGTACAGAAGAGGAGAATACGG + Intronic
1173687663 20:44935202-44935224 CACTACAGAAAAACAGTATAGGG - Intronic
1176842725 21:13853357-13853379 CAGTACAGAAGGAACATATAGGG - Intergenic
1176843654 21:13860006-13860028 CAGTACAGAAGGATAATATAGGG - Intergenic
1176844064 21:13863088-13863110 CAGTACAGAAGGAAAATATAGGG - Intergenic
1176844522 21:13866294-13866316 CAGTACACAAGGAGAGTATAGGG - Intergenic
1176844950 21:13869540-13869562 CAGTGCAGAAGGAAAATATGGGG - Intergenic
1176845415 21:13872704-13872726 CAGTACAGAAGGAACATATAGGG - Intergenic
1176846742 21:13882412-13882434 CAGTACAGAAGGAACATATAGGG - Intergenic
1176847250 21:13885857-13885879 CAGTACACAAGGAGAGTATAGGG - Intergenic
1176848147 21:13892261-13892283 CAGTACAGAAGGAACATATAGGG - Intergenic
1177155127 21:17493773-17493795 TAATACAGAAGGTGAGTACAGGG - Intergenic
1178681980 21:34680046-34680068 CAGTACAGAAGGGAAATGTAGGG - Intronic
1180119160 21:45735026-45735048 AAGAACACAGGGAGAGTATACGG - Intronic
1180363749 22:11921803-11921825 CAGTGCAGAAGGAAAATATGGGG + Intergenic
1181435456 22:22907835-22907857 CAGGTCAGAAAGAGAGCATAGGG + Intergenic
1183695788 22:39421411-39421433 CTGTACACATGGAGAGTATCTGG + Intronic
1183703388 22:39462530-39462552 CACTACAGAGGGAGGGTACAGGG + Intronic
951358921 3:21702104-21702126 CAGTACAGAAGGGAAATATGGGG - Intronic
951500062 3:23375840-23375862 CAGTACAGAAGGAAAGATTCTGG - Intronic
952749675 3:36815253-36815275 CAATACAGCAGGAGAGCATCAGG + Intergenic
953107798 3:39902314-39902336 CAGAACAATAGGAGAGTAGATGG + Intronic
954181668 3:48886139-48886161 CAGGGCAGAAGGAGGGGATAGGG + Intronic
955943458 3:64168674-64168696 GAGAACAGAAGGAGAGGATGGGG - Intronic
956198302 3:66676397-66676419 CCGTAGATAAGGAGAGGATAGGG - Intergenic
958469809 3:94502951-94502973 CAGTGCAGAAGGAAAATATGAGG - Intergenic
960473228 3:118093428-118093450 CAGTGCAGAAGGGAAATATAGGG + Intergenic
961152721 3:124653098-124653120 AAGTACAGCAGGAGAGAATAAGG - Intronic
961326189 3:126110786-126110808 CAGGACAGGAGCAGAGAATAAGG - Intronic
962295242 3:134177703-134177725 AAGTACACAACGAGAATATAAGG + Intronic
963376034 3:144466242-144466264 CAATACAGAAGGAGCAGATAAGG + Intergenic
963683502 3:148410185-148410207 CAGTACAGAAGGAAAATGTGAGG - Intergenic
964332480 3:155619267-155619289 CAGTACAGGAGTAGTGTACAGGG + Intronic
964332483 3:155619297-155619319 CAGTACAGGAGTAGTGTACAGGG + Intronic
965325735 3:167301408-167301430 CAATTCAGTAGGAGAGGATAAGG - Intronic
965990435 3:174811166-174811188 CAGTACAGAAGGGAAATATGGGG + Intronic
967808749 3:193737411-193737433 CAGTCCAGGAGGAGAGAATGAGG - Intergenic
969051796 4:4378524-4378546 CAGGACCGGAGGAGAGTATTCGG + Intronic
973367112 4:49216693-49216715 CAGTACAGAAGGAGAATTTAGGG - Intergenic
973367539 4:49219773-49219795 CAGTAGAGAAGGAACATATAGGG - Intergenic
973368017 4:49223187-49223209 TAGTACACAAGGAAAGTATAGGG - Intergenic
973368451 4:49226423-49226445 CAGTGCAGAAGGAAAATATGGGG - Intergenic
973392598 4:49569002-49569024 CAGTGCAGAAGGAAAATATGGGG + Intergenic
973393032 4:49572239-49572261 TAGTACACAAGGAAAGTATAGGG + Intergenic
973393508 4:49575668-49575690 CAGTACAGAAGGAGAATTTAGGG + Intergenic
974269592 4:59633334-59633356 CAGTGCAGAAGGAAAATATGGGG - Intergenic
974733269 4:65897326-65897348 CAGTACAGAGGGAAAATATGAGG - Intergenic
977703804 4:100049763-100049785 CATTACTGAAGGAGAATATGGGG + Intergenic
978229213 4:106377977-106377999 CATTACAGAAGGTTATTATAGGG - Intergenic
979464627 4:121022184-121022206 CAGTACAGAAGGGAAATATGGGG - Intergenic
979884568 4:126010437-126010459 CATTACAGAAGAAGAAGATAAGG + Intergenic
980426186 4:132630589-132630611 CAGTGCAGAAGGGAAGTATGGGG + Intergenic
980461776 4:133124876-133124898 CAGTACAGAATGAGATTGTCTGG + Intergenic
980874405 4:138646396-138646418 CAGCCCTCAAGGAGAGTATATGG + Intergenic
982142610 4:152341282-152341304 CAGCACAGAAAGAGTGTGTATGG - Intronic
982646727 4:158033297-158033319 CAGTAGAGAAGGGAGGTATAAGG - Intergenic
983083405 4:163414824-163414846 CAGTGCAGAAGGGAAATATAGGG + Intergenic
983383214 4:167023631-167023653 AAGTACAGAAGCAGAGAAAAAGG - Intronic
984549216 4:181140857-181140879 CAGTCCAGAAAAAGAGTAAAGGG + Intergenic
1202764613 4_GL000008v2_random:139254-139276 CAGTACAGAAGGAGAATTTAGGG - Intergenic
1202765106 4_GL000008v2_random:142679-142701 CAGTAGAAAAGGAAAGTATAGGG - Intergenic
987028904 5:13957208-13957230 CACTACAGAAGGAGAGACTCTGG + Intergenic
987429111 5:17810098-17810120 CGGTACAGAATGGGAGTTTAAGG - Intergenic
988274974 5:29069172-29069194 CAGTGCAGAAGGAAAATGTAGGG - Intergenic
991309587 5:65222071-65222093 TTATACAGAAAGAGAGTATATGG - Intronic
993216250 5:85026525-85026547 AAGGAAAGAAGGAGAGGATATGG - Intergenic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
997026539 5:130069348-130069370 CAAGATAGAAGAAGAGTATATGG + Intronic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
997885813 5:137629055-137629077 CAGTACAGGAGGAGAGAAGTGGG - Intronic
999073523 5:148773002-148773024 CAGTGCAGAGGAAGAGTATGGGG + Intergenic
1000203876 5:159038499-159038521 CCATACAGGAGGAGAGTATGGGG + Intronic
1000929323 5:167232160-167232182 CAGTGCAGAAGGGAAATATAGGG + Intergenic
1001858395 5:175032419-175032441 AAGAAAAGAATGAGAGTATAAGG - Intergenic
1004767474 6:18746583-18746605 CAGTACAGACAGAGAGTGAAAGG - Intergenic
1005450192 6:25964552-25964574 CAGTACAAAATGAGATAATAGGG + Intronic
1006147711 6:31969254-31969276 CAGGAAAGAAGGAGAGGTTAAGG - Intronic
1009370311 6:62892702-62892724 CAGAACAGAAGGCTAGAATAAGG - Intergenic
1010618133 6:78039955-78039977 GACTACAAAAGGAGAGTATAGGG - Intergenic
1010710531 6:79169358-79169380 CAGTAAACAATAAGAGTATAGGG - Intergenic
1011218863 6:85033435-85033457 CAGTGCAGAAGGGAAATATAGGG - Intergenic
1012071978 6:94633167-94633189 AAGTACTGAAGGACATTATAGGG - Intergenic
1013142617 6:107353449-107353471 AATTACAGAAGGAGAGTAATTGG - Intronic
1015777774 6:136832034-136832056 CAGTACAGAAGGAAAATGTGGGG - Intronic
1016121153 6:140342605-140342627 CAGTACAGAATGAAACCATAGGG - Intergenic
1016666541 6:146648536-146648558 CAGGAGAGAGGGAGAGTAAAGGG + Intronic
1017560613 6:155624557-155624579 CAGTTCAGAAGGAGATTTTAAGG - Intergenic
1017639995 6:156483790-156483812 CAGTACAGAAGCAAGTTATATGG + Intergenic
1018442112 6:163822877-163822899 GAGTGCAGAGGGACAGTATAGGG + Intergenic
1020989685 7:15181399-15181421 CAGTGAAGAATGAGAGTAGAAGG - Intergenic
1021627379 7:22607645-22607667 CAGCACAGTTCGAGAGTATAAGG - Intronic
1023863292 7:44227643-44227665 GAGGACAGAGGGAGAGTGTAGGG + Intronic
1028184821 7:87769946-87769968 TAGAACAGAAGCAGAGCATAAGG - Intronic
1029817806 7:103114464-103114486 CAGTTCAGCAGGAGAGTGGAGGG - Intronic
1029914916 7:104199132-104199154 CAGTACAGAAGGGGAATGTGGGG + Intronic
1030200170 7:106895223-106895245 CAGTTGAGAAGGAGAGAATGAGG + Intronic
1030409743 7:109161107-109161129 CAGTACAGGAAGAAAGTCTATGG - Intergenic
1030459075 7:109808199-109808221 CAATGCAGAAGGAAAATATATGG + Intergenic
1030492391 7:110254260-110254282 CAGTACAGAAATAAAGTATGGGG - Intergenic
1031254942 7:119435444-119435466 AAGTGCAGAAGGAAAATATAGGG - Intergenic
1033868420 7:145720204-145720226 CAGTAGAGACAGAGAGAATAGGG + Intergenic
1034205459 7:149310770-149310792 CAGGAAAGAAAGAGAGTAAAGGG - Intergenic
1039148960 8:34481355-34481377 CAGTACAAAAGAAAAATATAGGG - Intergenic
1040102497 8:43518141-43518163 CAGTGCAGAAGGAAAATATGGGG + Intergenic
1041355625 8:56996555-56996577 CTGTACACATGGAGACTATAAGG - Intergenic
1042372570 8:68008433-68008455 CATGAGAGAAGGAGAGAATATGG + Intronic
1044067081 8:87712052-87712074 CAGAACAGGAGGAGAGAAAACGG - Intergenic
1044219440 8:89651559-89651581 CATTCCAGAAGGAGAGAAAAAGG + Intergenic
1045458982 8:102411415-102411437 CATTTCAGGAGGAGAGTAAAGGG + Intronic
1045740511 8:105353227-105353249 CAGTGCAGTATGAGAGTATGGGG - Intronic
1046037374 8:108860219-108860241 CAGTACAGAAACAGAACATAGGG + Intergenic
1047169733 8:122480322-122480344 CAGAACACAAGGAGAGTTTTGGG - Intergenic
1047536564 8:125725433-125725455 CAGAACAAAAGGGGAGGATAAGG + Intergenic
1048212445 8:132466600-132466622 CAGGAAAGAAGTAGATTATAAGG - Intronic
1048676067 8:136781986-136782008 CAACCCAGAAGGAGAATATAAGG + Intergenic
1048806561 8:138246648-138246670 CAGTGCAGAAGGGAAATATAGGG + Intronic
1048867640 8:138772414-138772436 CAGCACAGAAGGAGAGGCTCTGG + Intronic
1049245420 8:141559839-141559861 CAGGGCAGAAGGAGAGGATGCGG - Intergenic
1050565303 9:6875991-6876013 CAGTAGAGAAAGAGAACATAGGG + Intronic
1052878235 9:33583542-33583564 CAGTGCAGAAGGAAAATATGGGG + Intergenic
1053480873 9:38415376-38415398 CAATACAAAAGGAGAGCAAAGGG + Intronic
1053495986 9:38548320-38548342 CAGTGCAGAAGGAAAATATGGGG - Intronic
1053497748 9:38560665-38560687 CAGTGCAGAAGGAAAATATGGGG - Intronic
1053663430 9:40300506-40300528 CAGTGCAGAAGGAAAATATGAGG + Intronic
1053664899 9:40310609-40310631 CAGTGCAGAAGGAAAATATGAGG + Intronic
1053665347 9:40313715-40313737 CAGTACAGAAGGAGAAAATGGGG + Intronic
1053665774 9:40316633-40316655 CAGTGCAGAAGGAAAATATGGGG + Intronic
1053913939 9:42931047-42931069 CAGTGCAGAAGGAAAATATGAGG + Intergenic
1053914933 9:42938762-42938784 CAGTACAGAAGGAGAATATGGGG + Intergenic
1053915358 9:42941680-42941702 CAGTGCAGAAGGAAAATATGGGG + Intergenic
1054375553 9:64446740-64446762 CAGTGCAGAAGGAAAATATGAGG + Intergenic
1054376498 9:64453745-64453767 CAGTACAGAAGGAGAAAATGGGG + Intergenic
1054376930 9:64456663-64456685 CAGTGCAGAAGGAAAATATGGGG + Intergenic
1054518838 9:66059651-66059673 CAGTGCAGAAGGAAAATATGGGG - Intergenic
1054519268 9:66062569-66062591 CAGTACAGAAGGAGAAAATGGGG - Intergenic
1054519715 9:66065675-66065697 CAGTGCAGAAGGAAAATATGAGG - Intergenic
1054521184 9:66075779-66075801 CAGTGCAGAAGGAAAATATGAGG - Intergenic
1054713447 9:68534277-68534299 CACTCCAGAAGGTGAGGATAAGG - Intergenic
1054978766 9:71179428-71179450 CAGACCAGAATGAGAGAATAAGG - Intronic
1056586093 9:87928131-87928153 CAGTGCAGAAGGAAAATATGGGG - Intergenic
1056592141 9:87972373-87972395 CAGCACAGAAGGAGGCTAGAGGG + Intronic
1057676781 9:97142054-97142076 CAGTACACAAGGAACATATAGGG - Intergenic
1057677211 9:97145150-97145172 CAGTGCAGAAGGAAAATATGGGG - Intergenic
1058871403 9:109204859-109204881 CAGTGCATAGTGAGAGTATAAGG - Intronic
1060402113 9:123355268-123355290 GAGTGCAGCAGGAGACTATAAGG + Intergenic
1060903889 9:127287433-127287455 CAGTACAGAAGCTGATTATCAGG - Intronic
1203545362 Un_KI270743v1:124141-124163 CAGTACAGAAGGAGAATTTAGGG - Intergenic
1203545854 Un_KI270743v1:127568-127590 CAGTACAAAAGGAAAGTATAGGG - Intergenic
1185537512 X:874008-874030 CAGCAAAGAAGTAAAGTATAGGG - Intergenic
1185647979 X:1628606-1628628 CAGGACAGAAGGAGAAGAGAGGG - Intronic
1188169645 X:26909116-26909138 AAATACAGAAGGAGATGATAGGG + Intergenic
1188629750 X:32339868-32339890 AATTAGAGAAGGAGAATATAGGG + Intronic
1191089818 X:56608161-56608183 CAGTACAGAAGGGAAGTGTGGGG - Intergenic
1191702256 X:64055245-64055267 CAGGAGAAAAGGAGAGTTTATGG + Intergenic
1197579304 X:128262248-128262270 CAGTACTGGAGTAGAGAATAGGG + Intergenic
1198200807 X:134416734-134416756 AAGTACAGAGGGAGACTAAAGGG - Intronic
1198693320 X:139307776-139307798 CAGTACAGAAAGAAAATATGAGG + Intergenic
1201938475 Y:19433185-19433207 CAGTGCAAAAGGAGAGAATTAGG + Intergenic