ID: 1105278078

View in Genome Browser
Species Human (GRCh38)
Location 13:18947792-18947814
Sequence AGGTGCAGCTGTGCCTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 3, 3: 15, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105278078_1105278084 27 Left 1105278078 13:18947792-18947814 CCTGAACAGGCACAGCTGCACCT 0: 1
1: 1
2: 3
3: 15
4: 213
Right 1105278084 13:18947842-18947864 GGCAGGCTCCACAGACTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 199
1105278078_1105278081 10 Left 1105278078 13:18947792-18947814 CCTGAACAGGCACAGCTGCACCT 0: 1
1: 1
2: 3
3: 15
4: 213
Right 1105278081 13:18947825-18947847 CAAGCTCACTCCCTTCTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1105278078_1105278080 6 Left 1105278078 13:18947792-18947814 CCTGAACAGGCACAGCTGCACCT 0: 1
1: 1
2: 3
3: 15
4: 213
Right 1105278080 13:18947821-18947843 AGCACAAGCTCACTCCCTTCTGG 0: 1
1: 0
2: 2
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105278078 Original CRISPR AGGTGCAGCTGTGCCTGTTC AGG (reversed) Intergenic
900014454 1:138561-138583 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
900044319 1:493763-493785 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
900065726 1:728669-728691 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
900284686 1:1893460-1893482 AGGTGCCTCTCTGCCTGCTCCGG + Intergenic
902330222 1:15727655-15727677 AGGCCCAGCTGTCCCTGGTCAGG + Exonic
902581387 1:17409945-17409967 GGGGGCAGCTGTGCCAGCTCGGG - Intronic
902843964 1:19094968-19094990 GGGTGCAGCTGTGGCTGAGCAGG - Exonic
902979385 1:20112343-20112365 GGGGGCAGCTGTGCCTGTGTGGG - Exonic
904004459 1:27356604-27356626 TGGTGCAGCTGAGCCTCTTGAGG - Exonic
906242367 1:44249767-44249789 AGGAGCCGCTGAGCCTGGTCAGG + Intronic
906411734 1:45584315-45584337 AAGAGCAGCTGTCGCTGTTCGGG + Intronic
906699321 1:47846475-47846497 AGCTGGGGCTGTGCCTGTTTGGG + Intronic
907319388 1:53593226-53593248 AGGTCCAGCTCTGCCGTTTCTGG + Intronic
910112026 1:83693082-83693104 AGCCCCAGCTGTGCCTGCTCTGG + Intergenic
910441107 1:87252894-87252916 AAGTGGAGTTGTGCCAGTTCTGG + Intergenic
913966488 1:143381476-143381498 AGGTGCTGATGTGCATGTCCAGG + Intergenic
914060863 1:144207083-144207105 AGGTGCTGATGTGCATGTCCAGG + Intergenic
914118287 1:144759286-144759308 AGGTGCTGATGTGCATGTCCAGG - Intergenic
914239727 1:145845654-145845676 GGGTGCAGCTGCTCCTGTCCCGG + Exonic
914392861 1:147237412-147237434 AGCTGCAGCTGTGCCTGAGAGGG + Intronic
915362560 1:155294892-155294914 ACGTCCATCTGTGCCTCTTCCGG - Intronic
919453886 1:197801009-197801031 AGCTGCAGCTGTGCCTGGGAGGG - Intergenic
919478420 1:198056523-198056545 AGGGGCAGCAGTGCCTGTGCTGG + Intergenic
920769408 1:208866755-208866777 AGGCGCAGCGGTGCCCATTCTGG - Intergenic
920868209 1:209770713-209770735 AGGTGGAGGTGTGCGTGTGCAGG + Intronic
920868212 1:209770733-209770755 AGGTGGAGGTGTGCGTGTGCAGG + Intronic
920868228 1:209770894-209770916 AGGTGAAGGTGTGCGTGTGCAGG + Intronic
920868230 1:209770914-209770936 AGGTGAAGGTGTGCGTGTGCAGG + Intronic
922100853 1:222476018-222476040 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
922554256 1:226521010-226521032 AGGGGCAGCTGTGCCTCCTGAGG + Intergenic
922733768 1:227968654-227968676 GGGAGGAGCTGTGCCTGTTGAGG - Intergenic
923776298 1:236981665-236981687 AGGAGCGGCTGTGCCTGCTGCGG + Intergenic
924343773 1:243056135-243056157 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
924382144 1:243474805-243474827 AGGAGCGGCTGTGCACGTTCAGG - Intronic
1066116215 10:32242736-32242758 AGGCGCAGGTGTGCCTGCTGTGG + Intergenic
1068072301 10:52210346-52210368 GGGTGCAGCTGTGACGGTCCTGG - Intronic
1069561891 10:69436329-69436351 AGCTGCAGCTGTGCCTGGGAGGG + Intergenic
1072252661 10:93593848-93593870 AGGAGGAGCTGTGCCTGGCCAGG - Exonic
1072753181 10:97999136-97999158 AGCTGCAGCTGTGCCTGGGAGGG - Intronic
1073681841 10:105713334-105713356 AGGTACTTCTGTTCCTGTTCAGG + Intergenic
1074249284 10:111728143-111728165 GAGTGCCACTGTGCCTGTTCTGG + Intergenic
1075397981 10:122141491-122141513 AGGAGCAGCTGTGGGTGTTAAGG + Intronic
1075896947 10:126004568-126004590 TCTTGCAGATGTGCCTGTTCTGG + Intronic
1076233950 10:128849239-128849261 AGGTGCACCTGTGCTTCATCTGG + Intergenic
1076563238 10:131381199-131381221 ACTTCCAGCTGTGGCTGTTCTGG - Intergenic
1076655315 10:132019763-132019785 AGCTGCAGCTGTGCCTGATGGGG + Intergenic
1076815175 10:132911083-132911105 GGGTGCAGCTGAGCCTGCTGTGG - Intronic
1076919223 10:133442613-133442635 AGGTGCCCCTCTGCCTCTTCCGG + Intergenic
1076970651 11:130238-130260 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
1078609571 11:12808713-12808735 AATTGCAGCTGTGCCTATTCAGG - Intronic
1083341149 11:61959258-61959280 AGGGACAGCTGTGGGTGTTCAGG + Intronic
1084670168 11:70601875-70601897 TGCTGCAGCTGCCCCTGTTCTGG - Intronic
1084806507 11:71582815-71582837 ATGGGCTGCTGTGGCTGTTCTGG - Exonic
1085514403 11:77103934-77103956 AGGCCCAGCTGTGGCTCTTCTGG + Intronic
1085749809 11:79151717-79151739 AGGTTCATCTGTGCCTGTTGGGG - Intronic
1086271628 11:85074217-85074239 AGGTTCAGCAGTACATGTTCAGG - Intronic
1087587752 11:100143561-100143583 ATGTGCAGCTGGACCAGTTCCGG + Intronic
1089774031 11:120823763-120823785 TGGAGCAGATGTGCCTGTCCAGG + Intronic
1090390348 11:126383747-126383769 GGATGCAGCTGGGCCTGTTCAGG + Intronic
1090514791 11:127412946-127412968 AGCTGCAGCTGTGCCTGGGAGGG + Intergenic
1091084399 11:132706427-132706449 AAGTGCAGTTGTGCCTGGTAGGG - Intronic
1091157554 11:133387481-133387503 GGATGCAGCTTTGCCTGTTGGGG - Intronic
1093616911 12:21236468-21236490 TGGTGCAGCTGTACCTGTGCAGG + Intronic
1096610169 12:52795771-52795793 CGGAGCAGCTGTGCCTTTGCAGG - Exonic
1097009211 12:55940511-55940533 AGGGGCAACTGTGCCTGTAAAGG - Intronic
1097299105 12:57998621-57998643 AGCTGCAGCTGTGCCTGGTGTGG + Intergenic
1098383850 12:69897954-69897976 AGCTGCAGCTGTGTGAGTTCAGG + Intronic
1098803110 12:74986098-74986120 AGTTGCAGCTGTGCCTGGGAAGG + Intergenic
1101788699 12:107909539-107909561 AAGTTCAGCGGTGCCTGTGCAGG + Intergenic
1103423923 12:120814380-120814402 TGATGCAGCTGTGGCTGTCCAGG + Intronic
1103605380 12:122082088-122082110 AGGTGAAGCCCTGCCAGTTCAGG - Intronic
1104686394 12:130787684-130787706 ATCTGCAGCTGTGCTTCTTCAGG + Intergenic
1105278078 13:18947792-18947814 AGGTGCAGCTGTGCCTGTTCAGG - Intergenic
1107219078 13:37959520-37959542 ATGTGCAGCTGTGTCTTCTCTGG + Intergenic
1107958955 13:45542500-45542522 AGGGGCAGCTGTGCCTGTGCAGG - Intronic
1111360482 13:87168575-87168597 AGTTGCAGCTGTGCCTGGGAGGG + Intergenic
1111485606 13:88895439-88895461 AGCTGCAGCTGTGCCTGGAAGGG - Intergenic
1113543008 13:111123395-111123417 TGGTGCAGCTGTGCCTGCTCTGG - Intronic
1114349713 14:21836293-21836315 AGCTGCAGCTGTGCCTGGAAGGG + Intergenic
1120281070 14:82438589-82438611 AGATGCTGCTGTTGCTGTTCTGG + Intergenic
1121417955 14:93791941-93791963 AGGGACAGTTGTTCCTGTTCTGG + Intergenic
1125831656 15:42721224-42721246 AGGTGTGGCAGTGACTGTTCTGG - Intergenic
1126145335 15:45468386-45468408 TAGTACAGCTGTGCCTGTCCTGG + Intergenic
1131583768 15:93671834-93671856 AGGTGCAGCTGTTCCTCTTAGGG + Intergenic
1132235669 15:100218890-100218912 AGGTGGACGTGTGCGTGTTCAGG - Intronic
1133229878 16:4361397-4361419 TGGGGCAGCTGTGACTGATCTGG - Exonic
1135351349 16:21731836-21731858 AGGTGAAGTTGTGTGTGTTCAGG - Intronic
1135449832 16:22547962-22547984 AGGTGAAGTTGTGTGTGTTCAGG - Intergenic
1135689253 16:24522972-24522994 TTGTAAAGCTGTGCCTGTTCGGG + Intergenic
1136111761 16:28067836-28067858 TGGTGCAGCTGTGGCAGTGCAGG - Intergenic
1137065522 16:35837735-35837757 AGGCTCAGCTCTGCCTGCTCTGG + Intergenic
1139150860 16:64380948-64380970 AGCTGCAGCTGTGCCTGGGAGGG - Intergenic
1139641120 16:68292304-68292326 AGGAGCAGGTGTGCCTTTCCTGG + Intronic
1142207747 16:88792017-88792039 AGGAGCAGCGGTGGCTGCTCGGG + Intergenic
1142449598 16:90167244-90167266 GGGAGGAGCTGTGCCTGTTGAGG - Intergenic
1142457491 17:64601-64623 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
1144254901 17:13458164-13458186 AGTGGCAGCTGTGTCTGTTTCGG - Intergenic
1150005845 17:61468483-61468505 AGATGCAGGTGTGGCTGTTGGGG + Intronic
1151455199 17:74221777-74221799 AGGTTCAGCTGTCCCTGGTGGGG + Intronic
1152456520 17:80420048-80420070 AGGTTCAGCTGTTGCTGCTCTGG + Intronic
1152772530 17:82179111-82179133 AGGTGCAGCTGGGCCTGGACTGG - Exonic
1158875888 18:61734220-61734242 GGGGGCAGCTGTCCCTGATCAGG + Intergenic
1159868069 18:73729356-73729378 AGATGCAGCAGTTCTTGTTCAGG - Intergenic
1164911142 19:32012921-32012943 GGGTGTAGCAGTGCCTCTTCTGG - Intergenic
1166784152 19:45357734-45357756 GGGTGCAGCTGTGGCTGTAGTGG - Intronic
1167292009 19:48629696-48629718 GGGTGCATCTGTGCCTGTAGCGG - Exonic
1168648968 19:58080683-58080705 AGGGGCAGCTGGGCTGGTTCAGG - Intronic
1202700271 1_KI270712v1_random:158971-158993 AGGTGCTGATGTGCATGTCCAGG + Intergenic
925426396 2:3751938-3751960 AGGCACAGCTGTGACTGTGCAGG - Intronic
926721524 2:15965033-15965055 AGGTGTGGCTGTGTCTGCTCAGG - Intergenic
927419943 2:22920046-22920068 AGGTGCACGTGTGCCTGCTTTGG - Intergenic
928593276 2:32838389-32838411 TGGTGCTGCGGTTCCTGTTCAGG + Intergenic
928987487 2:37195643-37195665 AGGTAGATCTGTGCCTGTTTTGG + Intronic
929194124 2:39167218-39167240 AGGTGATGCTGTGCCATTTCTGG - Intergenic
932584947 2:73021902-73021924 AGGGGCAGCTGTGCCTATGTGGG - Intronic
934055843 2:88250892-88250914 AGGAGCAACTGTGCATGTGCAGG + Intergenic
934154404 2:89182444-89182466 AGCTGCAGCTGGTCTTGTTCTGG + Intergenic
934171204 2:89542447-89542469 AGGTGCTGATGTGCATGTCCAGG + Intergenic
934281510 2:91616765-91616787 AGGTGCTGATGTGCATGTCCAGG + Intergenic
936890225 2:117360477-117360499 AGTCTCAGCTGTGCCTGTTGTGG - Intergenic
937361277 2:121231683-121231705 ACCTGCAGCTGTGGCTGTCCGGG - Intronic
939623051 2:144444582-144444604 AAGTGCAGATAGGCCTGTTCAGG - Intronic
940225406 2:151395959-151395981 TGGTTCATCTGTGCATGTTCAGG + Intergenic
941644310 2:168023962-168023984 AGGTGCAGCTGTTAGTGTCCAGG + Intronic
941665671 2:168241967-168241989 AGTTGCAGCAGTGCCGGCTCTGG - Intronic
945692839 2:213063157-213063179 AGCTGCAGCTGAGCCACTTCTGG + Intronic
946239218 2:218343696-218343718 AGGTGGAGCTGTGTCGCTTCTGG - Intronic
948380496 2:237547145-237547167 CGGGCCCGCTGTGCCTGTTCAGG - Intronic
948877393 2:240836933-240836955 AGGAGCAGCTGGTCCTGGTCCGG - Intergenic
1168983519 20:2027352-2027374 AGCTGCAGCTGTGCCTGGGAGGG + Intergenic
1169595304 20:7191715-7191737 AGGAACAGCTCTGCTTGTTCAGG - Intergenic
1170521501 20:17190428-17190450 TCCTGCAGCTGTGCTTGTTCTGG - Intergenic
1170609738 20:17902730-17902752 CGGTGCAGATGTGGCTGCTCTGG + Intergenic
1171457411 20:25279823-25279845 AGGTGAGGCTGTACCTGTTGTGG + Intronic
1173166297 20:40689225-40689247 CGGTGCAGCTGTGCTGGATCCGG + Exonic
1176278670 20:64288499-64288521 GGGAGGAGCTGTGCCTGTTGAGG - Intergenic
1176364826 21:6026489-6026511 AGGACCAGCTGTGCCAGGTCCGG - Intergenic
1178828471 21:36035125-36035147 AGGGGCTGCTGGTCCTGTTCAGG - Exonic
1179089950 21:38255755-38255777 AAGTGCAGCTGCTGCTGTTCTGG - Intronic
1179758692 21:43512056-43512078 AGGACCAGCTGTGCCAGGTCCGG + Intergenic
1181547131 22:23608426-23608448 AGGTGCAGAGGTGGCTGATCAGG - Intergenic
1184090686 22:42291523-42291545 AGCAGCAGCAGTGCCTGTGCTGG + Intronic
1184940697 22:47762511-47762533 AGTTGAAGCTGTGCATGTTGAGG - Intergenic
1184976146 22:48063881-48063903 AGGTGGTTCTGTGCCTCTTCTGG + Intergenic
950682363 3:14594053-14594075 AGGTGCAGCCCTGCCTTTTGGGG + Intergenic
951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG + Exonic
953573909 3:44097565-44097587 AGGAACAGCTGTATCTGTTCAGG + Intergenic
954862765 3:53704137-53704159 AGGTGCAATTGTGCCTCTTCTGG + Intronic
955209822 3:56930090-56930112 AGGTGCAACTGTGACTGATGAGG - Intronic
956517690 3:70067707-70067729 AGCTGCAGCTGTGCCTGTACTGG + Intergenic
957787855 3:84905021-84905043 GGATGCAGCTGTGCCTGTGAGGG - Intergenic
961179666 3:124866720-124866742 AGCTGCAGGTGTGGCTGGTCAGG - Intronic
967588210 3:191239857-191239879 AGGAGTAGTTGAGCCTGTTCAGG + Intronic
968046163 3:195624866-195624888 AGGAGCCGCTGTGCGCGTTCAGG + Intergenic
968308491 3:197665221-197665243 AGGAGCCGCTGTGCGCGTTCAGG - Intergenic
968459544 4:717747-717769 AGGTGCAGGAGGGCGTGTTCTGG + Intronic
969028565 4:4193441-4193463 AGGTGCTGATGTGCATGTCCAGG - Intronic
974179060 4:58360918-58360940 AGCTGCAGCTGTGCCTGGGAGGG + Intergenic
977816353 4:101417358-101417380 AGGTGCAGGTGTGCCTGGGAGGG + Intronic
978378800 4:108104853-108104875 AGTTGGAGGTGTGCCTTTTCAGG + Intronic
978663527 4:111155061-111155083 AGCTGCAGCTGTGCCTGGGAGGG + Intergenic
979258939 4:118631552-118631574 GGGAGGAGCTGTGCCTGTTGAGG - Intergenic
979329415 4:119409005-119409027 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
981617010 4:146652865-146652887 GGATGGAGCTGTGGCTGTTCTGG + Intergenic
983508422 4:168581100-168581122 AGGTGCAGGGGTACATGTTCAGG - Intronic
985493385 5:191894-191916 AGGTGCAGCGGTGCCCGTGCGGG + Exonic
985747148 5:1654009-1654031 AGGAGCCGCTGTGCGCGTTCAGG - Intergenic
991531432 5:67619568-67619590 TGGCTCAGCTGTGCCTCTTCAGG + Intergenic
997403094 5:133617588-133617610 AAGTGCAGCTGTGTGTGTGCTGG - Intergenic
997594201 5:135095407-135095429 AGAAGCGGCTGAGCCTGTTCTGG - Intronic
997785966 5:136714197-136714219 AGGTTCAGAGGTGCATGTTCAGG + Intergenic
998211034 5:140198577-140198599 AAGTGATGCTGTGCCAGTTCTGG - Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1001682770 5:173570835-173570857 AACTGCAGCTGACCCTGTTCTGG - Intergenic
1001766047 5:174247982-174248004 GGGCACAGCTGAGCCTGTTCAGG + Intergenic
1002293008 5:178212387-178212409 AGATGCAACTGTGCCTATTTAGG + Intronic
1002729524 5:181325166-181325188 GGGAGGAGCTGTGCCTGTTGAGG - Intergenic
1002754450 6:146748-146770 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
1004415902 6:15423868-15423890 TGGTGCTGCTGTGCCTTTGCAGG + Intronic
1005790469 6:29295398-29295420 GGCTGCAGCTGTGCCTAGTCGGG - Intergenic
1006797789 6:36742264-36742286 AGGTTCAGATGTGCGTGTGCAGG + Exonic
1007325374 6:41055439-41055461 AGGTGCAGCTGGGTCTGTGCAGG + Intronic
1013047514 6:106502059-106502081 GGCTGTAGCTGTGCCTGGTCGGG + Intergenic
1019183658 6:170208526-170208548 ATTTGCAGCTGTTCCTGTGCTGG + Intergenic
1019187929 6:170231785-170231807 AGGAACAGCTGTGGCTCTTCTGG - Intergenic
1019402828 7:866363-866385 AGTGGCAGCTGTTCCTGCTCGGG + Intronic
1019554802 7:1623927-1623949 AGAGGCAGCTCTGCCTGTGCAGG + Intergenic
1020005933 7:4783797-4783819 AGGTGAGGCTGGGACTGTTCTGG + Exonic
1023966223 7:44964277-44964299 AGGAGCAGCTGGGCCTGGGCTGG + Intronic
1024073652 7:45807634-45807656 CGGTGGAGCTGTGCCTGTGGAGG - Intergenic
1024649489 7:51391598-51391620 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
1024649686 7:51392566-51392588 CGGTGGAGCTGTGCCTGTGGAGG + Intergenic
1025053569 7:55746928-55746950 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
1025053763 7:55747896-55747918 CGGTGGAGCTGTGCCTGTGGAGG + Intergenic
1025131670 7:56377402-56377424 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
1025131868 7:56378370-56378392 CGGTGGAGCTGTGCCTGTGGAGG + Intergenic
1025182474 7:56830467-56830489 GGGAGGAGCTGTGCCTGTTGAGG + Intergenic
1025689455 7:63746527-63746549 GGGAGGAGCTGTGCCTGTTGAGG - Intergenic
1026014563 7:66662930-66662952 ATGTGCAGGTGTGCGTGTGCAGG + Intronic
1027318704 7:76999297-76999319 AGGTGCAGCTGTGCGCCCTCAGG + Intergenic
1029918047 7:104231933-104231955 AGTTGCAGCCGTTCCTGTTGCGG - Intergenic
1030848977 7:114459163-114459185 AAGTGCTGCTTTGCCAGTTCTGG - Intronic
1031265195 7:119572456-119572478 AGCTGCAGCTGTGCCTGGGAGGG - Intergenic
1035107724 7:156456307-156456329 AGGTGCAGCTGTGACTTTGGTGG + Intergenic
1036212162 8:6851248-6851270 ATGTGCAGGTGTGCATGTGCAGG - Intergenic
1036968162 8:13324015-13324037 AGGTGCCACTGAGCCTGTTGGGG + Intronic
1036990486 8:13587154-13587176 ATGTGCATCTGTGCATGTACAGG - Intergenic
1037469390 8:19192677-19192699 AGGAGCAGCAGTGTCTGTTTTGG - Intergenic
1037478438 8:19280194-19280216 AGGTGTAGGTGTGTCTGATCCGG + Intergenic
1038446881 8:27610708-27610730 AAGTGCAGCAGTGCCTGCTGTGG - Intronic
1042860544 8:73308928-73308950 TGGTGCTGCTGTGGCTGCTCGGG - Intronic
1043359044 8:79449039-79449061 AGGGGTAGCTGTGCATTTTCTGG + Intergenic
1048167887 8:132079818-132079840 AGGAGCAGCTGTCTCTGTCCAGG + Exonic
1048230576 8:132636583-132636605 TGCTGCAGCTGAGCCTGGTCAGG - Intronic
1048622930 8:136154334-136154356 AAGTCCAGCTGCGTCTGTTCTGG + Intergenic
1048976704 8:139677211-139677233 GGCTGCACCTGTGCCTGTGCTGG + Intronic
1049758747 8:144322403-144322425 AGGGGCAGATGTGCGTGTGCGGG - Intronic
1049798286 8:144506332-144506354 AGGTCCAGCAGGGCCTGTCCTGG - Exonic
1050675935 9:8053266-8053288 ATGGGCAGCTGTGGCTGCTCAGG + Intergenic
1051846350 9:21455520-21455542 GTGTGCAGCTGTGGCTCTTCTGG + Intergenic
1056963919 9:91150355-91150377 AGGTGACTCTGTGCCTGTTCTGG + Intergenic
1057274898 9:93670973-93670995 AGGTGCAGCTGTGTCTGTTCAGG + Intronic
1057443301 9:95097168-95097190 AGGCTCACCTCTGCCTGTTCTGG + Intergenic
1059886113 9:118746382-118746404 AGCTGCATCTGGGCCTGTTGAGG - Intergenic
1062615080 9:137392682-137392704 AGGGGGTGCTGTGTCTGTTCTGG + Intronic
1062635317 9:137487481-137487503 ATGTGCAGCTGTGTCTGTGCAGG + Intronic
1203577495 Un_KI270745v1:20435-20457 GGGAGGAGCTGTGCCTGTTGAGG - Intergenic
1185643645 X:1601561-1601583 AGGTACTGCGGTGCCTGCTCGGG - Exonic
1192553242 X:72070183-72070205 AGGTGTAGGTGTACATGTTCAGG - Intergenic
1193494330 X:82191911-82191933 AGGTTCAGGTGTGCATGTGCAGG + Intergenic
1197680150 X:129374224-129374246 AGGAGTAGCTGTTCCTATTCTGG - Intergenic
1200651720 Y:5848136-5848158 TGCTGCAGCTGTCCATGTTCAGG - Intergenic
1201892226 Y:18955141-18955163 AGGTTCAGCAGTGCATGTGCAGG - Intergenic