ID: 1105278028

View in Genome Browser
Species Human (GRCh38)
Location 13:18947529-18947551
Sequence GGAGAAAAGTTGCAGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105278028 Original CRISPR GGAGAAAAGTTGCAGGTCAC TGG (reversed) Intergenic
900264904 1:1752467-1752489 GGGGAAGAGGTGCAGGTCAAGGG + Exonic
900840406 1:5044833-5044855 GGCGTATAGGTGCAGGTCACAGG - Intergenic
901112200 1:6807192-6807214 GGAGAAAAGTTCCAGGTAATTGG + Intronic
901122194 1:6905088-6905110 GGAGAAAACATGAAGTTCACAGG - Intronic
904024449 1:27493472-27493494 GGAGAAGTGTTGCAGGCCAAGGG + Intergenic
904701885 1:32362606-32362628 GGAGAAAAGGAGCAGGCCAAGGG + Exonic
904773354 1:32893216-32893238 GGAGAGATGTTGGAGGACACCGG - Intronic
905120615 1:35679132-35679154 GGAGCAAAGCTGCAGGTCTGCGG - Intergenic
906644310 1:47462916-47462938 GAAGGAAAATTGCAGGTCAGAGG + Intergenic
907739908 1:57155106-57155128 GGAGAAAATCTGCAGGACATGGG - Intronic
909008372 1:70303978-70304000 TGAGAAAAGTTGTAGGTTAAGGG - Intronic
911415513 1:97567169-97567191 TGAGAAAAGGTGCAGGCCATGGG - Intronic
911615008 1:100000785-100000807 GGAGAAATGTTTCAGGACATTGG - Intronic
912565490 1:110584587-110584609 GGAGAAATGTTGGAGGTGAGGGG + Intergenic
913378244 1:118179503-118179525 GGAGAAATGTTTCAGGACATTGG + Intronic
913382961 1:118230444-118230466 GGAGAAAAGTGGCAGGGCTGAGG - Intergenic
915815920 1:158964472-158964494 AGAGAGAAGGGGCAGGTCACTGG + Intronic
916245402 1:162682423-162682445 GAAGTAAAGTTCCAGTTCACTGG - Intronic
916544031 1:165785199-165785221 GGAGCAAAATGGCAGGTCAAAGG - Intronic
917257730 1:173133685-173133707 AGTGAAATATTGCAGGTCACTGG - Intergenic
917843877 1:179004276-179004298 GGAGAAAAGTTTCAGATCAAAGG - Intergenic
919186279 1:194155042-194155064 GGAAAAAAATTAAAGGTCACAGG + Intergenic
920401499 1:205679469-205679491 GGAGAAAGCATGCAGGTCCCTGG + Intronic
920828985 1:209448842-209448864 GGCGTATAGGTGCAGGTCACAGG - Intergenic
920829754 1:209453589-209453611 GGCGTATAGGTGCAGGTCACAGG - Intergenic
921026431 1:211287311-211287333 GGACAACAGGTGCAGGGCACAGG - Intronic
922868811 1:228883654-228883676 GGAGACAAGTTCAAGGACACAGG - Intergenic
924676887 1:246188109-246188131 GGAGAAAACATGAAGGTCAGAGG - Intronic
1063666970 10:8068245-8068267 GTAGCATAGTTGCAGGTCAAAGG - Intronic
1064636246 10:17370800-17370822 GTAAGAAACTTGCAGGTCACTGG + Intronic
1065613265 10:27494121-27494143 GGAGAAATATTGCAGGACACTGG + Intergenic
1066055849 10:31679217-31679239 GGAGAAAAGATGCAAGCCAATGG - Intergenic
1066644189 10:37588683-37588705 GCAGACAGGTTACAGGTCACAGG + Intergenic
1068082575 10:52338095-52338117 GGAGAACAATTGAAGATCACTGG + Intergenic
1069964572 10:72103655-72103677 GGAGAAGAGCAGGAGGTCACAGG - Intronic
1070762677 10:79034466-79034488 GTGGAAATGGTGCAGGTCACAGG - Intergenic
1071241404 10:83709423-83709445 GCAAAAAAGTTGCAGGTGATAGG - Intergenic
1073558222 10:104473923-104473945 GGAGATAAGTTCCAGAGCACAGG - Intergenic
1075125118 10:119693329-119693351 GGAGACAAGTCATAGGTCACTGG + Intergenic
1075870356 10:125768366-125768388 GGAGCAAAGTTCCATTTCACAGG - Intronic
1076423135 10:130347089-130347111 GGAGAAAGTTTTCAGGTCTCAGG - Intergenic
1078510227 11:11979405-11979427 GGAGAAATGCTTCCGGTCACAGG + Intronic
1078798098 11:14614044-14614066 GAAGAACAATTGCATGTCACTGG + Intronic
1078914687 11:15768410-15768432 GTAGAATGGTTGTAGGTCACAGG - Intergenic
1082577503 11:54826926-54826948 GGTGAAAAGGTGCACATCACAGG + Intergenic
1082908035 11:58334020-58334042 GAAGAAATGTTGCAGGTCAGAGG - Intergenic
1082950588 11:58810959-58810981 GGAGAGAACTTCCAAGTCACAGG - Intergenic
1085122332 11:73975127-73975149 GGAGAAAAATCACAGGTCATGGG + Intronic
1085942835 11:81226031-81226053 GGAGGAAAGAAGCAGGTCAATGG - Intergenic
1085984556 11:81769978-81770000 GGCGTATAGGTGCAGGTCACAGG - Intergenic
1086004712 11:82025445-82025467 GGAGTATACGTGCAGGTCACAGG - Intergenic
1088033799 11:105286558-105286580 GGAGAAATGTTTCAGGACATTGG + Intergenic
1089864887 11:121623199-121623221 GGAGAAAAGTTCAACCTCACCGG + Intronic
1089929054 11:122290717-122290739 GGAGAAAAATTTCATGACACTGG + Intergenic
1090218046 11:124988055-124988077 GGAGAGAACATGCAGGTCTCTGG - Exonic
1091136834 11:133198861-133198883 GAAGAAAACTTGCAGCTCATTGG - Intronic
1091374813 12:18336-18358 GGGGAAAAGTCTCAGGACACAGG + Intergenic
1092155921 12:6281411-6281433 GGAGAAGAGTTCTAGGCCACTGG - Intergenic
1092178316 12:6426423-6426445 AGAGGAATGTTGCAGGCCACAGG - Intergenic
1093136218 12:15454660-15454682 GGAGAAAAGCTTCATGACACTGG - Intronic
1093627562 12:21367426-21367448 GGAGAAAAGCAGAAGGTCAGAGG + Intronic
1096386962 12:51200502-51200524 GGCAAAAAGCTGCAGGTCACGGG - Intronic
1096858482 12:54504498-54504520 TGAGAAAAGTTGAAGGGCAAAGG + Intronic
1096903593 12:54911549-54911571 GGAGAAATGTTCCAGGACATAGG + Intergenic
1097566425 12:61275161-61275183 GAAGAAAATTTGCATGTAACTGG - Intergenic
1100024924 12:90116530-90116552 GGAGAAAAATTATAGGTCATTGG - Intergenic
1101256033 12:102977729-102977751 GGAATAAAGTTCCATGTCACTGG - Intergenic
1101286284 12:103316624-103316646 GGAGACATGATGGAGGTCACAGG - Intronic
1104223206 12:126806227-126806249 GGAGGAGAGATGCAGGTCAAAGG - Intergenic
1105278028 13:18947529-18947551 GGAGAAAAGTTGCAGGTCACTGG - Intergenic
1106963654 13:35033083-35033105 GAAGAAAATTTCCAGGGCACTGG - Intronic
1112136727 13:96586880-96586902 GGAGAAAAGTTCTATGACACTGG - Intronic
1114364485 14:22012297-22012319 GGAGAACAGTGGCAGCTCAGGGG + Intergenic
1114763329 14:25342809-25342831 GGAGAAAATTTTCAAGTCACAGG - Intergenic
1116062759 14:39944704-39944726 GGGGAAAATTTCCAGGACACTGG - Intergenic
1116906172 14:50405858-50405880 GGAGAAAAGCTTCAGGACATTGG - Intronic
1118260633 14:64243701-64243723 GGAAAAACCTTGCAGTTCACTGG - Intronic
1119147191 14:72328084-72328106 GGAGAAAAGCTGGATGTCCCAGG + Intronic
1119927320 14:78507442-78507464 GGAGAAAAGTGGCATGGCCCTGG - Intronic
1121674522 14:95741572-95741594 GGAGAAAGGTGGCAGGTGGCAGG - Intergenic
1122196465 14:100091181-100091203 GGAGAAAAGGGGCAGGTGAAAGG - Intronic
1122388313 14:101363925-101363947 GGAGACAGGTGCCAGGTCACGGG - Intergenic
1124989695 15:34659421-34659443 GCAGAACACTTGCAGTTCACTGG - Intergenic
1126239440 15:46425050-46425072 GGAGAATAGGTGCAGGACAGTGG + Intergenic
1128171660 15:65518620-65518642 GGAAAGAAATTGCAGGTCAAGGG - Intergenic
1129329837 15:74821336-74821358 GATGAAATGCTGCAGGTCACAGG + Intronic
1130316366 15:82800231-82800253 GGACAAAACTTGGAGGGCACTGG - Intronic
1131620758 15:94065766-94065788 GGTGAAAATTTGGAAGTCACTGG + Intergenic
1131722300 15:95183474-95183496 GGAGAAATGTTCCAGGACATTGG - Intergenic
1132543757 16:523650-523672 GCAGAATGGTTCCAGGTCACAGG + Intergenic
1132680502 16:1139044-1139066 GGAGCAAAACTGCACGTCACAGG - Intergenic
1134198383 16:12176898-12176920 GGGGAAAATTTGCAGGTCCTGGG + Intronic
1138494294 16:57398034-57398056 GGAGAAAAGTAGCAGGGCTGAGG + Intergenic
1138879895 16:61000277-61000299 GGAGAAAAATGGCAAGTTACTGG + Intergenic
1139515780 16:67451573-67451595 GGAGCAAAGGAGCAGGTCATTGG + Intronic
1139822909 16:69734866-69734888 GGAGAAAAGGTGAAGGTGAGGGG - Intergenic
1203011903 16_KI270728v1_random:301018-301040 GGTGAAAAATTGAATGTCACAGG + Intergenic
1203011934 16_KI270728v1_random:301534-301556 GGCGAAAAATTGAATGTCACAGG + Intergenic
1203030238 16_KI270728v1_random:574177-574199 GGTGAAAAATTGAATGTCACAGG + Intergenic
1203030269 16_KI270728v1_random:574693-574715 GGCGAAAAATTGAATGTCACAGG + Intergenic
1203041452 16_KI270728v1_random:759738-759760 GGCGAAAAATTGAATGTCACAGG - Intergenic
1203041483 16_KI270728v1_random:760254-760276 GGTGAAAAATTGAATGTCACAGG - Intergenic
1143034960 17:3989475-3989497 GAAGAAAACTTGCAGGGGACGGG + Intergenic
1143130305 17:4673277-4673299 GGAGAAGGCTTGCAGGGCACAGG + Exonic
1143825217 17:9600201-9600223 GGAGAAAAATGGCAGGGCAGTGG - Intronic
1146319587 17:31836343-31836365 GGAGAAAAGAGGCAGGTTAATGG + Intergenic
1152839105 17:82555178-82555200 GGAGGAAAGTTGCAGGGCCAGGG + Intronic
1152883325 17:82832964-82832986 CGAGGAAAGGTCCAGGTCACAGG - Intronic
1152884525 17:82841795-82841817 GGAGAAAGCTGGCAGGTGACTGG + Intronic
1153072748 18:1124634-1124656 GGAGAAAAGCAGCAGTTCCCTGG + Intergenic
1157904501 18:51557285-51557307 GGAGAAGAGCTGCAGGAAACAGG - Intergenic
1158122904 18:54070068-54070090 GGAGATAACTTTCAGGTCATAGG - Intergenic
1160765276 19:804815-804837 GGAGAAAATCTGCAGGTCCCGGG - Exonic
1163235392 19:16026815-16026837 TCAGAAAAGTTGCAGCTTACTGG - Intergenic
1164497342 19:28778830-28778852 GTAGAAATGTTGCAAGCCACAGG + Intergenic
1164772975 19:30826498-30826520 GAAGAAAATTTGCTGGCCACGGG + Intergenic
1164992728 19:32696127-32696149 GGAGAAAAGTGGCAGGGCTGAGG + Intronic
1165032674 19:33009604-33009626 AGAGAAAATTTGCCGGTCATGGG - Intronic
1165205435 19:34181053-34181075 GGGGAACAGATGCAGGTAACTGG - Intronic
1166024837 19:40072687-40072709 GGAGAAATGTTCTAGGTCAGTGG + Intronic
1166577896 19:43861374-43861396 GGGGAAATGTTTCAGGACACTGG + Intergenic
925420365 2:3705243-3705265 GAAGAAAAGTCGTAAGTCACAGG + Intronic
926664596 2:15507242-15507264 AGAGAAAAGTTACAGTACACAGG + Intronic
928100504 2:28434679-28434701 GGAGACAGTTGGCAGGTCACTGG - Intergenic
928791832 2:34965984-34966006 TGAGAAAAGTTGCAGTGCACTGG + Intergenic
929257057 2:39823525-39823547 GGAGAAAAGTTGGAAGTGAAGGG + Intergenic
930679895 2:54245934-54245956 GGAGAAAAGTTCCAGGACATTGG - Intronic
931585187 2:63818466-63818488 GGAGAACAGTTAGGGGTCACTGG + Intronic
934106449 2:88699279-88699301 GGAGAATACTTTCAGGGCACAGG + Intronic
936140772 2:109938334-109938356 GGAGAGGAGTTGCAGGGCAAAGG + Intergenic
936177463 2:110236279-110236301 GGAGAGGAGTTGCAGGGCAAAGG + Intergenic
936203921 2:110433152-110433174 GGAGAGGAGTTGCAGGGCAAAGG - Intronic
936682559 2:114790864-114790886 GGCGAATACGTGCAGGTCACAGG + Intronic
937169252 2:119849213-119849235 GAAGAAAAATAGCAGGTAACAGG - Intronic
937360924 2:121229685-121229707 GGAGAACAGTGGCAGGTGCCAGG - Intronic
939065434 2:137478887-137478909 GGTGAAAATTTGCTGGTGACAGG + Intronic
942657445 2:178229062-178229084 GCAGAAAAGTGGAAGGTCATGGG + Intronic
947505611 2:230706242-230706264 GGAGTAGAATTGAAGGTCACTGG + Intergenic
1170701417 20:18707077-18707099 GGTGAAAAGTGGCAAGTTACAGG - Intronic
1170797345 20:19560443-19560465 GCAGAAAAGTAGAAAGTCACAGG + Intronic
1171166258 20:22974667-22974689 TGAAAAAAATTCCAGGTCACTGG + Intergenic
1173483742 20:43424613-43424635 GGAGTAGAATTGCAGGTCACAGG - Intergenic
1173566897 20:44046852-44046874 AGAGACAAATTGCATGTCACAGG - Intronic
1173722874 20:45274955-45274977 GGAGTAAAATTGCAAGTCATAGG + Intergenic
1175093658 20:56524644-56524666 GGACAGAGGTTACAGGTCACAGG - Exonic
1175094847 20:56533177-56533199 GGACAGAGGTTACAGGTCACAGG - Intergenic
1177361486 21:20078031-20078053 GGAGCATAGTTGCCGGTCACTGG + Intergenic
1177624136 21:23636980-23637002 GGGGAAATGTTTCAGGACACTGG - Intergenic
1177825813 21:26081602-26081624 GGCGAATACGTGCAGGTCACAGG + Intronic
1177931307 21:27287431-27287453 GGAGGACAGTTGCAGGACAGTGG - Intergenic
1178835245 21:36091863-36091885 GGAGAATTGCTGCAGGTCAAAGG - Intergenic
1179190159 21:39116532-39116554 AGAGAAAAGATGGAGGTCCCTGG + Intergenic
1179989324 21:44938927-44938949 GGAGAAGAGTAGCAGGTCCCAGG - Intronic
1180700485 22:17778857-17778879 GGCGGCAAGTTGGAGGTCACTGG - Intergenic
1182953232 22:34396953-34396975 GGAGGAAAGCTGAAGCTCACTGG - Intergenic
1183925037 22:41199715-41199737 GGAGAAAAGTTCCAGTTAGCAGG + Intergenic
1185001314 22:48248207-48248229 GGAAGAAAGTTTCAGGTCACAGG + Intergenic
1185001332 22:48248312-48248334 GGAGACACAGTGCAGGTCACGGG + Intergenic
1185071775 22:48660603-48660625 GGAGAACAGCTGCATGTCCCAGG + Intronic
949728148 3:7075087-7075109 TGAAAAAAGGTGCAGGTCAGGGG + Intronic
952639047 3:35569280-35569302 GGAGAAAAGTTGTTGGTAACTGG - Intergenic
952707382 3:36392964-36392986 GGAGAAAAGTTTAAGGACTCAGG - Intronic
952914099 3:38218744-38218766 GGAGAAAAGCTTCATGACACTGG - Intronic
953546437 3:43867071-43867093 CCAGAAAAGTGGCAGATCACGGG - Intergenic
954587952 3:51753198-51753220 GGAGAAGTCTTCCAGGTCACAGG + Intergenic
957283765 3:78188626-78188648 AGAAAAAAGTCGCAGCTCACAGG + Intergenic
957377082 3:79372099-79372121 GGAGATAAGTGGCAGGTGACAGG - Intronic
957814688 3:85280382-85280404 GCAGAAATTTTGCAGGTCAAAGG - Intronic
958144120 3:89601929-89601951 GCAGAGAACATGCAGGTCACTGG - Intergenic
960076262 3:113489404-113489426 GAAGCAAAGTTGCAGGGCATAGG - Intronic
963093041 3:141504592-141504614 AGCGAAAACTTGCAGGTCAGGGG - Intronic
963380780 3:144527140-144527162 GGAGGAAGATTGTAGGTCACAGG + Intergenic
963589657 3:147242080-147242102 GGAGAAAAGTTGCATTTCAGAGG + Intergenic
964160632 3:153641032-153641054 GGATGAAAGTCCCAGGTCACTGG - Intergenic
964562861 3:158017616-158017638 GTAGAAATGTTGCTGGTAACAGG - Intergenic
965196057 3:165596403-165596425 TGTGAAAAGTTGCAGGTTAAAGG + Intergenic
965248499 3:166308952-166308974 GAAGTAGAGTTGCAGCTCACAGG + Intergenic
966285098 3:178286381-178286403 GGAGAAAAGTAGCAGGTGAAAGG - Intergenic
967720697 3:192813102-192813124 ACAGAAAAGTTACAAGTCACTGG - Intronic
968059647 3:195717556-195717578 GGAGAAAGCTTCCAGGTCACAGG - Intergenic
969861986 4:10043981-10044003 GGAGAAAAGCTTCAGGACATTGG + Intronic
970207569 4:13670120-13670142 TCAGAGAAGTTCCAGGTCACAGG + Intergenic
970783032 4:19762115-19762137 GGAGAAATGTTTCAGGACATTGG - Intergenic
970946641 4:21700678-21700700 GGAGAAAAGCTTCAGGACATTGG - Intronic
971685900 4:29767653-29767675 GCAGAAAACTTGCAGGCCAGAGG - Intergenic
972280456 4:37597138-37597160 GAGGAAGAGTTGCAGGTCAGTGG - Intronic
972967224 4:44525393-44525415 GGAGGAAAGCTTCAGGACACTGG - Intergenic
973154445 4:46932315-46932337 ACAGAAAGGTTACAGGTCACTGG + Intronic
973285646 4:48413089-48413111 GGACTACAGATGCAGGTCACCGG - Intronic
974428770 4:61769966-61769988 GGCGTACAGGTGCAGGTCACAGG + Intronic
974449884 4:62040683-62040705 GAATAAAAGTTCCAGATCACAGG - Intronic
974727886 4:65819380-65819402 GCAGAAACCTTGCAGGTCAAAGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
977075560 4:92444595-92444617 GGAGTATAGGTGCAAGTCACAGG + Intronic
977336107 4:95701570-95701592 GGAGGAGAGTGGTAGGTCACTGG - Intergenic
979542163 4:121897203-121897225 GGAGAAATGCTTCAGGACACTGG + Intronic
979593252 4:122504926-122504948 GGAAAAAAGTGGAAGGTCAAGGG - Intergenic
979648895 4:123107157-123107179 GGAGAAGAGTTGCAGCCCTCTGG - Intronic
980701927 4:136442560-136442582 GGAGGAAGGGTGCAGGTCCCTGG + Intergenic
981705162 4:147651295-147651317 GGAGAAAAGCTTGAGGACACTGG + Intronic
981871372 4:149490847-149490869 GGAGAAATCATCCAGGTCACGGG - Intergenic
982361355 4:154523013-154523035 GGAGAAAAGCTTCATGACACTGG + Intergenic
982619241 4:157682088-157682110 GGAAAAAACTTGAAGGTCAGCGG + Intergenic
982861717 4:160460063-160460085 TGAGAGAAGTAGCAGGTCAGAGG - Intergenic
983730263 4:170984701-170984723 GGAGAAAAATTGCAAGGCATAGG - Intergenic
983827283 4:172279129-172279151 GGAGAAAAGTTTCATGACACTGG + Intronic
984680896 4:182608499-182608521 GGTGAAAAGTTACAGGTGTCAGG + Intronic
984730263 4:183061741-183061763 GGAGAAAAGCTCCATGACACTGG - Intergenic
985442988 4:189998101-189998123 TGGGAAAAGTGGCAGGTCATAGG - Intergenic
985731600 5:1552599-1552621 GGAGAAAGGCTGCCTGTCACAGG - Intergenic
986097020 5:4568011-4568033 GGGGAAAGGTTTCAGGACACTGG + Intergenic
986163211 5:5250001-5250023 GGAGAAAAGTAGCTGGACATTGG - Intronic
986622394 5:9689224-9689246 GCAGAAATGTTAAAGGTCACAGG - Intronic
986923519 5:12717396-12717418 GGTGGAAAGTGGCAGGTCCCTGG + Intergenic
988659001 5:33243808-33243830 TGAAAAAAGTAGCAGCTCACAGG + Intergenic
988692401 5:33585771-33585793 AGAGAAAAGGGGCTGGTCACAGG + Intronic
989496525 5:42115760-42115782 GGAGAAAAGTGGCAGGGCTGAGG - Intergenic
990299315 5:54434739-54434761 GGATAAAATTTGAAGGTCAGAGG + Intergenic
991121595 5:63021722-63021744 GGAGAAGACTTCCAGGCCACAGG - Intergenic
991202332 5:64008838-64008860 ATAGAAAAGTTGCAGCTCAGTGG - Intergenic
991239388 5:64440252-64440274 GGAGTGAAGTTGCTGGTCAAAGG + Intergenic
993345681 5:86779372-86779394 GGAGAAATGTTTCAGGACATTGG - Intergenic
994384074 5:99107578-99107600 GGAGAAAAGTTGAAGGGCAAAGG + Intergenic
996078810 5:119231441-119231463 GGATAAAAGTTGCAGGTTTCAGG + Intronic
999949390 5:156632684-156632706 GTAGAGACTTTGCAGGTCACTGG - Intronic
1000222359 5:159226370-159226392 GGGGAAAAGTTGCCAGTCTCTGG - Intergenic
1002703819 5:181147387-181147409 GGAGGAAGGATGCAGGGCACAGG - Intergenic
1004824927 6:19409183-19409205 GGAGAAAAGCTCCAGGACATTGG + Intergenic
1006619133 6:35350334-35350356 GGAGAAAATCTCCAGGACACTGG - Intronic
1006655132 6:35584704-35584726 GGAGAAAAGTCTCAGGTCAGTGG + Intronic
1007547758 6:42707437-42707459 GGAGAAAAATGGCAGGTATCTGG - Intronic
1010139193 6:72594229-72594251 GGAGAAAAGTTCCAATTTACTGG - Intergenic
1013598839 6:111685327-111685349 TGGGAACAGTTGGAGGTCACGGG + Intronic
1014337623 6:120157200-120157222 GGAGAAAAGTTGAAAGACAGCGG - Intergenic
1016135447 6:140535655-140535677 GGGGAAAATCTGCAGGACACTGG + Intergenic
1017087330 6:150725728-150725750 GGAGAAAAGCTTCATGACACTGG - Intronic
1017101295 6:150851946-150851968 GGAGAAAAGTGGCAGGGTTCAGG - Intergenic
1018365608 6:163116983-163117005 GGAGAAATGATGCTGGCCACGGG - Intronic
1022657941 7:32338030-32338052 GGAGAAAAGCTTCAGGACATTGG + Intergenic
1022734794 7:33065398-33065420 GCATATAACTTGCAGGTCACAGG + Intergenic
1024697206 7:51869887-51869909 GGCGTAAAGGTGCAGGTCACAGG - Intergenic
1024794799 7:53007993-53008015 GGTGAAAAGAGGCAGGTAACTGG + Intergenic
1024809333 7:53189235-53189257 GCAAAAAAGTTACAGGTCATGGG + Intergenic
1025529178 7:61855695-61855717 GGCGAAAAATTGAATGTCACAGG - Intergenic
1025529209 7:61856208-61856230 GGTGAAAAATTGAATGTCACAGG - Intergenic
1027558446 7:79695907-79695929 GTAGAATAGTTGAATGTCACAGG + Intergenic
1028362493 7:89985915-89985937 GGAGAGACCTTCCAGGTCACAGG - Intergenic
1028863176 7:95678065-95678087 GGGGAAAATTAGCAGGTAACAGG + Intergenic
1029750936 7:102542041-102542063 GGACTTAAGTTGGAGGTCACTGG - Intronic
1029768889 7:102641152-102641174 GGACTTAAGTTGGAGGTCACTGG - Intronic
1030218165 7:107067984-107068006 GGACAAAAGTTGAAGGTTGCAGG + Intronic
1030294838 7:107912877-107912899 GGAGAAATGCTCCAGGACACTGG - Intronic
1030322112 7:108179973-108179995 GGAGAAAAATTTTAAGTCACGGG + Intronic
1031558390 7:123207055-123207077 GGAGAGAGCTTCCAGGTCACAGG + Intergenic
1031653446 7:124321096-124321118 GGAGAAATGCTCCAGGACACTGG + Intergenic
1031693275 7:124817208-124817230 GAAGACCAGTTGCAGGGCACTGG + Intergenic
1031732112 7:125312748-125312770 GGAGAAAAGTGGCAGGGCTGAGG - Intergenic
1031873153 7:127109444-127109466 GGAGAGAAGGTACAGGTCAGGGG - Intronic
1032581707 7:133109176-133109198 GGAGAAAGGATGCTGGTAACAGG + Intergenic
1032649424 7:133861351-133861373 GTAGATAAATTGCATGTCACAGG - Intronic
1032834127 7:135657970-135657992 GGAGTGAAGGTGAAGGTCACTGG + Intergenic
1034439283 7:151078423-151078445 GTAGAAAAGATGCAGGTCCCAGG + Intronic
1034893142 7:154858091-154858113 AGAGAAAGGCTGGAGGTCACAGG + Intronic
1035091611 7:156317588-156317610 GGAGTAAAGTTTCAGGGCCCAGG + Intergenic
1035143969 7:156794414-156794436 GGAGAAAAATGACATGTCACTGG + Intronic
1035550571 8:521009-521031 GGAGAAAAGGTTCAGGGCATTGG - Intronic
1038280710 8:26161642-26161664 TCAGAAAAGTCACAGGTCACAGG - Intergenic
1038770218 8:30471700-30471722 GGAGGAGAGTTGCGGGTGACAGG + Intronic
1040302682 8:46196107-46196129 GGGGAAAAGCTGGAGGTCCCAGG + Intergenic
1044371829 8:91420990-91421012 GGAAAAAAGTTGCAAGACAGTGG - Intergenic
1047987223 8:130247659-130247681 GGAGTCAACTTGCAGGTCACTGG + Intronic
1050835819 9:10077542-10077564 ACAGATAAGTTGCATGTCACTGG + Intronic
1051222773 9:14867808-14867830 GGAGCAAAGTTACAGGACAGTGG + Intronic
1051543856 9:18252146-18252168 GGAGAAAAGTTGCAGTACATAGG + Intergenic
1051803115 9:20959611-20959633 GGAGAAATGCTTCAGGACACAGG - Intronic
1054864606 9:69987347-69987369 GGAGAAATGCAGCTGGTCACAGG - Intergenic
1055019362 9:71652701-71652723 AGAGAAAAGATGGAGGTCCCTGG + Intergenic
1055176720 9:73327547-73327569 GGTGAAAAGTTACCAGTCACAGG + Intergenic
1055591006 9:77813762-77813784 GGAGAACAGTTACAGTTGACAGG + Intronic
1055813121 9:80174890-80174912 GGAGAAAAATTGCATTTCAATGG + Intergenic
1056742074 9:89266117-89266139 GAATAAAAGTTGCAGCTCATAGG + Intergenic
1057042063 9:91855296-91855318 GGAGGAAAGTTGCAGGGCCTGGG - Intronic
1057275270 9:93673030-93673052 GGAGAGAAGTTGCAGGTCACTGG + Intronic
1058542780 9:106029461-106029483 AGAGAAAAGTTGCACCTTACTGG + Intergenic
1059568292 9:115406536-115406558 GGAGAAAAGTTGCTTTTCTCAGG - Intergenic
1059686714 9:116644785-116644807 GGAAACAAATTTCAGGTCACAGG + Intronic
1186214350 X:7282938-7282960 GGAGATAAATTGTGGGTCACAGG - Intronic
1186378219 X:9031714-9031736 GTAGATAAATTGCATGTCACAGG - Intronic
1186429404 X:9491758-9491780 GGAGAAAAGGTCCTTGTCACTGG + Intronic
1186767064 X:12781803-12781825 GGAGAGAAGCTGAAGGTCAGTGG + Intergenic
1189487654 X:41445548-41445570 GGAGAAATGTTTCAGTTCACAGG + Intergenic
1189648642 X:43163799-43163821 GAAGAACAGGTTCAGGTCACTGG + Intergenic
1190299773 X:49050345-49050367 GGGGAAGAGTTGGGGGTCACTGG + Intergenic
1190924796 X:54893721-54893743 GGTGAAAAGTAGAGGGTCACAGG - Intergenic
1191801344 X:65084170-65084192 GGAGAAAATCTGCAGGACATTGG + Intergenic
1191820331 X:65299636-65299658 GGAGAAAAATGGCAGCTAACAGG + Intergenic
1192771151 X:74192904-74192926 GGGCAAAAGTTCCATGTCACTGG - Intergenic
1193286148 X:79717574-79717596 GGAGAATCACTGCAGGTCACAGG - Intergenic
1194670914 X:96731177-96731199 GGTGTATAGGTGCAGGTCACAGG + Intronic
1194849815 X:98856838-98856860 GGAAAAGAGTTGGAGGTCATCGG - Intergenic
1196205877 X:112938770-112938792 GGAGAAAAGCTCCAGGACATTGG + Intergenic
1197105544 X:122709753-122709775 GGAGAAATGTTTCAGGACATTGG + Intergenic
1198614072 X:138434810-138434832 GGAGAATAGTTACAGGTTAGGGG - Intergenic
1199560506 X:149158216-149158238 GGATAAAAATTCTAGGTCACAGG + Intergenic
1200896267 Y:8379162-8379184 GAAGAAAAGTTGCATGTCTTGGG + Intergenic
1201404079 Y:13632791-13632813 GGAGAAAAGTTGCAGGGTTGAGG - Intergenic