ID: 1105271050

View in Genome Browser
Species Human (GRCh38)
Location 13:18875510-18875532
Sequence CCCAACCCGCTCCCCACGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 4, 1: 1, 2: 2, 3: 24, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105271044_1105271050 -5 Left 1105271044 13:18875492-18875514 CCACGGATCCTTAAGGCCCCCAA 0: 4
1: 2
2: 4
3: 5
4: 71
Right 1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG 0: 4
1: 1
2: 2
3: 24
4: 192
1105271039_1105271050 14 Left 1105271039 13:18875473-18875495 CCCGCCGTGAATAGTGCAGCCAC 0: 3
1: 0
2: 2
3: 5
4: 59
Right 1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG 0: 4
1: 1
2: 2
3: 24
4: 192
1105271040_1105271050 13 Left 1105271040 13:18875474-18875496 CCGCCGTGAATAGTGCAGCCACG 0: 3
1: 1
2: 2
3: 5
4: 58
Right 1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG 0: 4
1: 1
2: 2
3: 24
4: 192
1105271038_1105271050 15 Left 1105271038 13:18875472-18875494 CCCCGCCGTGAATAGTGCAGCCA 0: 3
1: 0
2: 6
3: 3
4: 26
Right 1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG 0: 4
1: 1
2: 2
3: 24
4: 192
1105271037_1105271050 21 Left 1105271037 13:18875466-18875488 CCTGATCCCCGCCGTGAATAGTG 0: 3
1: 0
2: 0
3: 4
4: 27
Right 1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG 0: 4
1: 1
2: 2
3: 24
4: 192
1105271042_1105271050 10 Left 1105271042 13:18875477-18875499 CCGTGAATAGTGCAGCCACGGAT 0: 3
1: 0
2: 6
3: 6
4: 52
Right 1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG 0: 4
1: 1
2: 2
3: 24
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105271050 Original CRISPR CCCAACCCGCTCCCCACGAT GGG Intergenic
902887426 1:19415965-19415987 CCCAACCCACTCTGGACGATGGG + Intronic
903628168 1:24745806-24745828 CCCAACCCGGACCCCTCGACGGG - Intronic
903927364 1:26840128-26840150 CCCAAGCCTCTCCCCAGGACAGG - Intronic
904490117 1:30853478-30853500 CACAGCCCCCTCCCCACCATAGG + Intergenic
906790980 1:48658666-48658688 CCCAAACAGCTTCCCACTATAGG - Intronic
907227438 1:52961225-52961247 CCCAACCCCCACCCCACAACAGG + Intronic
911587810 1:99711152-99711174 CCTAAACCGCCCCCCACAATTGG - Intronic
913341678 1:117764122-117764144 CCCAACCCCCACCCCACGACAGG + Intergenic
913959199 1:143326478-143326500 CCCAACCGGCTCCCCACCAAAGG + Intergenic
914053516 1:144151858-144151880 CCCAACCGGCTCCCCACCAAAGG + Intergenic
914125681 1:144814683-144814705 CCCAACCGGCTCCCCACCAAAGG - Intergenic
914403759 1:147348950-147348972 CCCACCCCTCACCCCACGACGGG - Intergenic
916635794 1:166667161-166667183 CCCTTCCCCCACCCCACGATGGG - Intergenic
916638297 1:166697802-166697824 CCCTACCCCCACCCCACGACAGG - Intergenic
923193886 1:231645660-231645682 CCCTCCCCGCACCCCACGACAGG + Intronic
1066265342 10:33771360-33771382 CCCAACCCCCTCCCCACAGCTGG - Intergenic
1067008923 10:42691490-42691512 CCCAAGCCGCTCCCCACCGTGGG + Intergenic
1067369646 10:45671675-45671697 CCCATCTCACTCCCCACGACAGG - Intronic
1068413723 10:56689794-56689816 CCCATCCCCCACCCCACGACAGG - Intergenic
1072373970 10:94795151-94795173 CCCCACCCCCACCCCACGACAGG + Intronic
1074680274 10:115899104-115899126 CCCATCCCCCACCCCACGACAGG + Intronic
1076877746 10:133224928-133224950 CCCAGCCCGCCCCCCACAGTCGG - Exonic
1079440919 11:20513879-20513901 CCCACCCCCCACCCCACGACAGG - Intergenic
1084573649 11:69975245-69975267 CCCTACCCCCTCCCCACAGTGGG + Intergenic
1086074113 11:82831866-82831888 CCCAACCCTCACCCCCCGACAGG + Intronic
1089200868 11:116724064-116724086 CCCGGCCCCCTCCCCACAATAGG + Intergenic
1093275593 12:17121122-17121144 CCCTTCCCCCACCCCACGATAGG - Intergenic
1094324987 12:29227974-29227996 ACCTACCCCCACCCCACGATAGG - Intronic
1097303141 12:58039839-58039861 CCCAACCCCCACCCCATGACAGG + Intergenic
1099430594 12:82579957-82579979 CCCACCCCCCACCCCACGACAGG + Intergenic
1100127854 12:91452365-91452387 CTCTACCCCCACCCCACGATAGG + Intergenic
1102797578 12:115702117-115702139 CCCTACCCCCACCCCACGACAGG - Intergenic
1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG + Intergenic
1105322663 13:19343888-19343910 CCCCACCCCCTCCCCCCGACAGG - Intergenic
1115099069 14:29675972-29675994 CCCACCCCCCACCCCACGACAGG - Intronic
1117068461 14:52034011-52034033 CCCCACCCCCACCCCACCATTGG + Intronic
1117347766 14:54850629-54850651 CCCTCCCTGCTCCCCACGACAGG + Intronic
1118829405 14:69416067-69416089 CCCAGCCCCCACCCCACGACAGG + Intronic
1120663188 14:87275184-87275206 CCCTCCCCCCTCCCCACGACAGG + Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122688434 14:103520837-103520859 CCCGACCCGCCCCCCACAGTGGG + Intronic
1202929190 14_KI270725v1_random:23612-23634 CCCAACCAGCCACCCAAGATGGG - Intergenic
1202929220 14_KI270725v1_random:23702-23724 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1123423078 15:20147518-20147540 CCCAACCGGCTCCCCGCCAAAGG + Intergenic
1123505983 15:20941608-20941630 CCCCACCCGCACCCCGCCATGGG - Intergenic
1123532303 15:21154057-21154079 CCCAACCGGCTCCCCGCCAAAGG + Intergenic
1123563215 15:21515315-21515337 CCCCACCCGCACCCCGCCATGGG - Intergenic
1123599464 15:21952598-21952620 CCCCACCCGCACCCCGCCATGGG - Intergenic
1128802089 15:70503438-70503460 CCCAAACCGCCCCCCAAGCTGGG + Intergenic
1129866012 15:78909380-78909402 CCCAAACCCCTCCCCAGGACTGG - Intergenic
1202971567 15_KI270727v1_random:242449-242471 CCCCACCCGCACCCCGCCATGGG - Intergenic
1132687612 16:1168854-1168876 CTCAGCCCGCTCCCCACTTTAGG + Intronic
1134564920 16:15243155-15243177 CCCCTCCAGCTCCCCACAATGGG - Intergenic
1134737576 16:16513541-16513563 CCCCTCCAGCTCCCCACAATGGG + Intergenic
1134929932 16:18198616-18198638 CCCCTCCAGCTCCCCACAATGGG - Intergenic
1135258525 16:20961338-20961360 CCCTCCCCGCACCCCACGACAGG - Intronic
1136861674 16:33707827-33707849 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1141901195 16:86991970-86991992 CCCAAATCTCTCCCCACGTTAGG - Intergenic
1203123171 16_KI270728v1_random:1556011-1556033 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1142759753 17:2035484-2035506 CCCCACCCCCTCCCCACCACAGG - Intronic
1142828783 17:2532219-2532241 TCCAACCCACCCCCCACGCTGGG - Intergenic
1143188380 17:5023953-5023975 CAGAACCCGCTCCCCGGGATCGG - Exonic
1143966047 17:10757132-10757154 CCCAACCCCCTTCCCAGCATAGG - Intergenic
1146600403 17:34209895-34209917 CCCACCCCTCACCCCACGATAGG + Intergenic
1148113695 17:45162263-45162285 CCCAACCTTCTCCCCAAGCTGGG - Intronic
1149202462 17:54202700-54202722 CCCAACCCCCACCCCACAACAGG + Intergenic
1153051375 18:905773-905795 CCCAACCCGGCCCACAGGATGGG + Intronic
1154107133 18:11533160-11533182 CCCAATCCGCTCCCCACGATGGG - Intergenic
1154170484 18:12047343-12047365 CCCAACCAACCCCCCACTATGGG + Intergenic
1154170506 18:12047436-12047458 CCCAACCCACTCCCCATGATGGG + Intergenic
1154170535 18:12047533-12047555 CCCAACCCACACCCCACCATGGG + Intergenic
1154170565 18:12047630-12047652 CCCAACCCACACCCCACCATGGG + Intergenic
1154170697 18:12048151-12048173 CCCACCTCGCTCCCCACCATGGG + Intergenic
1154171615 18:12056844-12056866 CAGAACCCGCTCCCCAGGATTGG + Intergenic
1154172398 18:12061242-12061264 CCCAACCCGCACCCCACCACAGG - Intergenic
1154172424 18:12061339-12061361 CCCAACCCACTCCCTGCGATAGG - Intergenic
1154175281 18:12083658-12083680 CCCAACCCGCTCCCCGCCGAGGG - Intergenic
1154184120 18:12166871-12166893 CCCAACCCCCACCCCATGACAGG + Intergenic
1154416528 18:14178517-14178539 CCCAACCCGCTCCCCACGATGGG - Intergenic
1156380444 18:36554479-36554501 CCCCACCCCCACCCCACGACAGG - Intronic
1156444470 18:37225002-37225024 CCAAACCTGATCCCCATGATGGG + Exonic
1157600838 18:48892298-48892320 CCCAGCCTGCCCTCCACGATGGG - Intergenic
1158100551 18:53824882-53824904 CCCTACCCCCACCCCACGACAGG - Intergenic
1158775338 18:60571785-60571807 CCCAACCCCCACCCCACAACAGG - Intergenic
1159633124 18:70772965-70772987 CCCAACACCATCCCCACGATAGG - Intergenic
1161265490 19:3361585-3361607 CCCAAACAGCCCCCCATGATGGG - Intronic
1161882073 19:6962529-6962551 CCCTACCCCCACCCCACGACAGG - Intergenic
1162032772 19:7924655-7924677 CCCAACCCGGGCCCCAGGACAGG - Exonic
1164772309 19:30819092-30819114 CCCACCCCGCCCCCCAGCATTGG + Intergenic
1165879618 19:39032680-39032702 CCCAACCTGCTTCCCGCGACGGG + Intronic
1202692915 1_KI270712v1_random:104281-104303 CCCAACCGGCTCCCCACCAAAGG + Intergenic
933398484 2:81762120-81762142 CCCAACCCCCACCCCACAACAGG + Intergenic
933567214 2:83964962-83964984 CCCAACCCCCACCCCATGACAGG - Intergenic
933953486 2:87349686-87349708 CCCAACCGGCTCCCCACCAAAGG - Intergenic
934237693 2:90245934-90245956 CCCAACCGGCTCCCCACCAAAGG - Intergenic
934275510 2:91570797-91570819 CCCAACCGGCTCCCCACCAAAGG + Intergenic
934460119 2:94209265-94209287 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
936111512 2:109669806-109669828 CCCAACCTGCTCCCCGCCATGGG + Intergenic
936224476 2:110635344-110635366 CCCAACCCACTCCCCACCACGGG - Intergenic
938020481 2:127902106-127902128 CCCTACCCCCACCCCACGACAGG - Intergenic
938772082 2:134509351-134509373 CCCAAGCCACTCCTCAAGATGGG + Intronic
939095336 2:137827408-137827430 CACAACCCACTCCCCACAAGGGG - Intergenic
939357846 2:141127007-141127029 CCCACCCCTCACCCCACAATAGG + Intronic
943150674 2:184108157-184108179 CCCCACCCCCACCCCACGACAGG - Intergenic
943779012 2:191800760-191800782 CCCAACCCCCACCCCACAACAGG - Intergenic
944203377 2:197132208-197132230 CCCAACCTGCTCCCCACATCTGG - Intronic
948751549 2:240136175-240136197 CCTTCCCCGCTCCCCACGCTCGG + Exonic
1173712167 20:45168333-45168355 CCCTCCCCGCTCCCCATGACAGG - Intergenic
1175175867 20:57111754-57111776 CCCATCCAGCTCCCCCCGACAGG + Intergenic
1175962553 20:62644431-62644453 CCCAGCCAGCTCTCCACCATGGG - Intronic
1176265045 20:64204770-64204792 CCCAGACCGCTCCCCACGGCAGG - Intronic
1176518404 21:7805024-7805046 CCCTCCCCTCTCCCCACGACAGG + Intergenic
1176591214 21:8652210-8652232 CCCAACCAGCCACCCAAGATGGG - Intergenic
1176591240 21:8652301-8652323 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG + Intergenic
1176867780 21:14063472-14063494 CCCAACCCGCTCCCCACGATGGG - Intergenic
1176869774 21:14075362-14075384 CCCAACACACTACCCACGAGCGG + Intergenic
1178652432 21:34435037-34435059 CCCTCCCCTCTCCCCACGACAGG + Intergenic
1178678288 21:34649439-34649461 CCCAACCCGCTGCCCATCACTGG + Intergenic
1178701081 21:34834601-34834623 CCCTCCCTGCTCCCCACAATAGG - Exonic
1180274060 22:10629321-10629343 CCCAACCAGCCACCCAAGATGGG - Intergenic
1180274088 22:10629412-10629434 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1181342492 22:22193807-22193829 CCCTACCCCCACCCCACGACAGG - Intergenic
1181356143 22:22297498-22297520 CCCAACCGGCTCCCCGCCAAAGG + Intergenic
1182686022 22:32122253-32122275 CCCAACCCACTCCCCTCCACAGG - Intergenic
1182697243 22:32205734-32205756 CCCAACCCGCTCCCCACTGTGGG - Intergenic
1182697424 22:32206387-32206409 CCCAACCCGCTCCCTGCCGTAGG - Intergenic
1182715688 22:32354683-32354705 CCCAACCCACTCCCCTCTGTGGG + Intergenic
950688507 3:14636678-14636700 CCCAACCCCCATCCCACGAGGGG + Intergenic
950947419 3:16964170-16964192 CCCTCCCCCCTCCCCACGACAGG + Intronic
952146627 3:30540301-30540323 CCCTACCCCCACCCCACGACAGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953356329 3:42259195-42259217 CCTAACCCCCACCCCCCGATAGG - Intronic
954562982 3:51573993-51574015 CCCCACCCCCACCCCACAATAGG + Intronic
955347016 3:58168689-58168711 CACAACCAGCTCCCCAGGAAGGG - Intronic
956048030 3:65217440-65217462 CCCAACCCCCACCCCACGACAGG + Intergenic
958545761 3:95548399-95548421 CCCAACCCCCACCCCACAACAGG - Intergenic
959723602 3:109519629-109519651 CCCAAGCCCCACCCCACGACAGG + Intergenic
960744765 3:120874804-120874826 CCCTACCCCCACCCCACGACAGG - Intergenic
962601378 3:136993568-136993590 CCCAACCCCCACCCCATGACCGG + Intronic
964715811 3:159720221-159720243 CCCTCCCCCCACCCCACGATAGG - Intronic
965818385 3:172660123-172660145 CCCTCCCCCCTCCCCACGACAGG + Intronic
967602748 3:191409067-191409089 CCCTCCCCACACCCCACGATAGG - Intergenic
968648458 4:1751187-1751209 CCCTGCCCCCACCCCACGATGGG + Intergenic
970833891 4:20376866-20376888 CCCAACCCCCGCTCCACGACAGG - Intronic
972335252 4:38102086-38102108 CCCTCCCCCCACCCCACGATAGG - Intronic
972864226 4:43210462-43210484 CCCCACCCCCACCCCACGACAGG - Intergenic
972936112 4:44138048-44138070 CCCAACCCCCACCCCCCGACAGG - Intergenic
975057774 4:69956996-69957018 CCCTACCCCCACCCCACGACAGG - Intronic
975754883 4:77562215-77562237 CCCAACCCCCACCCCACCATGGG + Intronic
976222620 4:82770182-82770204 CCCTCCCCACACCCCACGATAGG + Intronic
977857298 4:101909385-101909407 CCCTACCCCCACCCCACGACAGG - Intronic
979117685 4:116848548-116848570 CCCTACCCCCACCCCACGACAGG + Intergenic
979800215 4:124898854-124898876 CCCTACCCCCACCCCATGATAGG - Intergenic
979821301 4:125175589-125175611 CCCTCCCCGCACCCCACGACAGG + Intergenic
979896451 4:126164061-126164083 CCCTCCCCCCACCCCACGATAGG + Intergenic
982620930 4:157703863-157703885 CCCTACCCCCACCCCACGACAGG - Intergenic
983717991 4:170809229-170809251 CCCAACCCCCACCCCAAGACAGG + Intergenic
987703672 5:21434956-21434978 CCCTCCCCGCACCCCACGACAGG + Intergenic
988312292 5:29575834-29575856 CCCTCCCCCCTCCCCACGACAGG - Intergenic
992513686 5:77469235-77469257 CCCTACCCCCACCCCACGACAGG - Intronic
994209311 5:97070508-97070530 ACCAACCCCCTCCCCACTCTTGG + Intergenic
999096340 5:148981187-148981209 ACCAACCGGGTCCCCACCATGGG - Intronic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
1006092243 6:31634946-31634968 CACCACCTGCCCCCCACGATGGG + Exonic
1007600298 6:43076923-43076945 TCCATCGCGCTCCCCACGGTGGG - Exonic
1008135018 6:47764936-47764958 GCCCACCCTCTCCCCACCATTGG + Intergenic
1008371667 6:50739219-50739241 CCCTACCCCCACCCCACGACAGG + Intronic
1010168477 6:72945401-72945423 CCCACCCCCCACCCCACGACAGG + Intronic
1011242411 6:85286942-85286964 CCCCACCCCCACCCCACGACAGG + Intergenic
1011337596 6:86278299-86278321 CCCTACCCGCACCCCACAACAGG + Intergenic
1011521209 6:88208948-88208970 CCACACTCCCTCCCCACGATGGG + Intergenic
1014675362 6:124357923-124357945 CCCAACCCGCACGCCACAACAGG + Intronic
1016363319 6:143290930-143290952 CCCCACCCTCTTCCCAAGATGGG + Intronic
1017207871 6:151823619-151823641 CCCTACCCCCACCCCACGACAGG + Intronic
1018795715 6:167184125-167184147 CCCTCCCCCCTCCCCACGACAGG + Intronic
1018820601 6:167370934-167370956 CCCTCCCCCCTCCCCACGACAGG - Intronic
1020119920 7:5497346-5497368 ACCACCCCGCTCCCCACGCACGG + Intronic
1021671900 7:23042948-23042970 CCCTCCCCCCACCCCACGATAGG - Intergenic
1021824775 7:24538663-24538685 CCCTACCCCCACCCCACGACAGG - Intergenic
1022046350 7:26625369-26625391 CCAAACCCACTCCCTACCATGGG - Intergenic
1022466573 7:30656314-30656336 CCCAACCCTCTCCCCAGTATAGG + Intronic
1022558474 7:31324876-31324898 CCCTACCCCCACCCCACGACAGG - Intergenic
1024067840 7:45756723-45756745 CCCATCCCCCACCCCACGACAGG - Intergenic
1028099820 7:86805896-86805918 CCCTCCCCGCACCCCACGACAGG + Intronic
1032461639 7:132115751-132115773 CCCAATCCACACCCCAAGATAGG - Intergenic
1033660350 7:143398240-143398262 CCCAACCCACACCCCAGGCTAGG + Intronic
1034515296 7:151572365-151572387 CCCACCTCGCTGCCCACAATGGG - Intronic
1036463294 8:8973349-8973371 ACCACCCCCCTCCCCACGTTTGG - Intergenic
1038937972 8:32273298-32273320 CCCAACCCCCTCCCGACTTTTGG + Intronic
1041623582 8:60000135-60000157 CCCGAGCCCCTCCCCACCATGGG + Intergenic
1049552665 8:143267630-143267652 CCCACCCCGCTCCCCGGGCTTGG - Intronic
1049797169 8:144502160-144502182 CACAACCCACTCCCCACTGTGGG - Intergenic
1049816835 8:144607565-144607587 CCCACCCCGCCCCCCAGGAGAGG + Intergenic
1050315006 9:4392233-4392255 CCCGACCCCCGCCCCACGACAGG - Intergenic
1051043814 9:12849055-12849077 CCCTCCCCCCTCCCCACGACAGG - Intergenic
1051339772 9:16100802-16100824 CCCACCCCGCCCCCCACCAAGGG + Intergenic
1052642129 9:31181909-31181931 CCCCACCCCCACCCCACGACAGG - Intergenic
1053076576 9:35139135-35139157 CCCAACCCCCACTCCAAGATGGG - Intergenic
1053341691 9:37341525-37341547 CCCAACCCCATCCCCAGGCTAGG - Intronic
1053690619 9:40584949-40584971 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1054301876 9:63385920-63385942 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1054400650 9:64712426-64712448 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1054406651 9:64768801-64768823 CCCTCCCCCCACCCCACGATAGG + Intergenic
1054434257 9:65196742-65196764 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1054496133 9:65824939-65824961 CCCAACCGGCTCCCCGCCAAAGG + Intergenic
1055226571 9:74004515-74004537 CCCTCCCCCCTCCCCACGACAGG + Intergenic
1056996572 9:91467684-91467706 CCCAACCCCCACCCCACAACAGG + Intergenic
1057371622 9:94479547-94479569 CCCAACCCGCTCCCCGCTGCAGG - Intergenic
1057371638 9:94479591-94479613 CCCAACCCGCCCCCCACTGTGGG - Intergenic
1059524379 9:114976786-114976808 CCCTACCCCCACCCCACGACAGG - Intergenic
1061425791 9:130497679-130497701 CCCATCCCGTTCCCCAAGGTGGG - Intronic
1061749829 9:132770125-132770147 CCTAGCCCGGTCCCCACGATGGG - Intronic
1062132044 9:134901664-134901686 CCCTCCCCCCTCCCCACGACAGG + Intergenic
1062218251 9:135400559-135400581 CCCACCCCGGACCCCACGAGAGG - Intergenic
1203621269 Un_KI270749v1:131065-131087 CCCAACCGGCTCCCCGCCAAAGG - Intergenic
1185977682 X:4739823-4739845 CCCTCCCCCCACCCCACGATAGG + Intergenic
1186306966 X:8271929-8271951 CCCTACCCCCACCCCACGACAGG - Intergenic
1192970621 X:76225238-76225260 CCCAACCCCCACCCCATGACAGG + Intergenic
1197116716 X:122842405-122842427 CCAACCCCCCACCCCACGATAGG + Intergenic
1198094379 X:133364247-133364269 CCCAACCCCCACCCCAGTATAGG + Intronic
1199194857 X:145016296-145016318 CCCTCCCCCCTCCCCACGACAGG + Intergenic
1200645649 Y:5779778-5779800 CCCTACCCCCACCCCACGACAGG - Intergenic