ID: 1105265228

View in Genome Browser
Species Human (GRCh38)
Location 13:18809212-18809234
Sequence CACCCAGGACAACCCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 6, 1: 7, 2: 5, 3: 15, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105265228_1105265236 9 Left 1105265228 13:18809212-18809234 CCCTGATGGGGTTGTCCTGGGTG 0: 6
1: 7
2: 5
3: 15
4: 183
Right 1105265236 13:18809244-18809266 GTGATGAGAAAAATGCAGAATGG 0: 4
1: 0
2: 5
3: 45
4: 497
1105265228_1105265237 22 Left 1105265228 13:18809212-18809234 CCCTGATGGGGTTGTCCTGGGTG 0: 6
1: 7
2: 5
3: 15
4: 183
Right 1105265237 13:18809257-18809279 TGCAGAATGGAATTGCTGCGAGG 0: 16
1: 7
2: 5
3: 10
4: 121
1105265228_1105265238 26 Left 1105265228 13:18809212-18809234 CCCTGATGGGGTTGTCCTGGGTG 0: 6
1: 7
2: 5
3: 15
4: 183
Right 1105265238 13:18809261-18809283 GAATGGAATTGCTGCGAGGATGG 0: 1
1: 0
2: 0
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105265228 Original CRISPR CACCCAGGACAACCCCATCA GGG (reversed) Intergenic
900358624 1:2276902-2276924 CACCCAAAACAAACGCATCAGGG - Intronic
900361548 1:2291519-2291541 GTCCCAGGAGAACCCCAGCAAGG + Intronic
900578566 1:3396205-3396227 CCCCCAGGACACCCCCAGCTGGG + Intronic
901843923 1:11970663-11970685 CCTCCAGGACAACCGCATCCAGG + Exonic
903846152 1:26280836-26280858 CTCCCAGGACAACGCCCTGAGGG + Exonic
904495203 1:30882554-30882576 CTCCCAGGAGCACCCCATCAGGG + Intronic
904696902 1:32336030-32336052 CCCCCAGCAGACCCCCATCATGG - Exonic
905256952 1:36690988-36691010 GGCCCAGGACAGCACCATCAGGG - Intergenic
906215166 1:44034297-44034319 CCCCCAGCACCACTCCATCAAGG - Intergenic
914515207 1:148368443-148368465 CACCCTGGAAAGCCCCTTCATGG - Intergenic
921417981 1:214912566-214912588 GCCCTAGGACAAACCCATCATGG - Intergenic
922577004 1:226667518-226667540 CAACCAGGGCCAGCCCATCAGGG + Intronic
922925352 1:229342838-229342860 ACCCCAGGACCACCCGATCACGG - Intronic
924932877 1:248746603-248746625 CACCCAGGGCATCCCCCGCACGG + Intronic
924932949 1:248746823-248746845 CACCCAGGGCATCCCCCGCACGG + Intronic
924933011 1:248747015-248747037 CACCCAGGGCATCCCCCGCACGG + Intronic
924933023 1:248747046-248747068 CACCCAGGGCATCCCCCGCACGG + Intronic
924933064 1:248747170-248747192 CACCCAGGGCATCCCCCGCACGG + Intronic
924933076 1:248747201-248747223 CACCCAGGGCATCCCCCGCACGG + Intronic
924933098 1:248747263-248747285 CACCCAGGGCATCCCCCGCACGG + Intronic
924933110 1:248747294-248747316 CACCCAGGGCATCCCCCGCACGG + Intronic
924933132 1:248747356-248747378 CACCCAGGGCATCCCCCGCACGG + Intronic
924933174 1:248747480-248747502 CACCCAGGGCATCCCCCGCACGG + Intronic
924933196 1:248747542-248747564 CACCCAGGGCATCCCCCGCACGG + Intronic
924933218 1:248747604-248747626 CACCCAGGGCATCCCCCGCACGG + Intronic
924933240 1:248747666-248747688 CACCCAGGGCATCCCCCGCACGG + Intronic
924933252 1:248747697-248747719 CACCCAGGGCATCCCCCGCACGG + Intronic
924933294 1:248747821-248747843 CACCCAGGGCATCCCCCGCACGG + Intronic
924933306 1:248747852-248747874 CACCCAGGGCATCCCCCGCACGG + Intronic
924933318 1:248747883-248747905 CACCCAGGGCATCCCCCGCACGG + Intronic
924933330 1:248747914-248747936 CACCCAGGGCATCCCCCGCACGG + Intronic
924933342 1:248747945-248747967 CACCCAGGGCATCCCCCGCACGG + Intronic
924933354 1:248747976-248747998 CACCCAGGGCATCCCCCGCACGG + Intronic
924933366 1:248748007-248748029 CACCCAGGGCATCCCCCGCACGG + Intronic
924933388 1:248748069-248748091 CACCCAGGGCATCCCCCGCACGG + Intronic
924933400 1:248748100-248748122 CACCCAGGGCATCCCCCGCACGG + Intronic
924933432 1:248748193-248748215 CACCCAGGGCATCCCCCGCACGG + Intronic
924933444 1:248748224-248748246 CACCCAGGGCATCCCCCGCACGG + Intronic
1063163754 10:3441350-3441372 CTCCCAGCTCAGCCCCATCATGG + Intergenic
1071238535 10:83678012-83678034 CACACAGGACTTCCCCAGCAGGG - Intergenic
1071295141 10:84214120-84214142 GACCAAGGACAACCCCATGAAGG + Exonic
1073804896 10:107087147-107087169 CACCAAAGACAACCCCAAGACGG - Intronic
1075264605 10:120989847-120989869 CACCCCTGACCACCCCATTATGG + Intergenic
1075991177 10:126840137-126840159 CACTCAGGAAAACCCCAGCCAGG + Intergenic
1076685779 10:132197883-132197905 GACCCAGGACAACCTCCTGACGG - Intronic
1077786533 11:5390195-5390217 CACCAGGGACAGCCCCATCATGG - Exonic
1081762944 11:45589937-45589959 TACCCAGGCCAATCCCATCAGGG - Intergenic
1082235989 11:49820822-49820844 ACCCCAGGACACCCCCCTCAAGG - Intergenic
1082239449 11:49855378-49855400 ACCCCAGGACATCCCCCTCATGG - Intergenic
1082242700 11:49888974-49888996 ACCCCAGGACACCCCCCTCAAGG + Intergenic
1082609497 11:55280750-55280772 ACCCCAGGACACCCCCCTCAAGG - Intergenic
1082657192 11:55869783-55869805 ACCCCAGGACACCCCCCTCAAGG + Intergenic
1083180033 11:60979340-60979362 CCCCCAGGCAAACCCCATGAGGG - Intronic
1084317743 11:68355104-68355126 CACCAAGGGCCACCCCATCCAGG - Intronic
1085700410 11:78740763-78740785 CAGCCAGGACAGCCCCAGAAAGG - Intronic
1088850585 11:113700189-113700211 CACCCAGGATCCCCACATCAAGG + Intronic
1091152233 11:133339517-133339539 TACCCAGGCCAGCCTCATCATGG + Intronic
1097522310 12:60684975-60684997 CACTCAGGACTACTCCCTCAGGG - Intergenic
1098037517 12:66320275-66320297 CCCCCAGGACAATCCCATTAAGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101962291 12:109259153-109259175 CACCCAGGACAGCACCCTCTGGG + Intronic
1103847842 12:123912201-123912223 CACCCAGGACAGACCCACCCAGG - Intronic
1103849960 12:123926440-123926462 CACTCAGGAGTTCCCCATCAGGG + Exonic
1105265228 13:18809212-18809234 CACCCAGGACAACCCCATCAGGG - Intergenic
1106242805 13:27924178-27924200 CACGCAGCCCAACCCCTTCAAGG - Intronic
1109429633 13:62214327-62214349 CACCAAAGACAACCCGATCCAGG - Intergenic
1109979904 13:69894238-69894260 AATCCTGGACAACTCCATCATGG - Intronic
1113533334 13:111045288-111045310 CAGCCAGGCCAACCCCAGTAGGG + Intergenic
1114657053 14:24322595-24322617 CACCCAGCTCAGCCCCACCAGGG - Intronic
1118744066 14:68761525-68761547 CTCCCAGGACAACACCTCCAGGG + Intergenic
1119806467 14:77485406-77485428 CACCCAGGCCATCCACATGAGGG + Intronic
1120686192 14:87540523-87540545 CACCTAGGACAGTGCCATCATGG + Intergenic
1122414351 14:101541761-101541783 GACCCAGAACCACTCCATCATGG - Intergenic
1122774747 14:104112144-104112166 CACCCTGGACATCCCCAGGAGGG - Intronic
1202833259 14_GL000009v2_random:58910-58932 CACACAGGACAACCCCATCAGGG + Intergenic
1127397437 15:58553837-58553859 CACCCTGGACAACACCATCCTGG + Intronic
1128515535 15:68339626-68339648 CTCCCAGCAGAACCCCATCCTGG + Exonic
1129253050 15:74319202-74319224 CCCAGAGGACAACCCCAACAAGG + Intronic
1130599300 15:85264972-85264994 CACCCAAGCCAACCCCAGGAAGG - Intergenic
1131179722 15:90231492-90231514 CTCCTAGGCCAACCCCTTCAAGG - Exonic
1131400244 15:92119593-92119615 CACCCAGGTCCACCCCACCCAGG - Intronic
1131512284 15:93056029-93056051 CACCCAGTACAGCCTCATCTGGG - Intronic
1132554972 16:568368-568390 TGCCAAGGACAACTCCATCAAGG + Exonic
1132955670 16:2592086-2592108 CGCCCAGGAGAGCCCCAGCAAGG - Intronic
1133015665 16:2938338-2938360 AACCCAGGGCCACCGCATCATGG + Exonic
1136063126 16:27740537-27740559 CACCCGGGAAAACCCCATCCTGG + Exonic
1136545672 16:30953442-30953464 CAACCAGGACAACTTCAGCAAGG - Exonic
1138309570 16:56011809-56011831 CACCCAGAACAATCCCCACAGGG - Intergenic
1139352570 16:66346530-66346552 CCCACAGCACAGCCCCATCAGGG - Intergenic
1139666276 16:68459011-68459033 CACCACGGACAACCCCATGCTGG - Intergenic
1139740936 16:69034342-69034364 CACCCTGGACAACTTCACCAAGG + Intronic
1139958646 16:70705286-70705308 CACCCAAAACACCCCCACCACGG - Intronic
1142175528 16:88643373-88643395 TCCCCAGGTCAACCCCATCCCGG - Exonic
1142319737 16:89373396-89373418 CACCGGGGGCAACCCCAACAGGG + Intronic
1142908262 17:3063262-3063284 GACCCTGGACAACCTCATCCTGG - Exonic
1142926304 17:3240999-3241021 GACCCTGGACAACCTCATCCTGG + Intergenic
1142942918 17:3397961-3397983 CACCCAGGACAGCGCCACCAGGG + Exonic
1142946451 17:3433365-3433387 CACCCAGGACAGCGCCACCACGG + Exonic
1144061154 17:11583925-11583947 GACCCAGCCCAGCCCCATCATGG + Intergenic
1144098098 17:11919965-11919987 CACCCAGGGCTCTCCCATCATGG - Intronic
1149333431 17:55609575-55609597 ACCCCAGAACAAGCCCATCATGG - Intergenic
1152662474 17:81549123-81549145 CACCCAGGACGACCCCACACAGG + Intronic
1154009121 18:10560344-10560366 CTCCCAGGAAAGCCCCCTCAAGG - Intergenic
1154423166 18:14252332-14252354 CACCCAGGACAACCCCATCAGGG + Intergenic
1158213938 18:55079748-55079770 CACCCAGAACAAACTCATGAAGG + Intergenic
1159016668 18:63106426-63106448 CAAGCAGGATAAGCCCATCATGG - Intergenic
1161280938 19:3445482-3445504 CACCCAGGACACCCACATGGGGG - Intronic
1161640459 19:5419371-5419393 GAACCAGGACAACTCCATCTTGG + Intergenic
1163158178 19:15450024-15450046 CGCCCCGGACCTCCCCATCATGG - Intergenic
1163417251 19:17194286-17194308 CACCCACCACAGCCCCAACAAGG + Intronic
1164422375 19:28106174-28106196 CTCCCCTGCCAACCCCATCAGGG + Intergenic
1168526890 19:57095756-57095778 CACCCTGGAAAACCTCAGCAGGG - Intergenic
1202639410 1_KI270706v1_random:68786-68808 CACACAGGACAACCCCATCAGGG - Intergenic
925060463 2:886124-886146 CAGCCAGGACAAAGCCATCCGGG - Intergenic
925129037 2:1481553-1481575 CTCCCTGGACATCCCCATCCCGG + Intronic
926044781 2:9702605-9702627 CACCTAGGAGAACCCCAACTGGG - Intergenic
926183481 2:10667644-10667666 TACCCAGGACAAGCCTGTCAAGG - Intronic
927825756 2:26309186-26309208 CACCCATGGCAATCCCTTCAAGG + Intronic
930841076 2:55845917-55845939 AACCCAGGACAGGCCCATCCTGG - Intergenic
931937998 2:67219328-67219350 CACCCTTGACGTCCCCATCATGG - Intergenic
932280916 2:70491274-70491296 CTCCCAGGACAAACCCATGTTGG + Intronic
936091258 2:109502739-109502761 CACGCAGGTCAACCCCAGCCGGG + Intronic
938022545 2:127917899-127917921 CACCCAGGACACCCACAACATGG + Intergenic
939752380 2:146063812-146063834 CACTCAACACCACCCCATCAGGG - Intergenic
942346473 2:175007639-175007661 CTCCCAGGACAACCCCTCAAGGG - Intergenic
943046322 2:182866351-182866373 CACTCAGGCCAACGCCATCCTGG - Exonic
947148179 2:227087603-227087625 CACCCAGCACCACCACATTAAGG + Intronic
948476744 2:238225474-238225496 CTCCCAAGACGACACCATCAGGG + Exonic
1171886063 20:30653152-30653174 CACCCAGGACAACCCCATCAGGG - Intergenic
1172305114 20:33875231-33875253 GCCCCACCACAACCCCATCAAGG - Intergenic
1176647739 21:9366395-9366417 CACACAGGACAACCCCATCAGGG - Intergenic
1176850306 21:13907677-13907699 CACCCAGGACAACCCCATCAGGG - Intergenic
1178311021 21:31530142-31530164 CTCCCAGGGCAACCTCATCTGGG + Intronic
1180206536 21:46264699-46264721 CCCCCAGGCCATGCCCATCAGGG + Intronic
1180362534 22:11913078-11913100 CACACAGGACAACCCCATCAGGG + Intergenic
1185046402 22:48530745-48530767 CCCCCAGGCCCACCCCTTCAGGG + Intronic
949848759 3:8399596-8399618 CGCCCAGGATACCCCCATCTTGG + Intergenic
950042933 3:9931919-9931941 CACCCAGGACAGCAAGATCAAGG + Intronic
951682709 3:25311196-25311218 CAGACAGGACAACCACCTCAAGG + Intronic
953213716 3:40898376-40898398 CACCCAGGATACCTGCATCATGG - Intergenic
953728766 3:45426855-45426877 CAGTCAGGTCATCCCCATCAAGG + Intronic
953778218 3:45841787-45841809 CACCCAGGATTACCCCAGAAGGG + Intronic
954291179 3:49650854-49650876 CCCCCAGGCCAAGCCCCTCAGGG + Exonic
962805187 3:138922065-138922087 CATCCAGCTCAACCCCCTCAGGG - Intergenic
966589128 3:181660466-181660488 CATTCAGGATAACCCCTTCAGGG - Intergenic
967152669 3:186664091-186664113 CACCCAGGACACCCCATTTAGGG + Intronic
1202739144 3_GL000221v1_random:38592-38614 CACACAGGACAACCCCATCAGGG + Intergenic
968521321 4:1035985-1036007 CACCCAGGGCCACCCTCTCAGGG - Intergenic
968694046 4:2012586-2012608 CACCCTTTACAACCACATCAAGG - Intronic
969938810 4:10709862-10709884 CATCCAAGATCACCCCATCATGG + Intergenic
972583788 4:40418549-40418571 GACCCAGCACACCCCCAGCAAGG + Intergenic
973369658 4:49235152-49235174 CACCCAGGACAACCCCATCAGGG - Intergenic
973391373 4:49560264-49560286 CACCCAGGACAACCCCATCAGGG + Intergenic
976693482 4:87893724-87893746 CAACCCCGACCACCCCATCATGG + Intergenic
977574317 4:98659806-98659828 CACCCAGTGCAACCCGATCCTGG + Intergenic
982972996 4:162014627-162014649 CACCCAGGAGAACCACAGCATGG - Intronic
983425186 4:167574924-167574946 ATCCCAGCACAACTCCATCAGGG - Intergenic
1202766769 4_GL000008v2_random:154655-154677 CACACAGGACAACCCCATCAGGG - Intergenic
986169395 5:5303474-5303496 CACCCATGCCAACCCCACCCTGG - Intronic
986986524 5:13506640-13506662 CAGCCAGTAAAACACCATCAAGG - Intergenic
987310865 5:16679922-16679944 AAGCCAAGACAAGCCCATCAAGG - Intronic
991088234 5:62668017-62668039 CATCCTGACCAACCCCATCAAGG + Intergenic
992509162 5:77416411-77416433 GACCCAGGACAGCCCCAACCTGG - Intronic
993268646 5:85763115-85763137 CACCATGGACAACTCCATCAAGG + Intergenic
1001138644 5:169124242-169124264 TTCCCAGTACAACTCCATCAAGG - Intronic
1002939958 6:1707483-1707505 CACCCTGGACAACGCCATGGAGG - Intronic
1003110713 6:3250060-3250082 GACCCTGGGCAACCCCATGAAGG - Intronic
1004221080 6:13747038-13747060 CACCCTTAACACCCCCATCATGG + Intergenic
1005022243 6:21429514-21429536 CACACAGGACAACCCCAAAAGGG + Intergenic
1006025205 6:31142489-31142511 CCCCCAGGGCAACCCCAGGATGG + Exonic
1006248366 6:32759800-32759822 CACCCAGGCCAACCTCTGCATGG - Intronic
1008554019 6:52657492-52657514 CTCCCAGGACAACGCCCTGAGGG + Intergenic
1009854234 6:69240332-69240354 CAAAAATGACAACCCCATCAAGG + Intronic
1013398489 6:109768163-109768185 GACCCAGGCCAACCCCATGCTGG - Intronic
1014253601 6:119139985-119140007 CACCCTGGGCAGCCCCAGCAAGG - Intronic
1018390162 6:163335812-163335834 CACCCAGGCCAGCCACGTCATGG - Intergenic
1019262449 7:88988-89010 CTCCTAGGAAGACCCCATCAGGG + Intergenic
1019500503 7:1362255-1362277 CACTCAGGGCAACCCCAGCTTGG - Intergenic
1019855179 7:3598520-3598542 CAGCCAGGACACCAGCATCAGGG + Intronic
1020278411 7:6637804-6637826 CCCCCAGGACACACCCATCCAGG + Intronic
1023220444 7:37916369-37916391 CACGCAGGAGAACGCCATCCTGG - Exonic
1024311852 7:47976786-47976808 GACCCATGACATCCCCATAAAGG - Exonic
1024532775 7:50407095-50407117 CACCCAGAACATGCCCAGCATGG - Intergenic
1024676496 7:51642240-51642262 CCCCAAGGACAACCCTTTCAGGG + Intergenic
1024908012 7:54410397-54410419 CCTCCAGGTCAACCCCAGCATGG + Intergenic
1029697857 7:102226173-102226195 CACCCACGGCGACCCCAACAAGG + Intronic
1032482403 7:132257449-132257471 CACCCTGGCCAAACCCAGCAGGG + Intronic
1032802539 7:135328396-135328418 AACCCAGGATATCCCCATCATGG - Intergenic
1034162945 7:149006026-149006048 CACCCAGGACTCGGCCATCAAGG - Exonic
1034345489 7:150382876-150382898 CACCCATGGCCATCCCATCAGGG - Intronic
1038918594 8:32055809-32055831 CACCAAGGAAAACACCACCAAGG - Intronic
1040618635 8:49064559-49064581 CCCCCAGGACAAGCCCACCGAGG + Intronic
1040921604 8:52626798-52626820 TCCCCATGACAACTCCATCATGG - Intronic
1043341945 8:79250555-79250577 CACCCAGGAGAGCCAGATCATGG - Intergenic
1044842064 8:96345053-96345075 CATCCAGGAGATCCCCATAAGGG + Intergenic
1048077936 8:131093912-131093934 CACCAAGGACACCACCACCAGGG - Intergenic
1052351339 9:27461368-27461390 CCCACAGGACAACCCCAGAATGG + Intronic
1052877041 9:33575206-33575228 CCACCAGGACAACCCCATCATGG + Intergenic
1053498963 9:38569188-38569210 CCACCAGGACAACCCCATCATGG - Intronic
1056586544 9:87931149-87931171 CCACCAGAACAACACCATCATGG - Intergenic
1056610332 9:88121793-88121815 CCACCAGAACAACCCCATCATGG + Intergenic
1057162017 9:92895523-92895545 CCACCAGGACAACCCCATCATGG - Intergenic
1057678409 9:97153679-97153701 CCACCAGGACAACCCCATCACGG - Intergenic
1061400975 9:130368269-130368291 CACCCAGGTCAACCCCTCCCCGG + Intronic
1061534773 9:131240736-131240758 CACCCAGGACCACCACCTCTTGG - Intergenic
1061618683 9:131796702-131796724 CACCCAGGGCCACCCCACCGAGG + Intergenic
1062037868 9:134390701-134390723 CCCCCATCACAACCCCAACATGG - Intronic
1062075536 9:134586604-134586626 CCCCCACGCCTACCCCATCAGGG + Intergenic
1062474949 9:136722247-136722269 CACCCGGGGCACCTCCATCAAGG + Exonic
1203707873 Un_KI270742v1:69036-69058 AACACAGGACAACCCCATCAGGG + Intergenic
1203547522 Un_KI270743v1:139534-139556 CACACAGGACAACCCCATCAGGG - Intergenic
1190214546 X:48470755-48470777 GACCCATCACAGCCCCATCAAGG + Intergenic
1190562318 X:51697522-51697544 CACCCAGGATAACCTCCTTATGG - Intergenic
1195017868 X:100796566-100796588 AACCCAGGAAAACCCCTCCATGG + Intergenic
1195968315 X:110449046-110449068 CAGCCTGGACAACCCCAAGATGG - Intronic
1198659448 X:138951858-138951880 CACCCAGGAAATCCACATCTAGG + Intronic