ID: 1105274425

View in Genome Browser
Species Human (GRCh38)
Location 13:18906330-18906352
Sequence TCCAGCTGGCCAGGAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 3, 1: 7, 2: 4, 3: 43, 4: 506}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105274425_1105274434 5 Left 1105274425 13:18906330-18906352 CCAGCAGTTCCTGGCCAGCTGGA 0: 3
1: 7
2: 4
3: 43
4: 506
Right 1105274434 13:18906358-18906380 CCAGGGGCCGGTTTCAGCAAAGG 0: 1
1: 2
2: 47
3: 26
4: 122
1105274425_1105274436 24 Left 1105274425 13:18906330-18906352 CCAGCAGTTCCTGGCCAGCTGGA 0: 3
1: 7
2: 4
3: 43
4: 506
Right 1105274436 13:18906377-18906399 AAGGCAGTCACACCCACCCCAGG 0: 3
1: 1
2: 14
3: 21
4: 263
1105274425_1105274431 -7 Left 1105274425 13:18906330-18906352 CCAGCAGTTCCTGGCCAGCTGGA 0: 3
1: 7
2: 4
3: 43
4: 506
Right 1105274431 13:18906346-18906368 AGCTGGACCTCGCCAGGGGCCGG 0: 1
1: 0
2: 11
3: 27
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105274425 Original CRISPR TCCAGCTGGCCAGGAACTGC TGG (reversed) Intergenic
900003980 1:32077-32099 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900023707 1:202596-202618 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900084743 1:886616-886638 TCCAGCTGGCCAGAGGCAGCAGG - Intergenic
900392805 1:2441062-2441084 TCCAGGTGCCCAGGAAGTGGAGG + Intronic
900606213 1:3524720-3524742 TCCAGATGGCCATGAACTGCGGG - Intronic
900724383 1:4205967-4205989 CCCACCTGGCAAGGAACTGTGGG - Intergenic
901413251 1:9099748-9099770 TCCTGGTGGTCAGGGACTGCTGG - Intergenic
901581694 1:10249690-10249712 TCCAGCTGGTCTCGAACTCCTGG - Intronic
901810830 1:11766095-11766117 GCCTCCTGGCCAGGGACTGCAGG - Exonic
901957346 1:12796168-12796190 TCCAGCTGGTCTCAAACTGCTGG + Exonic
901973741 1:12928420-12928442 CCCAGCTGGTCTGAAACTGCTGG + Intronic
902011437 1:13273347-13273369 CCCAGCTGGTCTGAAACTGCTGG - Intergenic
902418590 1:16258947-16258969 TCAGGCTGGCCACGAACTCCTGG + Intronic
903398869 1:23024056-23024078 CCCAGCTGGCCTCGAACTTCTGG + Intronic
904027618 1:27514298-27514320 CCCAGCTGTCCTGGCACTGCAGG + Intergenic
904564664 1:31421449-31421471 TCCACCTGTCCAGCAACTTCTGG - Intronic
904859233 1:33522311-33522333 TCCAGAGGGCCAGGAACAGCTGG - Intronic
904918914 1:33991214-33991236 CCCAGCTGGCATGGAACTCCTGG + Intronic
905117260 1:35653144-35653166 TCCGGCTGGTCTGGAACTCCTGG + Intergenic
905237716 1:36561582-36561604 TTCACGTGGCCAGGAAATGCTGG - Intergenic
906129663 1:43448477-43448499 CCCAGCTGGTAAGGAACTGTGGG + Exonic
907424998 1:54373986-54374008 TCCTGCTGGACAGGAAAGGCAGG + Intronic
907515765 1:54992371-54992393 CCCAGCTGGCCAGGACATCCTGG + Intergenic
907559486 1:55375584-55375606 TCCAGCGAGCCTGGCACTGCTGG + Intergenic
908251169 1:62267126-62267148 CCCAGCATGCCAGGAAATGCAGG - Intronic
908747129 1:67386467-67386489 CACAGCTGCCCAGGAACTGTGGG + Intronic
910328293 1:86037435-86037457 TCCATGTGGCCAGAAACTGTGGG + Intronic
910745682 1:90571721-90571743 TCAAGCTGGTCTTGAACTGCTGG - Intergenic
912998159 1:114552407-114552429 TCCATGTGGCAAGGAACTGAGGG - Intergenic
914348689 1:146821412-146821434 TCCAACTGGCCAGGTACATCCGG - Intergenic
914720855 1:150287686-150287708 TCCAGCTGGCCCAGACTTGCAGG + Intergenic
914913779 1:151805902-151805924 TCCACCTGGGGAGAAACTGCAGG + Exonic
915085637 1:153386798-153386820 TCCAGATGGCCAGTGACAGCTGG + Intergenic
915155199 1:153869914-153869936 TCCAGCTGGTCTTGAACTCCTGG - Intronic
915398571 1:155605590-155605612 TCAAGCTGGTCACGAACTCCAGG - Intergenic
916232561 1:162554828-162554850 TCCGGCTGGCCACGAACTCCTGG - Intergenic
916726693 1:167529864-167529886 GCCACCTGGCAAGGAACTGCAGG - Intronic
918076285 1:181173797-181173819 TGCAGCTGTCCTGGAACTGTGGG + Intergenic
918118401 1:181516612-181516634 TCCAGCAGCACAGGAACAGCTGG - Intronic
918849831 1:189672782-189672804 CCCAGCTGGCCTCGAACTCCTGG + Intergenic
919777275 1:201202465-201202487 GCCAGTGGGCCAGGAACTGAGGG - Intronic
920122203 1:203667159-203667181 TCCAGCTGGTCTCGAACTCCTGG + Intronic
921011380 1:211145269-211145291 TCCAGATGGCAAGGAACTGAAGG - Intergenic
921079739 1:211729479-211729501 CCCACATGGCCAGGAACTGAGGG - Intergenic
922204439 1:223434233-223434255 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
922229215 1:223671182-223671204 TCAGGCTGGTCTGGAACTGCTGG - Intergenic
922938900 1:229443948-229443970 TCCAGCTGGTCTTGAACTACTGG + Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924628636 1:245716347-245716369 TGCACCTGGCAAGGCACTGCTGG + Intergenic
1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1063104287 10:2979400-2979422 GGAAGCTGGCCAGGAACTACTGG - Intergenic
1064085665 10:12344722-12344744 TCCAGCTAGCCTGGAAGTCCAGG - Intergenic
1064229493 10:13517541-13517563 CCCAGCTGGTCTTGAACTGCTGG - Intronic
1064321911 10:14313141-14313163 CCAAGCTGGTCAGGAACTCCTGG - Intronic
1065836717 10:29665028-29665050 TCCAGCTGGTCTTGAACTCCTGG - Intronic
1066216848 10:33296538-33296560 TCCAGCTGAGCAGTTACTGCTGG - Intronic
1066659914 10:37728673-37728695 TCCAGCTAGACAGGAACCCCCGG - Intergenic
1067070011 10:43124371-43124393 TCCAGCTGGCCACCAGCTGGGGG - Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1068669530 10:59709580-59709602 CCCGGCTGGCCCGGAGCTGCAGG - Exonic
1069719216 10:70539224-70539246 TCCAGCTGGTCAGGAGCCACAGG - Exonic
1071715528 10:88091586-88091608 GCCAGCTACCCAGGAAATGCAGG + Intergenic
1071996385 10:91153522-91153544 TCCAGCTGGCCAGGATGTTGGGG + Intergenic
1075488844 10:122848870-122848892 TCCAGCTGGACAAGATCAGCTGG + Intronic
1075673265 10:124278644-124278666 TCCACATGGCAAGGAACTGAAGG - Intergenic
1075976479 10:126700539-126700561 TCCATGTGGCAAGGAACTGAGGG + Intergenic
1076305387 10:129462504-129462526 TCCAGTTGTCCAGTAACTGGTGG - Intergenic
1076424883 10:130360876-130360898 TCCTGCTGGGCAGCAGCTGCGGG - Intergenic
1076623165 10:131806012-131806034 TCCTGTTGCTCAGGAACTGCTGG - Intergenic
1076747275 10:132520592-132520614 TCCGGCTGCTCAGGACCTGCTGG + Intergenic
1076804076 10:132846527-132846549 ACCTGCTGGCCTGCAACTGCTGG + Intronic
1077424456 11:2467792-2467814 TCCACCTGGCCTGGGTCTGCAGG - Intronic
1078076052 11:8161794-8161816 TAGAGCTGGCCTGGAACTCCTGG - Intronic
1080060319 11:27949869-27949891 TCCAGCTTGGCAGGGACAGCTGG + Intergenic
1080522883 11:33083001-33083023 GCCAGCTGGCCTCGAACTCCTGG + Intronic
1080617639 11:33958904-33958926 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
1080741382 11:35067571-35067593 TCTAGGTGGCCAGGAAATACAGG - Intergenic
1081106654 11:39078706-39078728 TGCAGCTGGCCAGCACCTGCTGG + Intergenic
1081237047 11:40658901-40658923 TGCAGCAGGGGAGGAACTGCTGG + Intronic
1081559869 11:44203741-44203763 GCCTGCTGGCCAGGCACTACTGG + Intronic
1082825798 11:57577585-57577607 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
1083717225 11:64584378-64584400 TGCAGCTGGCAATGAACTCCTGG + Intergenic
1083868025 11:65468975-65468997 TGCAGGTGGACAGGCACTGCAGG - Intergenic
1084443105 11:69187218-69187240 TACAGCTGCCCAGGATCTGCGGG + Intergenic
1084693596 11:70740894-70740916 ACCACCTGGCCAGGGGCTGCAGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1085280823 11:75329311-75329333 TCAGGCTGGCCTGGAACTCCTGG + Intronic
1085707827 11:78802435-78802457 CCCTGCTGTGCAGGAACTGCTGG - Intronic
1087068815 11:94054555-94054577 TTCATCTGTGCAGGAACTGCTGG + Intronic
1088240238 11:107766555-107766577 TCCAGTTGGTCATGAACTCCCGG - Intergenic
1088894500 11:114067614-114067636 TCAGGCTGGCCTGGAACTCCTGG + Intronic
1088928847 11:114328749-114328771 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1089115428 11:116091249-116091271 GCCAGCTGGCCAATATCTGCAGG + Intergenic
1089979320 11:122759242-122759264 GCCACGTGGCAAGGAACTGCAGG - Intronic
1091377404 12:34128-34150 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1092162740 12:6324817-6324839 TCCAGGTGCCCAGGAGTTGCTGG + Intronic
1092240899 12:6836014-6836036 TCAGGCTGGCCTGGAACTCCTGG - Intronic
1092866812 12:12769016-12769038 TCCAGCTGGTCTTGAACTCCTGG - Intronic
1092926167 12:13274494-13274516 TGCAGCTGGCCAGGATCCCCTGG + Intergenic
1094469471 12:30790268-30790290 TCCATGTGGCAAGGAACTGAGGG + Intergenic
1094500670 12:31018265-31018287 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1095726314 12:45456769-45456791 TCCAGCTAGCCACCAACTTCTGG + Intergenic
1096483481 12:51959369-51959391 GCCACATGGCAAGGAACTGCAGG + Intronic
1096510074 12:52122810-52122832 TCCAGCTTCCCAGGAGCTCCAGG + Intergenic
1096695907 12:53348156-53348178 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1096800159 12:54105277-54105299 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1096814457 12:54193103-54193125 TCAAGCTGGTCTTGAACTGCTGG + Intergenic
1097088044 12:56483653-56483675 TCAAGCTGGCCTTGAACTCCTGG + Intronic
1097960996 12:65531834-65531856 TAGAGCTGGTCAGGAACAGCTGG - Intergenic
1098101608 12:67023785-67023807 TCCAGCGGACCAGGAACTAGAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099460557 12:82915982-82916004 TCAAGCTGGTCTGGAACTTCTGG - Intronic
1100958685 12:99938202-99938224 GCCATATGGCCAGGAACTGCAGG + Intronic
1101695836 12:107125455-107125477 ACCAGCTGGCCTTGAACTACTGG - Intergenic
1101919402 12:108920034-108920056 GCCAGTTGGCAAGGAACTGAAGG + Intronic
1102243675 12:111341712-111341734 TCCTGCTGGCCAGGAACTTTTGG + Intronic
1102360937 12:112286966-112286988 TGCAGTTTGCCTGGAACTGCAGG + Intronic
1102376504 12:112426033-112426055 TCAAGCTGGCCAGTAATTTCAGG - Intronic
1103065524 12:117894453-117894475 CCAGGCTGGCCAGGAACTCCTGG - Intronic
1104537308 12:129630124-129630146 CCCAGCTGGCCTGGAACCCCTGG + Intronic
1104659923 12:130604045-130604067 TCCAGCAGGACAGGACATGCAGG + Intronic
1105274425 13:18906330-18906352 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1105299037 13:19116976-19116998 TGCAGCTGGCCACAAATTGCTGG + Intergenic
1105515975 13:21091047-21091069 CCCAGCTGGTCTGGAACTCCTGG + Intergenic
1106158636 13:27180780-27180802 CCCAGCTGGTCTGGAACTCCTGG - Intergenic
1106269708 13:28140589-28140611 CCAAGCTGGCCTGGAACTCCTGG + Intronic
1108802141 13:54111733-54111755 TCAAGCTGGTCTGGAACTCCTGG - Intergenic
1109229661 13:59741545-59741567 GCCAGCTGGTCATGAACTCCTGG - Intronic
1110436676 13:75483643-75483665 TCCAGCAGGCCAGTTACTACTGG + Intergenic
1113812325 13:113150195-113150217 TGAAGCTGGCCAGGAGCTTCTGG + Intergenic
1114051345 14:18921406-18921428 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1114111217 14:19480519-19480541 TGCAGCTGGCCAGAAATTGCTGG + Intergenic
1114927017 14:27415455-27415477 TCAGGCTGGCCTTGAACTGCTGG + Intergenic
1115957985 14:38803083-38803105 TCCAGACGGGCAAGAACTGCAGG + Intergenic
1115987295 14:39115241-39115263 GCCAGCTGGTCTGGAACTCCTGG + Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116824132 14:49655409-49655431 TCCAGCTGGTCTTGAACTTCAGG + Intronic
1118477003 14:66126988-66127010 CCCAGTTGGCCTTGAACTGCTGG + Intergenic
1119117046 14:72033442-72033464 CCCAGCTGGTCTGGAACTCCTGG + Intronic
1119310545 14:73642829-73642851 TCAAGCTGGTCTGGAACTCCCGG + Intergenic
1120364566 14:83548888-83548910 ACCACATGGCAAGGAACTGCAGG - Intergenic
1121770074 14:96526543-96526565 TCCAGCTGGTCTCGAACTCCTGG + Intronic
1122554821 14:102572572-102572594 TCCTGCTGGTCTGGAACTCCTGG + Intergenic
1122717091 14:103702318-103702340 TCCACCTGGCCAAGGCCTGCTGG - Intronic
1122855603 14:104558678-104558700 GCCATCTGGCCTGGAGCTGCTGG - Intronic
1122929548 14:104927066-104927088 CCCAGCTGCCCAGGCACTGAGGG + Intronic
1123538306 15:21261509-21261531 TCCAGCTGACCAGGAATTGCTGG + Intergenic
1124073688 15:26421212-26421234 ACCAGGTGGCCAGGAAGTGCTGG - Intergenic
1124338037 15:28871954-28871976 TCCATCAGGCCAGAAACTTCTGG + Intergenic
1125280728 15:38040050-38040072 TCCATGTGGCAAGGAACTGCAGG - Intergenic
1126138048 15:45411525-45411547 TCAAGCTGGCCTTGAACTCCTGG + Intronic
1126876013 15:53042089-53042111 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1128434263 15:67630026-67630048 TCAGGCTGGCCTGGAACTGCTGG - Intronic
1128561685 15:68672834-68672856 ACCAAGTGGCCAGGGACTGCAGG + Intronic
1129233915 15:74212412-74212434 TCCAGCTGAGCAGGAGCTGGAGG - Intergenic
1129706849 15:77799294-77799316 GCCAGAAGGCCAGGGACTGCAGG + Intronic
1129885161 15:79032224-79032246 TGCAGTGGGCCAGGATCTGCAGG + Exonic
1130152951 15:81324944-81324966 TCCAGCTGCCCTGGAGCTGCGGG + Intergenic
1131424659 15:92335633-92335655 TCCAGCTGGTCTCGAACTCCTGG + Intergenic
1132251723 15:100340304-100340326 TGCAACAGGCCAGGAACTTCGGG + Intronic
1132313779 15:100876476-100876498 TGCAGCTGGCCAGAGGCTGCGGG + Intergenic
1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
1132677209 16:1125767-1125789 TCCAGCTGGCCAGGCTCTGAGGG + Intergenic
1132818882 16:1851217-1851239 TCCTGCTGGCCTTGAACTCCTGG + Intronic
1133805723 16:9124797-9124819 CCCACCTGGCCAGGAGCTACTGG + Intergenic
1136620089 16:31422898-31422920 CCCAGCTGGTCTGGAACTCCTGG + Intronic
1137664335 16:50240449-50240471 CACAGCTGGCCAGAAACTCCAGG - Intergenic
1138238239 16:55403834-55403856 TGCAGCTCTCCTGGAACTGCTGG - Intronic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1139294657 16:65889804-65889826 TGCAGCTGGGAAGGAGCTGCAGG + Intergenic
1139347792 16:66315509-66315531 TCCAGCCAGCCAGGACCTCCGGG + Intergenic
1139908698 16:70383339-70383361 TCCGGCTGGCCTCGAACTCCTGG - Intronic
1139985347 16:70894136-70894158 TCCAACTGGCCAGGTACATCCGG + Intronic
1140193513 16:72838005-72838027 TCAAGCTGTCCAGAAACTCCAGG - Intronic
1140585744 16:76289778-76289800 TCAAGCTGGTCTTGAACTGCTGG + Intronic
1140831149 16:78752831-78752853 CCTAGCTGGCCAGGAATTCCAGG + Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1141668156 16:85476820-85476842 CCCAGCTGGCCTTGAACTCCTGG + Intergenic
1141756843 16:85997002-85997024 TGCAGGAGGCCAGGGACTGCAGG - Intergenic
1142286160 16:89172336-89172358 CCCTGCTGGCCAGGAACTTGGGG - Intronic
1143112080 17:4558533-4558555 CTCAGCTGGCCCAGAACTGCTGG - Exonic
1143147370 17:4785511-4785533 TTCAGACGGCGAGGAACTGCAGG - Exonic
1143459765 17:7094769-7094791 TTCATCTGGGCAGGAACTGGTGG - Intergenic
1144004919 17:11091099-11091121 TCTAGGTGCCCAGGAACTTCAGG - Intergenic
1144126052 17:12204016-12204038 CCCAGCTGGTCTTGAACTGCTGG + Intergenic
1144626222 17:16845679-16845701 TCCTGCAGGCCGGGATCTGCTGG - Intergenic
1144696860 17:17310332-17310354 CCCAGCTGGTCTTGAACTGCTGG - Intronic
1144829058 17:18121621-18121643 TCCCCCTGGCCAGGAGGTGCAGG + Exonic
1144838465 17:18171044-18171066 TCCAGCTGGTCAGGATGGGCTGG + Intronic
1144880211 17:18427041-18427063 TCCTGCAGGCCGGGATCTGCTGG + Intergenic
1145152024 17:20517343-20517365 TCCTGCAGGCCGGGATCTGCTGG - Intergenic
1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG + Intronic
1145298680 17:21614160-21614182 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145723168 17:27090896-27090918 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1146009092 17:29179970-29179992 CCCAGGTGGCCCGGAGCTGCGGG - Intronic
1147016301 17:37494419-37494441 TCAGGCTGGCCTTGAACTGCTGG + Intronic
1147677734 17:42219347-42219369 AGCAGCTGGCCGGGAACGGCGGG - Exonic
1147688302 17:42300224-42300246 AGCAGCTGGCCGGGAACGGCGGG + Exonic
1147930494 17:43977538-43977560 TGCACCTGCCAAGGAACTGCAGG - Intronic
1148549809 17:48543730-48543752 TGCAGATGGCCTGGGACTGCCGG - Exonic
1148903581 17:50897043-50897065 CCCAGCTGGGCACGAACTCCTGG - Intergenic
1149836490 17:59917645-59917667 CCCGGCTGGCCTGGAACTCCTGG + Intronic
1150025382 17:61668780-61668802 TCCAGCTGGTCTGGAACTACTGG + Intergenic
1150129188 17:62657790-62657812 TCAGGCTGGGCTGGAACTGCTGG - Intronic
1150422825 17:65054518-65054540 CCCAGCTGGTCTGGAACTCCTGG + Intronic
1150483768 17:65530470-65530492 TCCTGCTGCAAAGGAACTGCAGG - Intronic
1150558356 17:66274010-66274032 TCCAGCTGGTCTAGAACTCCTGG - Intergenic
1150679613 17:67274252-67274274 TCCAGCTGGTCTGAAACTCCTGG + Intergenic
1150786717 17:68169430-68169452 TCCAGCTGCACAGGAACTTACGG + Intergenic
1151017880 17:70577758-70577780 TCCAGCTGAACAGGAGTTGCTGG + Intergenic
1151731096 17:75911718-75911740 CCAAGCTGGCCACGAACTCCTGG + Intronic
1152227251 17:79098162-79098184 TCCAGGTGGCCAGAGGCTGCAGG + Intronic
1152301314 17:79496597-79496619 TCAAGGTGGCCAGGGACCGCTGG - Intronic
1152638517 17:81439945-81439967 TCCTGCAGGCGAGGAAGTGCAGG - Intronic
1152868304 17:82737018-82737040 TGCACCAGGCCAGGAACTCCCGG - Intronic
1152930911 17:83109460-83109482 GCCACCTGGCCAAGAACTGTCGG - Intergenic
1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1154302506 18:13206836-13206858 TCCAGCTGCCCAGGAATTCCAGG - Intergenic
1154466114 18:14643585-14643607 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1155007726 18:21742989-21743011 TCCGGCTGGTCTGGAACTCCTGG + Intronic
1155028902 18:21967143-21967165 TCCAGCTGGCCTTGAAATCCTGG - Intergenic
1155082947 18:22428779-22428801 TCCAGCTGGCCAGGCAGTGTGGG + Intergenic
1155494441 18:26428955-26428977 CCCAGCTGGCCTTGAACTCCTGG + Intergenic
1156128044 18:33931969-33931991 TCCAGATGGTAAGAAACTGCTGG - Intronic
1157298870 18:46465432-46465454 CCCTGCTGGACAGGGACTGCTGG - Intergenic
1157390304 18:47296566-47296588 TCCTGGTGGCCAGGCCCTGCAGG + Intergenic
1158180954 18:54714388-54714410 CCCATCAGGTCAGGAACTGCTGG - Intergenic
1160020397 18:75176105-75176127 GCCAGCTGGTCACGAACTCCTGG + Intergenic
1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG + Intronic
1160261635 18:77299593-77299615 CTCAGCTGGTCAGGAACTGTGGG + Intergenic
1160635732 19:73686-73708 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1160659023 19:289841-289863 TCCACCCGGCCGGCAACTGCAGG - Intronic
1161144190 19:2667567-2667589 TCCAGCTGGTCTTGAACTCCTGG - Intronic
1161871840 19:6876403-6876425 TCAAGCTGGCCTTGAACTCCTGG + Intergenic
1161975247 19:7604904-7604926 TCCAGCTGGCCTGGTATTGGGGG + Intronic
1162943836 19:14030832-14030854 CCCAGCTGGCAAGGAACCCCTGG + Exonic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166903010 19:46080899-46080921 TCCACCTGGACAGGAAGTGATGG - Intergenic
1167083904 19:47296079-47296101 TCAAGCTGGTCTTGAACTGCTGG - Intronic
1167394839 19:49221626-49221648 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
1167597335 19:50434755-50434777 CCCAGCCGGCAAGGAACAGCAGG + Intronic
1167750113 19:51374339-51374361 GCCAGCTGTCCTGGGACTGCTGG - Intergenic
1168081698 19:54014840-54014862 CCCAGGTGCCCAGGCACTGCGGG - Intergenic
925158648 2:1665954-1665976 TCCTGCTGGCCAGGTGCTGGAGG + Intronic
926001200 2:9334256-9334278 GCCAGCTGGTCTGGAACTCCTGG + Intronic
926128850 2:10287864-10287886 GCCACCTGGCCAGGAACTGCGGG - Intergenic
927202602 2:20587808-20587830 TCCAAGTGGCCAGGAGCTGTGGG + Intronic
927893347 2:26765955-26765977 TCCAGATTGCCAGTTACTGCTGG + Intronic
928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
928984319 2:37166234-37166256 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929302559 2:40322446-40322468 CCCAGCTGGCCTTGAACTCCTGG - Intronic
931837003 2:66109521-66109543 CCCAGCTGCCCAGCAACAGCTGG - Intergenic
932460810 2:71880814-71880836 ACCAGCTGCCCAGCTACTGCTGG + Intergenic
933465147 2:82641933-82641955 TCTAGCTGGCCAGCAGCAGCAGG + Intergenic
933899751 2:86840977-86840999 TTGAGCTGGCCAGGAAAAGCAGG + Intronic
934564677 2:95331746-95331768 TCCAGCTGGCCAGTCACGACAGG + Intronic
934853074 2:97713424-97713446 TGCAGCTGGGCAGGCAGTGCTGG + Intergenic
934947193 2:98550437-98550459 TGGCCCTGGCCAGGAACTGCTGG - Intronic
936562109 2:113549060-113549082 TCCAGTTGGCCATGAAAAGCTGG + Intergenic
936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
937092450 2:119215600-119215622 CCCAGCTGGCCTGTAACTCCCGG + Intergenic
937955516 2:127419963-127419985 CCCAGGTGGCCACGAACAGCAGG - Exonic
937973933 2:127569831-127569853 TGATGGTGGCCAGGAACTGCAGG - Exonic
938287115 2:130128053-130128075 TGCAACTGGCCAGAAATTGCTGG + Intronic
938312529 2:130302305-130302327 TCCTGCTGGACAGAAATTGCTGG - Intergenic
938428478 2:131210817-131210839 TGCAACTGGCCAGAAATTGCTGG - Intronic
938469380 2:131544835-131544857 TGCAACTGGCCAGAAATTGCTGG - Intergenic
938768876 2:134482925-134482947 GCCAGCCGGCCAGAAAATGCCGG - Intronic
940678297 2:156752301-156752323 TACATCTGCCCAGCAACTGCTGG + Intergenic
941153418 2:161943261-161943283 TCCAGCTGTTCCGGATCTGCTGG + Intronic
942112463 2:172695722-172695744 GACAGGTGGCAAGGAACTGCAGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942326236 2:174779133-174779155 TCTAGCTGGCTGGGGACTGCAGG - Intergenic
944660540 2:201917993-201918015 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
944840950 2:203623205-203623227 TCCAACTGGCAAGAAACTTCAGG + Intergenic
945337396 2:208608809-208608831 CCCACATGGCAAGGAACTGCTGG + Intronic
947098357 2:226592076-226592098 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948226097 2:236310339-236310361 TCCAGTTGGGGAGGAACTTCTGG - Intergenic
948850758 2:240704263-240704285 TCTGGCTGGACAGGACCTGCTGG - Intergenic
1168802524 20:652708-652730 TGCAGTGGTCCAGGAACTGCAGG - Intronic
1168999388 20:2156117-2156139 TGGAGCTGGCCTGGAGCTGCTGG - Intronic
1169534961 20:6528073-6528095 CCAGGCTGGCCAGGAACTCCTGG - Intergenic
1170103566 20:12728816-12728838 TCCAGGTGGCAAGGAGCTGAGGG - Intergenic
1170736981 20:19021196-19021218 GGCAGCTGGCCAGGGACTGCAGG - Intergenic
1171561901 20:26134415-26134437 TCCAGCTGGCCAACAATTGCTGG + Intergenic
1171722443 20:28577776-28577798 TCCGGCTGGTCTGGAACTCCTGG + Intergenic
1171774738 20:29354906-29354928 TCCAGCTGGCCAGTGGCAGCAGG + Intergenic
1171816743 20:29792534-29792556 TCCAGCTGGCCAGTGGCAGCAGG + Intergenic
1171851946 20:30315103-30315125 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1171860926 20:30402174-30402196 TCAGGCTGGCCTGGAACTCCTGG - Intergenic
1171901601 20:30863443-30863465 TCCAGCTGGCCAGCGGCAGCAGG - Intergenic
1172706777 20:36887847-36887869 TCCACCAGCCCAGGAATTGCAGG + Intronic
1173762464 20:45575683-45575705 TACAGATGGCCAGGAGCTGGGGG + Intronic
1174895796 20:54448805-54448827 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1175891178 20:62316719-62316741 TGCTGTTGGCCAGGAGCTGCTGG + Exonic
1176111299 20:63411943-63411965 AGGAGCTGGCCAGGAACTGGCGG + Intronic
1176649410 21:9531219-9531241 TACACCTGGCCAGGAATTGCTGG - Intergenic
1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG + Intergenic
1179084554 21:38206012-38206034 TCCAGCTGCTCTGGAGCTGCTGG - Intronic
1179346272 21:40560378-40560400 TAGAGCTGGCCAGGAATTTCCGG - Intronic
1180086888 21:45511742-45511764 AGCAGATGGCCAGGCACTGCTGG - Intronic
1180295993 22:10936460-10936482 TCCGGCTGGTCTGGAACTCCTGG + Intergenic
1180412680 22:12629549-12629571 TCCAGCTAGTCTGGAACTCCTGG - Intergenic
1180469818 22:15643781-15643803 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1180589749 22:16927075-16927097 TCCAGCTGGCCAGGAAAAATTGG + Intergenic
1180655452 22:17416709-17416731 CCGAGCTGGTCTGGAACTGCTGG + Intronic
1181095129 22:20499719-20499741 CCAAGCTGGTCAGGAACTCCTGG + Intronic
1181137094 22:20775697-20775719 TCCAGCTGGTCTTGAACTCCTGG + Intronic
1181161160 22:20960691-20960713 TCCAGCTTGCCATGAAGTTCTGG - Intergenic
1181310792 22:21943732-21943754 TCCCCCTGCCCAGGAACTGAAGG + Intronic
1181610154 22:24006631-24006653 TCCAGCTGTGCAGCATCTGCAGG + Intergenic
1181641210 22:24200008-24200030 TCAGGCTGGTCAGGAACTGCTGG + Intergenic
1182264298 22:29101040-29101062 CCAAGCTGGCCTGGAACTCCTGG - Intronic
1182324282 22:29500314-29500336 CCAAGCTGGTCAGGAACTCCTGG - Intergenic
1182372549 22:29821783-29821805 TCCAGCTGGTCTTGAACTCCTGG - Intronic
1182561747 22:31165125-31165147 TCAAGCTGGTCTGGAACTCCCGG + Intronic
1182956042 22:34427535-34427557 TCCAGCTGGACAGGATCACCTGG + Intergenic
1183321642 22:37168619-37168641 TCCTGCATGCCAGGAACTGTGGG - Intronic
1184316750 22:43699280-43699302 CCCAGCAGGGCAGGAACTGAGGG - Intronic
1184462141 22:44645144-44645166 TCCAGGTGGCCAGGAATTTTTGG + Intergenic
1184587027 22:45454812-45454834 TCCAGGTGGCCAGCAATGGCTGG - Intergenic
1184798058 22:46743194-46743216 TCCCGCTAGCCAGGGACTGGAGG + Intergenic
949263048 3:2124550-2124572 TCCAGCTGGTCTTGAACTCCTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
949971732 3:9412935-9412957 CCCAGCTGGCCTTGAACTCCTGG + Intronic
950562975 3:13746488-13746510 AACTTCTGGCCAGGAACTGCCGG + Intergenic
951554376 3:23905947-23905969 TCCAGCTGGTCTTGAACTCCTGG - Intronic
952031550 3:29148638-29148660 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
952962169 3:38599098-38599120 TCCAGCAGGACAGGAGCTGGGGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953566719 3:44038322-44038344 TCCTGCAAGGCAGGAACTGCTGG + Intergenic
953736579 3:45499082-45499104 TCCAGCTGGTCTTGAACTCCTGG - Intronic
953741384 3:45541984-45542006 ACCAGCAGGGCAGGGACTGCTGG - Intronic
953851898 3:46471025-46471047 TCTCACTGACCAGGAACTGCTGG - Intronic
954072773 3:48155085-48155107 TCAGGCTGGTCAAGAACTGCTGG + Intergenic
954248831 3:49352864-49352886 TCCAGCTGCCCCGAGACTGCAGG + Intergenic
954296449 3:49677012-49677034 TCCAGCTCACCAGGCACAGCTGG - Exonic
955749891 3:62177052-62177074 CCAAGCTGGTCAGGAACTGCTGG - Intronic
956386514 3:68725265-68725287 TCCAGCTGGCCAGCAGTGGCAGG - Intergenic
956834712 3:73087279-73087301 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
957074055 3:75587830-75587852 TCCAGCTGGCAGGGAAGCGCCGG - Intergenic
958524795 3:95241700-95241722 GCCACCTGGCATGGAACTGCTGG - Intergenic
958534570 3:95382340-95382362 TGGAGATGGCCAGGAACTGAGGG - Intergenic
959578424 3:107960181-107960203 TACAGCTGTCCCGGAACTGGAGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960611844 3:119561751-119561773 GCCAGCTGGCCTCGAACTCCTGG - Intergenic
961249371 3:125486839-125486861 TCAGGCTGGTCTGGAACTGCTGG - Intronic
961523244 3:127480403-127480425 TCCAGGGGGCCAGGTGCTGCAGG - Intergenic
962448523 3:135491746-135491768 TCCACATGGCAAGGAACTGAGGG - Intergenic
962792394 3:138823210-138823232 CCCAGCTGGCCTGTAACTCCTGG - Intronic
962855719 3:139343032-139343054 TCCAGCTATCCAGGATGTGCAGG - Intronic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
964468921 3:157030838-157030860 TCCATGTGGCAAGGAACTGAGGG - Intronic
964802260 3:160568934-160568956 TCAAGCTGGCCTGGAAATGGAGG + Intergenic
965435474 3:168645329-168645351 TCAAGCTGGCCAGAAGCTGGAGG + Intergenic
967886459 3:194336838-194336860 TCCCGGTGGCCAGGAGCTCCTGG - Intergenic
968359052 3:198133803-198133825 TCCAGCTGGCCAGCGGCAGCAGG - Intergenic
968476389 4:811353-811375 CCAAGCTGGCCTGGAACTCCTGG + Intronic
968605330 4:1532604-1532626 TCCAGCCTGCCAGGAAATCCAGG + Intergenic
969582657 4:8074242-8074264 CCCAGCTGGCCTGGAACTCTTGG - Intronic
969663848 4:8545633-8545655 CCCAGGTGGCCAGGACTTGCTGG + Intergenic
970493722 4:16604060-16604082 TCCAGCTGGTCTTGAACTCCTGG + Intronic
970568600 4:17357072-17357094 CCCACATGGCAAGGAACTGCAGG + Intergenic
971436042 4:26625151-26625173 TGTAGCTTGCCAGAAACTGCAGG - Intronic
971938589 4:33186614-33186636 CCCAGCTGGACATGAACTTCTGG - Intergenic
972337463 4:38120240-38120262 TCCAGCTGGCCAAGGGCTCCTGG + Intronic
972454750 4:39242611-39242633 TCCAGCTGGTCTTGAACTCCTGG - Intronic
973911270 4:55583176-55583198 TCCAGCTGGTCTTGAACTCCTGG + Intronic
974033140 4:56794250-56794272 TCAGGCTGGCCATGAACTCCTGG - Intergenic
974492493 4:62585210-62585232 TCCAGCTGGTTTGGAACTCCTGG - Intergenic
975151551 4:71028380-71028402 CCAAGCTGGTCAGGAACTCCTGG - Intronic
977464495 4:97366728-97366750 TCCACATGGCAAAGAACTGCTGG + Intronic
978386197 4:108177742-108177764 TCTACCTGGCCAGGAGCTTCTGG - Intergenic
979399914 4:120236773-120236795 GCCACGTAGCCAGGAACTGCTGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982455832 4:155608620-155608642 TCCACCTGGCAAGGAACTGTGGG + Intergenic
983012786 4:162568947-162568969 TCCAGCTACTCAGGAACTACAGG - Intergenic
983517816 4:168675843-168675865 TCCAGCTGGTCTTGAACTTCTGG - Intronic
984551312 4:181162846-181162868 TCCAGATGGCCAGGGACTAGAGG - Intergenic
984670019 4:182472930-182472952 TCAGGCTGGTCTGGAACTGCTGG + Intronic
984730732 4:183065802-183065824 TCAAGCTGGTCTGGAACTCCTGG - Intergenic
984968455 4:185164310-185164332 TCAGGCTGGCCTGGAACTCCTGG + Intronic
985703042 5:1385128-1385150 TCCAGCCGGCCACGCCCTGCAGG - Intergenic
985961533 5:3306640-3306662 TGCAGATGCCCAGGAACTGCGGG - Intergenic
986268860 5:6214178-6214200 TCCAGCTCATCATGAACTGCAGG - Intergenic
986364775 5:7019384-7019406 GCCAGCAGGCCACGAACTGGTGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987203683 5:15603047-15603069 TCCAGCTGGTCTTGAACTCCTGG + Intronic
987429978 5:17820913-17820935 TCCATCTGACAAGGTACTGCAGG + Intergenic
988338587 5:29938733-29938755 TCCACATGGCAAGAAACTGCAGG + Intergenic
988983218 5:36592468-36592490 TCAGGCTGGCCTGGAACTCCTGG - Intergenic
989086982 5:37686092-37686114 CCCAGCTGGTCATGAACTCCTGG - Intronic
989087037 5:37686516-37686538 CCCAGCTGGTCATGAACTCCTGG - Intronic
990230967 5:53712578-53712600 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
990353028 5:54937861-54937883 ACCTGCTGACCAGGAACTTCTGG - Intergenic
991222103 5:64228302-64228324 TCCAGCTGGCCTTGAACTCCTGG - Intronic
991431243 5:66549706-66549728 ACCAGATGGCAAGGAACTGAGGG + Intergenic
991916701 5:71612789-71612811 TCCAGCTGGTCTTGAACTCCTGG + Intronic
992743951 5:79801062-79801084 TCCATCTTGCCAGCAACTGCTGG - Intergenic
993505381 5:88702582-88702604 TCCTGCTGTTCAGGCACTGCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994174496 5:96696637-96696659 TCAAGCTGGTCATGAACTCCTGG - Intronic
995261786 5:110112842-110112864 ACCACATGGCCAGGAACTGCAGG - Intergenic
995468986 5:112480308-112480330 TCCTCCTGGACAGGAACAGCAGG + Intergenic
998989949 5:147804558-147804580 TGCAGCTGAGCAGGAAATGCAGG + Intergenic
999403574 5:151286499-151286521 TCCAGCTGGTCTTGAACTCCTGG + Intronic
1001403489 5:171460320-171460342 TCCAGCTGGGTAGGAACCCCAGG + Intergenic
1001549265 5:172590860-172590882 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
1001755446 5:174165100-174165122 TCCAGCTTGCCAGGGACTGAGGG + Intronic
1001833152 5:174806433-174806455 CCAGGCTGGCCAGGAACTCCTGG + Intergenic
1002801215 6:522864-522886 TACAGATGACCAGGAACGGCTGG + Intronic
1004037611 6:11938926-11938948 TCCAGCTAGGGAGCAACTGCTGG + Intergenic
1004502500 6:16221644-16221666 CCCAGCTGGTCACGAACTGCTGG + Intergenic
1004783990 6:18945256-18945278 CCCGGCTGGTCTGGAACTGCTGG - Intergenic
1004983435 6:21052580-21052602 TCAGGCTGGCCATGAACTCCTGG + Intronic
1005403421 6:25459459-25459481 CCCAGCTGGTCATGAACTCCTGG + Intronic
1005987826 6:30885055-30885077 TCCACCTGGCCAGTCCCTGCGGG + Intronic
1006929810 6:37680918-37680940 TCCAGCTGAGCAGGGCCTGCTGG + Intronic
1007067915 6:39011329-39011351 CACAGGAGGCCAGGAACTGCAGG - Intronic
1007546617 6:42699271-42699293 GCCAGCTGGCCTCGAACTCCTGG + Intronic
1007594144 6:43041024-43041046 TCCGGCTGCCCTGGATCTGCTGG + Exonic
1008162800 6:48099261-48099283 TCCAGCACGCTAGCAACTGCTGG - Intergenic
1008298398 6:49805381-49805403 TCCAGCTGGCCAGAGGCAGCAGG + Intergenic
1008894339 6:56535208-56535230 TCCAGCTGAGCAGGGACTCCAGG + Exonic
1009346885 6:62624445-62624467 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1011632251 6:89339213-89339235 TCAAGCTGGCCTTGAACTCCTGG - Intronic
1012666405 6:101976485-101976507 CCCAGCTGGTCTCGAACTGCTGG - Intronic
1013117440 6:107114348-107114370 TCCCGCTGCCCAGGAGCTGGAGG - Exonic
1013458145 6:110350714-110350736 TCAGGCTGGCCTTGAACTGCTGG - Intronic
1013548119 6:111180332-111180354 TCAAGCTGGTCTTGAACTGCTGG - Intronic
1014743400 6:125171554-125171576 CCCACATGGCCAGGAACTGTGGG + Intronic
1015873702 6:137801868-137801890 GCCACATGCCCAGGAACTGCCGG - Intergenic
1018042338 6:159936009-159936031 CCCATATGGCAAGGAACTGCAGG - Intergenic
1018785166 6:167102613-167102635 GCCTGCTGGCCTGGAAGTGCTGG - Intergenic
1018869563 6:167770619-167770641 TCGAGCTGGGCAGGAACAGGAGG - Intergenic
1020104661 7:5416780-5416802 TCCAGCTGGTCTCGAACTCCTGG - Intronic
1020120629 7:5501224-5501246 TCAAGCTGGCCAGGCTCCGCAGG + Exonic
1021111039 7:16694926-16694948 TCCTGGTGCCCAGGGACTGCTGG - Exonic
1021847293 7:24775492-24775514 TCAAGCTTGCAAGGAGCTGCTGG + Intergenic
1022488993 7:30802168-30802190 TTCTGGTAGCCAGGAACTGCTGG - Intronic
1023255902 7:38311703-38311725 TCGAACAGTCCAGGAACTGCCGG - Intergenic
1024576336 7:50767631-50767653 CCCTGCTGGCCAGGAGCCGCAGG - Intronic
1024609982 7:51055720-51055742 GCCGGCTGGCCAGGAACTCTGGG - Intronic
1024652846 7:51421630-51421652 TCCAGCTGGTCTCGAACTCCTGG + Intergenic
1025275970 7:57581278-57581300 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1026732757 7:72925577-72925599 TCCGGAGGGCCAGGACCTGCGGG + Intronic
1027057699 7:75061376-75061398 TCCAGGTGCCCAGGAGCGGCAGG - Intronic
1027270701 7:76516956-76516978 CCCAGCTGGTCTGGAACTCCTGG - Intergenic
1029290943 7:99501855-99501877 TCAGGCTGGCCTGGAACTCCTGG - Intronic
1029678582 7:102091542-102091564 CCCAGCTGGTCTTGAACTGCTGG + Intronic
1030364660 7:108631525-108631547 TCCATTTGTCCAGGAAATGCTGG - Intergenic
1031005615 7:116467747-116467769 CCCAGCTGGCCTTGAACTCCTGG + Intronic
1031582636 7:123495703-123495725 TCCACCTTACCAGGTACTGCTGG + Intronic
1032147273 7:129395470-129395492 TCCAGCTCTCCAGGAAGGGCAGG - Intronic
1032201203 7:129824510-129824532 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
1032913906 7:136465310-136465332 CCCACTTGGCCAGGAACTGTGGG + Intergenic
1033147866 7:138886484-138886506 CCCAGCTGATCTGGAACTGCAGG + Intronic
1033753545 7:144378886-144378908 AGCAGCAGGCCAGGCACTGCAGG + Intronic
1034560615 7:151877290-151877312 TCCAGCGGGCCAAGAAGGGCAGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035239115 7:157518444-157518466 TCCAGATGGTCAGAGACTGCTGG + Intergenic
1036628093 8:10488704-10488726 TCCAGCTTGCCAGGGATTGTAGG - Intergenic
1037690188 8:21175239-21175261 TCAAGCTGGTCATGAACTCCTGG + Intergenic
1038462502 8:27728812-27728834 CCCAGCTGGCCTCGAACTCCCGG - Intergenic
1038600606 8:28938655-28938677 TCCAGCTGGTCTTGAACTCCTGG + Intronic
1038662242 8:29507315-29507337 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1038745295 8:30249553-30249575 TACAGATGGGCAGCAACTGCGGG - Intergenic
1039550175 8:38437669-38437691 TACAGCTGGCCAGGAACAGAAGG + Intronic
1040387859 8:46925749-46925771 TCCGTGTGGCCAGGAACTGAGGG + Intergenic
1040507968 8:48068787-48068809 CCAAGCTGGTCTGGAACTGCTGG + Intergenic
1041793332 8:61720592-61720614 TGCAGCTGGAGAGGCACTGCAGG - Intergenic
1043040599 8:75258007-75258029 GCCAGATGGCCAGGAACTTAGGG + Intergenic
1043855058 8:85255471-85255493 TCAAGCTGGTCTGGAACTCCTGG + Intronic
1044702281 8:94975511-94975533 TCCAGGAGGCCAGCAGCTGCAGG - Intronic
1044827425 8:96211694-96211716 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
1044834631 8:96283724-96283746 CCCAGCTGCCCAGGAGCTCCAGG - Intronic
1044895126 8:96883605-96883627 TCTAGCTGGCCTGGAACCGCAGG + Intronic
1045001024 8:97878351-97878373 TCCAGCTGGCCGTGAGCTCCTGG - Intronic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1046877101 8:119267435-119267457 TCCAGCTGGGCATGATCAGCTGG + Intergenic
1047195333 8:122715833-122715855 CCCATGTGGCAAGGAACTGCAGG + Intergenic
1047324632 8:123824618-123824640 TCCAGATGGACATGAACTGGAGG - Intergenic
1048371835 8:133785093-133785115 TCCATCTGAGCAGGAGCTGCAGG + Intergenic
1048885883 8:138909462-138909484 TCCAATTGGCCTGGACCTGCCGG + Intronic
1049193621 8:141303347-141303369 TCAGGCTGGCCTGGAACTCCTGG + Intronic
1049211382 8:141387951-141387973 CCCAGCTGGCCAGGCCATGCAGG - Intergenic
1049882444 8:145075546-145075568 TCCAGCTGGCCAGCGGCAGCAGG - Intergenic
1049886674 9:31859-31881 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1049890569 9:66267-66289 TCCAGTTGGCCATGAAAAGCTGG - Intergenic
1050558527 9:6809787-6809809 TCCAGCTGGTCTCGAACTCCTGG - Intronic
1051917799 9:22229263-22229285 TCCAGCTGGCCAGCAGCAGTAGG + Intergenic
1053039422 9:34857180-34857202 TCCAGCTGGCCAGTGGCAGCAGG - Intergenic
1053732035 9:41067450-41067472 TCCAGTTGGCCATGAAAAGCTGG - Intergenic
1053789733 9:41678357-41678379 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1054155411 9:61636396-61636418 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1054178071 9:61890047-61890069 TCCAGCTGGTCTTGAACTCCTGG - Intergenic
1054475197 9:65567507-65567529 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1054659458 9:67690777-67690799 TCCAGCTGGTCTTGAACTCCTGG + Intergenic
1054696421 9:68364267-68364289 TCCAGTTGGCCATGAAAAGCTGG + Intronic
1055553770 9:77455233-77455255 GCCACATGGCCAGGAACTGAGGG - Intronic
1055648127 9:78379967-78379989 TCAGGCTGGTCACGAACTGCTGG - Intergenic
1056190814 9:84182178-84182200 TCAGACTGGCCAGAAACTGCTGG - Intergenic
1056587421 9:87937861-87937883 TCCACCCGGCCAGGAATTACTGG + Intergenic
1056609455 9:88115081-88115103 TCCACCCGGCCAGGAATTACTGG - Intergenic
1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1057454864 9:95198947-95198969 CCAGGCTGGCCAGGAACTCCTGG + Intronic
1058457249 9:105148902-105148924 TCCAGCTGTCCAGCAGCTTCAGG - Intergenic
1058720836 9:107762035-107762057 TCCATGTGGCAGGGAACTGCGGG + Intergenic
1059031458 9:110702146-110702168 TCCAACTAGCCCGGAAATGCTGG + Intronic
1059269134 9:113061222-113061244 TCCAGCTGCCCAAGACCTCCAGG + Intergenic
1059270270 9:113066671-113066693 TCCAGCTGCCCAAGACCTCCAGG + Intergenic
1059271406 9:113072121-113072143 TCCAGCTGCCCAAGACCTCCAGG + Intergenic
1059272537 9:113077565-113077587 TCCAGCTGCCCAAGACCTCCAGG + Intergenic
1059273672 9:113083007-113083029 TCCAGCTGCCCAAGACCTCCAGG + Intergenic
1059274808 9:113088453-113088475 TCCAGCTGCCCAAGACCTCCAGG + Intergenic
1060779480 9:126400927-126400949 TCCAGCTGGCTAGGATTTTCGGG + Intronic
1060915606 9:127387934-127387956 CCCAGCTGGTCTTGAACTGCTGG - Intronic
1060974029 9:127754526-127754548 CCCAGCTGGCCGGGCAGTGCAGG - Intronic
1061059450 9:128243315-128243337 TCCAGCTGGCCAAGGAGTGGGGG + Intronic
1061326638 9:129868452-129868474 ATCAGCTGGCCGGGGACTGCGGG + Intronic
1061329934 9:129885945-129885967 TCCAGCGGGTCAGGAAATACCGG - Intergenic
1061452969 9:130678534-130678556 CCCACCTGACCAGGAACTGCTGG + Exonic
1061453186 9:130679868-130679890 CCCAGCTGGTCTGGAACTCCTGG + Intronic
1061875298 9:133540547-133540569 TTCAGCGGGGCAGGAAATGCCGG - Intronic
1062204482 9:135328604-135328626 TCCAGCTGGCCCCCAACTGTGGG - Intergenic
1062527416 9:136983562-136983584 ACCAGGTGCCCTGGAACTGCAGG - Exonic
1062582832 9:137236028-137236050 TCCCGCTGGCCAGGCACTTCGGG + Exonic
1062743182 9:138192937-138192959 TCCAGCTGGCCAGTGGCAGCAGG - Intergenic
1062743430 9:138194938-138194960 TCCAGCTGGCCAGTGGCAGCAGG - Intergenic
1062743679 9:138196939-138196961 TCCAGCTGGCCAGTGGCAGCAGG - Intergenic
1203627151 Un_KI270750v1:34767-34789 TACACCTGGCCAGGAATTGCTGG - Intergenic
1186178486 X:6949959-6949981 TCCACATGGCCAGGAATTGAGGG - Intergenic
1186542917 X:10419266-10419288 CCCACATGGCCAGGAACTGAGGG + Intergenic
1187521115 X:20014924-20014946 TCAAGCTGGTCTGGAACTTCTGG + Intronic
1187688683 X:21841588-21841610 TCAGGCTGGCCTGGAACTCCTGG - Intronic
1187859229 X:23665882-23665904 TCCAGCTGGAAAGGAACTATGGG - Intronic
1188099966 X:26071467-26071489 TCCAGCTGGCCAGTGGCAGCAGG - Intergenic
1189459459 X:41226902-41226924 TCAAGCTGGCCTTGAACTCCTGG - Intronic
1190562338 X:51697626-51697648 TCTACATGGCAAGGAACTGCAGG + Intergenic
1191065563 X:56343519-56343541 TCCAGCTGGCCAGTGGCAGCAGG - Intergenic
1192135533 X:68595709-68595731 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
1192167939 X:68837658-68837680 TCCAGAAGGCCAGGCACTGGGGG - Intronic
1194722937 X:97361816-97361838 TCAATCTGCCCAGGAGCTGCTGG - Intronic
1194726228 X:97400939-97400961 TCAGGCTGGCCACGAACTCCTGG + Intronic
1195868207 X:109456526-109456548 TTCAGCTGGCCAGGCTGTGCTGG + Intronic
1195885668 X:109635077-109635099 ACCAACTGGCCTGGAGCTGCAGG - Intronic
1196416562 X:115477947-115477969 CCAAGCTGGTCTGGAACTGCTGG - Intergenic
1197107324 X:122731955-122731977 TCCAGCTGGCCAGTGGCAGCAGG + Intergenic
1197752826 X:129977220-129977242 CCCAGCTGGTCTTGAACTGCTGG - Intergenic
1197763532 X:130044329-130044351 TCCAGCTGGGCAGAAAATGAAGG + Intronic
1199664560 X:150086370-150086392 TCCAGCTCCCCAGGAAGTGATGG - Intergenic
1200094243 X:153649858-153649880 GCCAGATGGCCACGACCTGCAGG - Intronic
1200133849 X:153865195-153865217 TCGGGGTGGCCAGGCACTGCAGG + Exonic
1200157513 X:153985065-153985087 TCCAGAGGGGCAGGGACTGCAGG + Intergenic
1200372155 X:155738979-155739001 TCCAGCTGGCCAGAGGCAGCAGG + Intergenic
1201756661 Y:17493996-17494018 TCCAGCTGGCCAGCGGCAGCAGG + Intergenic
1201844892 Y:18411988-18412010 TCCAGCTGGCCAGCGGCAGCAGG - Intergenic
1202034164 Y:20614569-20614591 TCTAACTGGCCAGGAACCCCAGG + Intergenic