ID: 1105278374

View in Genome Browser
Species Human (GRCh38)
Location 13:18949148-18949170
Sequence CAGGGCCCGGGAGGTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105278374_1105278379 -8 Left 1105278374 13:18949148-18949170 CCAATGCCACCTCCCGGGCCCTG 0: 1
1: 1
2: 2
3: 38
4: 368
Right 1105278379 13:18949163-18949185 GGGCCCTGTCTCAGACACACTGG 0: 1
1: 0
2: 0
3: 26
4: 269
1105278374_1105278383 10 Left 1105278374 13:18949148-18949170 CCAATGCCACCTCCCGGGCCCTG 0: 1
1: 1
2: 2
3: 38
4: 368
Right 1105278383 13:18949181-18949203 ACTGGACTGCGCCGCATTTCGGG 0: 1
1: 0
2: 1
3: 2
4: 28
1105278374_1105278385 30 Left 1105278374 13:18949148-18949170 CCAATGCCACCTCCCGGGCCCTG 0: 1
1: 1
2: 2
3: 38
4: 368
Right 1105278385 13:18949201-18949223 GGGTTTCACACGAACTGAACAGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105278374_1105278382 9 Left 1105278374 13:18949148-18949170 CCAATGCCACCTCCCGGGCCCTG 0: 1
1: 1
2: 2
3: 38
4: 368
Right 1105278382 13:18949180-18949202 CACTGGACTGCGCCGCATTTCGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105278374 Original CRISPR CAGGGCCCGGGAGGTGGCAT TGG (reversed) Intergenic
900122694 1:1055615-1055637 CAGGGCCTGGGGTGTGGCAGAGG - Exonic
900123576 1:1059646-1059668 CGTGGCCCGGGGCGTGGCATCGG + Intergenic
900699285 1:4034115-4034137 CAGGGCCAGGCATGGGGCATGGG + Intergenic
900784150 1:4637158-4637180 CAGGTTCCGGCAGGTGGCTTGGG - Intergenic
900819266 1:4873649-4873671 CTGTGCACGGCAGGTGGCATTGG - Intergenic
901064223 1:6486986-6487008 CAGGGTCCGTGAGATGGCTTTGG + Intronic
901311479 1:8272414-8272436 CAGGCCTCAGGAGGTGGCCTCGG - Intergenic
901320930 1:8339410-8339432 CAGCCGCCGGGAGGTGGCACTGG + Intronic
901646252 1:10718279-10718301 CAGGGCCGAGGAGGTGGGAGTGG - Intronic
901812695 1:11776816-11776838 CAGGCCCTGGGAGGTGGCCTAGG + Intronic
902393582 1:16120074-16120096 CAGGGCCTGGGATGGGGCCTTGG - Intergenic
902649895 1:17830152-17830174 AAGGGCCCTGGAGGTGGGAGAGG - Intergenic
902660251 1:17895962-17895984 CAGGGCCAGGGTGATGGCATTGG + Intergenic
903134898 1:21302960-21302982 CCAGGCCCGGGGGGTGGCAGGGG - Intronic
903231845 1:21927051-21927073 CAGGGACCCGGAGGTGGGCTGGG + Intronic
903646843 1:24901309-24901331 CAGGGCGGGGGAGGGGGGATAGG - Exonic
903658894 1:24965097-24965119 CAGGGCCCTGGAGGCGGCAAGGG + Intronic
904533289 1:31182641-31182663 CAGGGCCCGGCAGGGGGCGGAGG - Intronic
904635522 1:31877965-31877987 CAGGTCCTGGGAAGTGGCACAGG - Intergenic
904806950 1:33138867-33138889 GAGGTCCAGGGAGGTGGCAGGGG + Intergenic
905277983 1:36831335-36831357 GAGGGACCTGGAGGTGGCAAGGG - Intronic
906266736 1:44436852-44436874 CAGGCCCAGGGAGGTGCCAGGGG - Intronic
907318477 1:53587886-53587908 CTGTGCCTGGGAGGTGGCTTGGG + Intronic
907525717 1:55052832-55052854 CCTGGCCTGGGAGGTGGCTTGGG + Intronic
908445586 1:64196567-64196589 CAGGGCCTGGGGTGTGGCAGAGG + Intergenic
909473438 1:76055669-76055691 CAGGTCCCTGGAGGTTTCATTGG + Intergenic
912444138 1:109721616-109721638 GAGGGCCAGGGAGTTGGCCTTGG + Intronic
913063785 1:115231344-115231366 CAGGGACCCTGAGGTGACATGGG - Intergenic
913509797 1:119551298-119551320 CAGGGCCTGGGTGATGGCACAGG - Intergenic
915169732 1:153969254-153969276 CAGGGCCTGGGTAGTGGCACAGG - Intronic
915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG + Intronic
915324687 1:155075266-155075288 CAGGGCTTGGTGGGTGGCATTGG - Intergenic
917517759 1:175722140-175722162 GAGGGCCCGGAGGGTGGCAATGG - Intronic
918136176 1:181675812-181675834 CAGAGCCCGGGAGGCTGCAAAGG - Intronic
918141871 1:181726592-181726614 AAGGGCCAGGGAGGGGGCAGGGG + Intronic
918373547 1:183885335-183885357 CAGGTACTGGGAGGGGGCATAGG - Intronic
919727767 1:200895090-200895112 GAGGGCGGGGGAGGTGGAATGGG + Intronic
919747773 1:201019524-201019546 CTGGGCCAGGGAGGTGGCAGAGG - Intronic
919924597 1:202185884-202185906 CAGGAGCCCGGAGCTGGCATGGG - Intergenic
920229375 1:204460499-204460521 CAGGGCTGGGGAGGTGGAATGGG - Intronic
920235123 1:204497761-204497783 CAGGGCCCAGGTGTTGGCAGAGG + Intergenic
920436057 1:205947903-205947925 CAGGGCCAGGGTGGAGGGATAGG - Intergenic
921127351 1:212189443-212189465 CTGGGCCTGAGAGGTGGCCTCGG + Intergenic
921360465 1:214326765-214326787 GAGGGTCAGGGAGGTGACATTGG + Intronic
922562084 1:226576729-226576751 CAGGGCCTGGGAGGGGGGAGTGG - Intronic
922731793 1:227952328-227952350 CAGCGCCAGGGAGGAGGCGTGGG + Intergenic
924942242 1:248820243-248820265 CAGGGCCCCAGAGGAGGCATAGG + Intronic
1063094608 10:2898696-2898718 CAGGGCTTGGGAGCTGGCAGGGG - Intergenic
1067078651 10:43202028-43202050 CAGGGCCTGGGGTGTGGCTTGGG - Intronic
1068061150 10:52069037-52069059 CAGGGCCTGGCATGTGGCACAGG - Intronic
1068132590 10:52913018-52913040 CAGGGGCTGGGAGGTGGAAATGG + Intergenic
1069370882 10:67746715-67746737 CAAGGCCCTGATGGTGGCATGGG - Intergenic
1070751886 10:78968699-78968721 CAGGGCCTGGGAGCTGGCCAGGG + Intergenic
1072563254 10:96596341-96596363 CAGGGCCAGTGAGGAGGCAGAGG - Intronic
1073072510 10:100803535-100803557 CAGGGCCCAGGAGAGGGCAGTGG - Intronic
1073151982 10:101318226-101318248 CAGGGCCCGCGGGGAGGCAGGGG - Intergenic
1073180385 10:101579720-101579742 CAGGGCCAGGGCGGCGGCACCGG - Exonic
1073596851 10:104809311-104809333 CAGGGCCAGTTAGCTGGCATGGG - Intronic
1074564753 10:114567249-114567271 CAGGGACCGGAACATGGCATCGG + Intronic
1075551358 10:123395135-123395157 CAGAGACAGGGAGGAGGCATAGG - Intergenic
1075719168 10:124574948-124574970 GAGGGCCCGGCAGGAGGCAGAGG - Intronic
1076268837 10:129132870-129132892 GAGACCCAGGGAGGTGGCATGGG - Intergenic
1076280396 10:129241943-129241965 AAGGGCCCGTGAGGGGGCGTGGG - Intergenic
1076536074 10:131178556-131178578 CAGGGCCTGGGAAGAGGCACAGG + Intronic
1077141074 11:1025148-1025170 GAGGGCCTGGGAGGAGGCAGAGG + Intronic
1077163036 11:1122214-1122236 GAGGGCCTGGGATGTGGCCTTGG + Intergenic
1078189033 11:9076213-9076235 CAGGGGCAGGGAGGAGGCAGAGG + Intronic
1078582237 11:12547435-12547457 CAGGGCCCAGCAAGTGGAATAGG - Intergenic
1079071801 11:17353543-17353565 CCGGGCCCGGGAGGGGGCGCGGG - Intronic
1079266361 11:18936865-18936887 CAGGGACCAGGGGCTGGCATTGG - Intronic
1079281575 11:19091429-19091451 CAGGGACCCGGAGGTGGAAAGGG - Intergenic
1079809473 11:24978906-24978928 CAGGGGTTGGGAGGTGGAATTGG - Intronic
1081447568 11:43145497-43145519 CAGGGCCGGGAAGGGAGCATAGG + Intergenic
1083657030 11:64234677-64234699 CAGGGCTCGGGAGGGGGCCGCGG + Exonic
1083891855 11:65599543-65599565 CAGGGCGCGGGCGTTGGCGTGGG + Exonic
1084038656 11:66529201-66529223 GTGGGCCCTGGAGGTGGCTTGGG + Intronic
1084074439 11:66762213-66762235 CAGGGCCCGCGAGGCCGCAGGGG + Intronic
1084396175 11:68911937-68911959 CAGGGGCCTGGAGTTGGCCTGGG + Intronic
1084768761 11:71329134-71329156 CTCAGCCCGGGAGGTGGCAGTGG - Intergenic
1085186373 11:74579277-74579299 CAGGGCCAGGGAGGGCGGATTGG + Intronic
1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG + Intronic
1085390735 11:76180864-76180886 CAGGCCCCAGGAGCTGGCTTTGG + Intergenic
1087651739 11:100875716-100875738 CAGGGCCTGGGGTGTGGCAGAGG + Intronic
1089261685 11:117228091-117228113 AAGAGCCTGGGAGGTGGGATGGG - Intronic
1089873854 11:121701227-121701249 CAGGGTCCGTGAGGCGCCATTGG - Intergenic
1089924203 11:122240222-122240244 CAGGGGACAGGAGGTGGCAGGGG - Intergenic
1090472244 11:126990487-126990509 CAGAGCCCGGGAGGTCCCTTAGG - Intronic
1092070249 12:5626175-5626197 GAGGGCCAGGGAGGTGAAATAGG + Intronic
1092257974 12:6937353-6937375 GAGGGCCCCGCAGGTGGCAGGGG - Exonic
1092965980 12:13642841-13642863 CAGGGCCATGGAGCTGGCTTTGG + Intronic
1093110471 12:15145522-15145544 CAGAGCCAGGGAGCTAGCATCGG - Intronic
1093461508 12:19411367-19411389 CAGGGCACGGGATGTGGTAGAGG - Intronic
1094494886 12:30983014-30983036 CATGGCCCAGGAGCAGGCATGGG - Intronic
1095443704 12:42264005-42264027 CAGGGACTGGGAGGTGGGGTTGG - Intronic
1095702061 12:45200893-45200915 CAGGAACCGGGATGTGGCGTGGG + Intergenic
1096191683 12:49623736-49623758 GAGAGCCCGGGAGGGGGGATGGG + Intronic
1096388208 12:51209294-51209316 CAGGGCTTGGGCGGTGGCAGTGG - Intronic
1096441437 12:51646851-51646873 CAGGGCCAGGGAGATGGAAGCGG + Intronic
1096539234 12:52295530-52295552 CAGGGCCCTGCAGAGGGCATGGG - Intronic
1096649051 12:53053040-53053062 CAGGGCCCTGGAGCTGGCTTGGG + Intronic
1097157489 12:57023496-57023518 CAAGGCCGGGGAGGGGGCAGGGG - Intronic
1101173059 12:102119932-102119954 CGGGCCCCGGGAGGTGGGAGCGG - Intronic
1102128079 12:110501912-110501934 CAGGGCCCAGGCGCTGGCCTGGG - Intronic
1102370814 12:112381620-112381642 GAGGGCCCGGGTGGTGGCGGTGG + Intronic
1103595599 12:122022712-122022734 CCGGGCCCGGGAGGCGGGAGCGG - Intronic
1103704823 12:122865836-122865858 CAGGGCCCAGCAGGGGGCAGTGG - Exonic
1103935879 12:124476243-124476265 GAGGGCCTGGGCGGTGGCGTGGG - Intronic
1104011095 12:124930756-124930778 CTGGGGGTGGGAGGTGGCATGGG - Intergenic
1104148283 12:126056238-126056260 CAGGACCCAGGAGCTGGCCTGGG - Intergenic
1104795071 12:131511630-131511652 CAGGGCCTAGGAGGTGGTCTGGG - Intergenic
1105278374 13:18949148-18949170 CAGGGCCCGGGAGGTGGCATTGG - Intergenic
1107879096 13:44817486-44817508 GTGGCCCCAGGAGGTGGCATTGG - Intergenic
1108404024 13:50081775-50081797 CGGGACTCGGGAGGTGGCAGTGG - Intergenic
1108484401 13:50909936-50909958 CAGCGCCCGGGAGGAGGCCCAGG - Exonic
1109128652 13:58551321-58551343 CAGTGCCGGGGGGGTGGAATTGG + Intergenic
1110868608 13:80424233-80424255 CAGGGCCCTGGATCTGGCCTAGG + Intergenic
1112954156 13:105039144-105039166 CAGGGACTCGGAGGTGGAATAGG - Intergenic
1113835202 13:113324493-113324515 CAGGGCCCGGCTGCTGGCACAGG - Intronic
1115511040 14:34138139-34138161 CAGGGTTAGGGAGGTGGGATGGG + Intronic
1115648665 14:35387642-35387664 CAGGGCCAGGCATGTGGAATGGG + Intergenic
1118035532 14:61862273-61862295 CAGGGTCCGGGAGGTGGGAGAGG - Intergenic
1118357592 14:65027478-65027500 CAGAGCCCAGAAGGTGGCTTTGG + Exonic
1118482074 14:66177360-66177382 CAGGGACGGGGAGGTGGAACAGG - Intergenic
1118746233 14:68775529-68775551 CAGGGACTGGCAGGTGGAATTGG - Intergenic
1119440919 14:74628207-74628229 AAGGGCAAGGGAGATGGCATGGG + Intergenic
1119769899 14:77214027-77214049 CAGGGGACAGGAGGTGGCCTGGG - Intronic
1119793638 14:77376765-77376787 CAGGGCCCGGGTGGTGGCAGCGG + Intronic
1119842607 14:77804597-77804619 CAGGGGCTGGGAGGTGGTGTTGG + Intronic
1120521263 14:85530467-85530489 CAGGGTCAGGGAGGTGGAAAGGG - Exonic
1120978985 14:90274339-90274361 CAGGGACGGGGTGGTGGCAGGGG + Exonic
1121339280 14:93095443-93095465 CAGGGCCCAGAAGCTGGCTTTGG - Intronic
1121583251 14:95046131-95046153 CAGAGGCCGGGAGGCAGCATAGG - Intergenic
1122214546 14:100194167-100194189 CATGGCCTGGGAGCTGACATGGG - Intergenic
1122264205 14:100539130-100539152 CAGGTCGCGGGCGGAGGCATCGG + Exonic
1122464145 14:101918655-101918677 CAGTGCCCGGGAGGGGGCGAGGG - Intronic
1123062742 14:105601648-105601670 CAGAGTCACGGAGGTGGCATTGG + Intergenic
1123224011 14:106883349-106883371 CAGGGCCCTGTAGGTGACAGTGG - Intergenic
1124249297 15:28096777-28096799 CGGGGCCCGGGAGAGGGCCTCGG + Intronic
1124484203 15:30101225-30101247 CAGGGCCCGGCAGGAGGCCAGGG - Intergenic
1124519379 15:30395999-30396021 CAGGGCCCGGCAGGAGGCCAGGG + Intergenic
1124539276 15:30570222-30570244 CAGGGCCCGGCAGGAGGCCAGGG - Intergenic
1124626287 15:31309271-31309293 CAGGGCCAGGGAAGTGGCTCAGG - Intergenic
1124759374 15:32437350-32437372 CAGGGCCCGGCAGGAGGCCAGGG + Intergenic
1124785959 15:32680705-32680727 TGGGGGCCAGGAGGTGGCATGGG + Intronic
1124893707 15:33756874-33756896 CAGGGACCGGGAGAAGGCACAGG + Intronic
1125751676 15:42033541-42033563 CAGGCACCTGGAGGAGGCATTGG + Intronic
1125761954 15:42102990-42103012 CTGGGCCTTGCAGGTGGCATAGG - Intergenic
1128459145 15:67853017-67853039 CATGGTCTGGGAGGTGGCAGGGG - Intergenic
1128529129 15:68432033-68432055 CAGGGGCCTGGTGGTGGCCTGGG - Exonic
1129324590 15:74793435-74793457 CAGGCCCCAGGAGTTGCCATGGG - Intronic
1129379141 15:75154535-75154557 CTGGGCATGGGAGGGGGCATGGG - Intergenic
1130096656 15:80861246-80861268 CAGGGACAGGGAGGAGGAATGGG - Intronic
1130894221 15:88157998-88158020 CCGGGCCCGTGAGGTGCCAAAGG - Intronic
1131180115 15:90233759-90233781 CAGGGTCCGGGAGCTGGCTGCGG - Intronic
1131829834 15:96347261-96347283 GAGGGCCAGGGAGGTGGGAACGG - Intergenic
1132114563 15:99126075-99126097 GAGGCCCCTGGGGGTGGCATGGG + Intronic
1132379054 15:101353445-101353467 CATGGACCGGTAGGTGGGATGGG + Intronic
1132739374 16:1403830-1403852 CAGGGCCCTGGACGCGGCTTGGG + Intronic
1132771594 16:1566730-1566752 CAGGGTCCCGGAGGTGCCATGGG - Intronic
1132830869 16:1927431-1927453 TTGGGCTGGGGAGGTGGCATTGG + Intergenic
1132873276 16:2124887-2124909 CGGGGCCTGGCAGGGGGCATGGG - Intronic
1132904907 16:2277614-2277636 CACGGCCCGGCAGGTGGTAATGG + Exonic
1133887807 16:9846911-9846933 CAGGGCCTTGGAGGTGGCCATGG + Intronic
1133973054 16:10580688-10580710 CACGGCCCGGGAGGCGGGATCGG - Exonic
1134552363 16:15144066-15144088 CGGGGCCTGGCAGGGGGCATGGG - Intergenic
1134763532 16:16735149-16735171 CTGGGCCCGGCCGGTGACATTGG + Intergenic
1134849433 16:17468855-17468877 CAGAGCCCAGGAGGTGGGGTGGG - Intronic
1134982520 16:18624008-18624030 CTGGGCCCGGCCGGTGACATTGG - Intergenic
1135490424 16:22904712-22904734 CAGAGCCCAGGAGGGGCCATGGG + Intronic
1136020861 16:27438903-27438925 AAGGGCCTGGGAGGTGGCTTTGG + Intronic
1136317659 16:29463778-29463800 CTGGGCCAGGGAGGTAGGATGGG - Intronic
1136432234 16:30203123-30203145 CTGGGCCAGGGAGGTAGGATGGG - Intronic
1137531380 16:49280895-49280917 CAGGGCCCGGCACGAGGCGTCGG + Intronic
1137665935 16:50249061-50249083 CAAGGCCTGGGAGGTGGGAGTGG - Intronic
1138530732 16:57632979-57633001 AAGGGCCTGGGAGGTGGCAGAGG - Intronic
1140478104 16:75249023-75249045 CTGGGCAGAGGAGGTGGCATGGG + Intronic
1141622013 16:85241355-85241377 GAGGGCCTGGGAGGTAGCACAGG - Intergenic
1142136225 16:88453179-88453201 CAGGGCCCGGCAGGAGGCACGGG + Intergenic
1142212733 16:88816175-88816197 CAGTGCCCAGGAGATGGCAGTGG + Intronic
1142251610 16:88994374-88994396 CCAGGACCGGGCGGTGGCATGGG + Intergenic
1142468167 17:147637-147659 CAGAACCTGGGAGGGGGCATGGG - Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143521531 17:7446956-7446978 CAAAGCCCGGGAGGTGGCGCGGG + Intronic
1143838573 17:9712470-9712492 CAGGGCCCGGGAGATAGGACGGG + Intronic
1144560440 17:16316665-16316687 CAGGGCCCTGGAGGAGGGATAGG - Exonic
1146290662 17:31604652-31604674 CTGGGCCCAGGTGTTGGCATTGG + Intergenic
1146835383 17:36106610-36106632 CCGAGCCTGGGAGCTGGCATTGG - Intergenic
1147717801 17:42519950-42519972 CAGGGGCTGGGAGGTGGCTGGGG - Intronic
1148111127 17:45145019-45145041 TAGGGCCCAGGTGGTGGCAGCGG - Intergenic
1148444746 17:47730795-47730817 CAGGGCCCGGGAGGAGGGTGAGG + Intergenic
1148565803 17:48632246-48632268 CAGGGCCAGGGAGGTGCCTCGGG + Intronic
1148878623 17:50707859-50707881 CGCGGCCCGGGAGGAGGCCTGGG - Exonic
1148885027 17:50766193-50766215 CTGGGCCCTGGAGGTGGCTCAGG + Intergenic
1149606875 17:57931404-57931426 CAGTGCCCGGCATGTGGCAGTGG - Intronic
1149658298 17:58321697-58321719 CAGGGCCTGGGCGGTGGCCTGGG - Intronic
1151293152 17:73164908-73164930 CAGGACCCGGGAGGAGGGGTTGG + Intergenic
1151351023 17:73532299-73532321 CAAGGCCCTGGAGGTGGGAATGG - Intronic
1152314245 17:79571067-79571089 CAGGGCCGGGGACGTGGAACTGG - Intergenic
1152353967 17:79797868-79797890 CAGGGCCCGGAGGGTGGCCGAGG - Intronic
1152371012 17:79888650-79888672 AAGGGCCCGGGATGTGACAGAGG - Intergenic
1152558037 17:81064281-81064303 CACAGCCGGGGAGGTGGCCTCGG + Intronic
1152633191 17:81419904-81419926 CAGGGCCCGGGAGCCGGGAGAGG - Intronic
1152723192 17:81932809-81932831 GAGGGGCCGGGAGGGGGCGTGGG + Intronic
1152795639 17:82304736-82304758 TGGGGCCCGGGAGCTGGCGTTGG - Intergenic
1152911186 17:83005779-83005801 CAGGGCCCGGGAGGGGGTCAAGG - Intronic
1154218190 18:12431236-12431258 CAGGGCCGGGGAGGAGGATTAGG + Exonic
1154338683 18:13485589-13485611 CTGGGCCCGGGGCGTGGCCTGGG + Intronic
1155838049 18:30612332-30612354 CATGGCACAGGAGGTAGCATAGG - Intergenic
1155963939 18:32018907-32018929 CAGGGCCCGCGCGGTGGCAGAGG - Exonic
1157568758 18:48698327-48698349 GAGGGCCCAGCAGCTGGCATGGG + Intronic
1157801493 18:50625169-50625191 CAGGGCACAGGGGGAGGCATGGG + Intronic
1158627815 18:59087005-59087027 TAAGGCCCGGGAGATGGAATAGG + Intergenic
1160540100 18:79616705-79616727 CAGGGCCCGGGAGCTCGGAGTGG - Intergenic
1160810805 19:1012224-1012246 CAGGGCCCAGGGGGTGGCCTGGG - Intronic
1160914877 19:1491605-1491627 CAGCGCCCGGAAGGAGGCGTCGG - Intronic
1161265425 19:3361324-3361346 ACGGGCCCGGGAGGTGGCTAAGG + Intronic
1161427196 19:4210151-4210173 CTGGGCACGGGAGGAGGCATGGG + Intronic
1162155047 19:8671839-8671861 CAGGGCCAGGAATGTGGCAGGGG + Intergenic
1162502388 19:11061309-11061331 AAGGGCCAGGCAGGTGACATGGG + Intronic
1162904036 19:13812982-13813004 CAGGGCCCCTGAGGAGGCACGGG - Exonic
1163668332 19:18613349-18613371 AGGAGCCCGGGAGGTGGTATCGG - Intronic
1164941207 19:32253281-32253303 GAGGGCCCAGGGGGTGGAATTGG - Intergenic
1165114999 19:33523319-33523341 CTGGGACCGGGAGGTGGGAGGGG - Intergenic
1165213815 19:34254961-34254983 CGGGGCCCGGGAGGTCGCGCTGG + Intronic
1166583406 19:43923753-43923775 CAGGGGCTGGGAGGGGGAATGGG - Intronic
1167113090 19:47473409-47473431 AAGGGCCAGGCAGGTGGCCTGGG + Intergenic
1167685449 19:50953024-50953046 CAGAGCCCAGGAGGAGGCAGTGG - Exonic
1168149688 19:54438940-54438962 CAGGGCCAGGATGGTGGCCTGGG - Intergenic
924994842 2:350111-350133 CAGGGCCAGGGAGAGGGCAGGGG - Intergenic
925328142 2:3038700-3038722 CAGGCCCGTGGAGGTGGCAATGG + Intergenic
925368513 2:3327095-3327117 CAGGGGCCGGGAGATGGGGTGGG + Intronic
925919345 2:8628381-8628403 CAAGGCCTGGGAGGTGGCTTAGG + Intergenic
925969267 2:9095709-9095731 CAGGGGCAGGGTGGTGGCAGGGG - Intergenic
926678916 2:15649477-15649499 CAGGGCACAGGAGGTGGTGTGGG - Intergenic
927201833 2:20582946-20582968 CAGGGCCTGGTAAGTGGCAGAGG - Intronic
927509079 2:23633065-23633087 CAGGGCCAGGCAGGTGGGATGGG + Intronic
927638940 2:24834745-24834767 CAGGGCCCGGGAGGAGTGGTGGG + Intronic
927712933 2:25336780-25336802 TAGTGCCCGGGAGGTGGACTGGG - Intronic
927842403 2:26454045-26454067 AAGGGCCTGGGAGGTGGCACTGG + Intronic
927869102 2:26612590-26612612 CAGGGCCAGGCAGTTGGCAGTGG - Intronic
931749804 2:65320435-65320457 GAGGGCTGGGGAGGTGGGATGGG - Intronic
931803283 2:65779354-65779376 CAGGGCTTGGCAGGTGGCAGAGG - Intergenic
932566518 2:72914606-72914628 CAGGGCAGGGGAGATGGCACAGG + Intergenic
932809987 2:74817042-74817064 CAGGGCCAGGCAGGTGGCTGGGG - Intergenic
934748400 2:96775225-96775247 CAGGGACTGGGAGGGTGCATGGG - Intronic
934985043 2:98879013-98879035 CAGGGCCAGGGTGGTGGTAATGG - Intronic
937249048 2:120511789-120511811 CAGGGCCCGGGGCTTGGCAAGGG + Intergenic
947525008 2:230872336-230872358 AAGGGCCCGGGGGAAGGCATAGG + Intronic
948122589 2:235542298-235542320 CAGGGCCAGGGACTTGGCCTTGG + Intronic
948658657 2:239492619-239492641 CAGGGGGGCGGAGGTGGCATAGG + Intergenic
948828882 2:240587739-240587761 AAGGGCCTGGGAGGAGGCAAGGG + Intronic
948899112 2:240947269-240947291 CAGGGCCCAGGAGGGAGCATGGG - Intronic
1169006025 20:2207676-2207698 CAAGGCCCGGGCGGCGGCAGGGG + Intergenic
1169032085 20:2417448-2417470 CTGGGCCCGGGAGGTGAGGTTGG - Exonic
1169367095 20:5001022-5001044 CAGAGCCCGGGAGGAGGCGGCGG + Intronic
1169490459 20:6067226-6067248 CGGGGCCGGGGAGGGGCCATGGG - Intergenic
1170368052 20:15618684-15618706 CAGGGGTCAGGAGGTGGCTTGGG - Intronic
1172607333 20:36222789-36222811 CAGGGCCAGGAACGTGGCACTGG - Intronic
1172962785 20:38810296-38810318 CAAGGCCAGGGAGGTAGCAGAGG + Intronic
1173190953 20:40875278-40875300 CAGGCCCAGGGAGGGGCCATGGG - Intergenic
1174107221 20:48171324-48171346 CAGGGAGAGGGAGGTCGCATGGG + Intergenic
1174870167 20:54174187-54174209 CTGGGCGCGGGAGGTGGGGTGGG + Intergenic
1175297443 20:57918723-57918745 TGGGGCCCAGGAGGTGGCACAGG - Intergenic
1175311058 20:58011811-58011833 CAGGGCAGGGGAGGTGACAAGGG + Intergenic
1176001221 20:62832151-62832173 CAGGGTCCGGGAGGTGCCGCAGG + Exonic
1178513965 21:33230420-33230442 CAGGGCCCGGGAGGGGTCCTGGG - Intronic
1180051840 21:45335183-45335205 CAGGTCCGGGGAGGGGGCACAGG - Intergenic
1180051948 21:45335446-45335468 CAGGTCCGGGGAGGGGGCACAGG - Intergenic
1180051981 21:45335521-45335543 CAGGCCCGGGGAGGGGGCACAGG - Intergenic
1180748965 22:18111301-18111323 CAGGGCCCGGAATGTGACAGAGG + Intronic
1180843635 22:18970431-18970453 CAGGGCGCGGGAGGCGGCGGCGG - Intergenic
1181266839 22:21635452-21635474 CAGGGCCCCTGAGGTGGCCCTGG - Intronic
1181307181 22:21923413-21923435 CAGCGCCCGGGAAGCTGCATCGG + Exonic
1181456044 22:23060789-23060811 CAGGGCCTGGCACGTGGCAGGGG + Intronic
1181545517 22:23599993-23600015 CAGGCCCCAGGAGGTGTCAGAGG + Intergenic
1181583973 22:23842836-23842858 CAATGCCAGGGAGGTGGCATGGG - Intergenic
1182087511 22:27571525-27571547 CAAGGCTAGGGAGGTGGCCTAGG - Intergenic
1182301939 22:29341900-29341922 CATGGCCCTGTAGGTGGTATAGG - Intronic
1183493415 22:38128521-38128543 CAGGGCCTGGGAGCTGGGACAGG - Intronic
1184133765 22:42533895-42533917 CTGGGCCAGGGAGGAGGCCTAGG - Intergenic
1184273207 22:43396533-43396555 CAGGGGCCGGGTGGTGACCTCGG - Intergenic
1184412568 22:44333371-44333393 AGGGGCCCAGGATGTGGCATCGG - Intergenic
1184596287 22:45516140-45516162 CAGGGCATGGGAGGTGGGCTAGG + Intronic
1184911289 22:47536008-47536030 CCAGGCAGGGGAGGTGGCATCGG - Intergenic
1185110905 22:48899650-48899672 CGGGGCCTGAGAGGTGCCATGGG - Intergenic
1185392510 22:50570297-50570319 CTGGGCGCTGGAGGTGGCTTTGG - Exonic
949807043 3:7966827-7966849 CAGGTACTGGGAGGTGGCAGAGG - Intergenic
950462830 3:13135479-13135501 CAGGGCCCAGGAGGTGACATGGG + Intergenic
950501926 3:13369979-13370001 CTGAGCCTGGGAGGTGGCAGAGG + Intronic
953118752 3:40018637-40018659 CTGGACCAGGGAGGTGGCAGTGG - Intronic
953733293 3:45468498-45468520 CAGGGGCAGGGAGGTGACATAGG + Intronic
953837747 3:46361988-46362010 CAGATCAAGGGAGGTGGCATGGG - Intergenic
954712552 3:52512336-52512358 CACTGCCCGGCAGGTGGCCTGGG - Exonic
956701467 3:71962853-71962875 TGGGGACCTGGAGGTGGCATGGG - Intergenic
961744244 3:129053651-129053673 CAGGGGCCGTGAGGGGGCAGGGG - Intergenic
961818644 3:129564144-129564166 CAGGGCCTGGGAGGGGCCATTGG - Intronic
962445071 3:135456519-135456541 CAGGGCCCTGGAGGAGGAACGGG + Intergenic
963091512 3:141487319-141487341 GCGGGCCCGGGAGGGGGCCTGGG + Intronic
964357643 3:155865113-155865135 CAGGGCAAGGGAGGTTGCAGTGG + Intergenic
967135785 3:186511641-186511663 CAGGGCCAGGGACATGGGATGGG - Intergenic
969276104 4:6136955-6136977 GAGGCTCAGGGAGGTGGCATGGG + Intronic
969907505 4:10410846-10410868 CAGGGCCCGGGAGCTGGGTGTGG + Intergenic
979099933 4:116600222-116600244 CAAGGCCGGGGTGGTGGGATGGG - Intergenic
979633827 4:122934408-122934430 CAGAGCCCTGGAGATGGCAGTGG + Exonic
984973540 4:185210304-185210326 CGGGGCGCGGGAGCTGGCACCGG - Intronic
986722874 5:10572508-10572530 CAGGTTCAGGGAGGTGCCATAGG + Intronic
987023774 5:13902379-13902401 CAGAGCCTGGGGGGTGGCACTGG + Intronic
989507681 5:42246300-42246322 CAGGGCCCTTTAGGTGACATGGG - Intergenic
989563870 5:42881393-42881415 CAGGGCCTGGGAGATGGCCTGGG + Intronic
992190375 5:74285747-74285769 CTGTGCCAGGGAGGTGGCACAGG + Intergenic
997470167 5:134113245-134113267 CTGGGGCTGGGGGGTGGCATGGG - Intergenic
998002995 5:138639449-138639471 CAGGGCCCAGGAGCAGGCAAGGG - Intronic
1001217046 5:169865887-169865909 CCGGCCCTGGGAGGTGACATGGG - Intronic
1001273284 5:170331814-170331836 CAGGGCTGGGGATGTGCCATGGG - Intergenic
1001590466 5:172861115-172861137 CAGGGAGGGGCAGGTGGCATGGG - Intronic
1002081897 5:176742326-176742348 CAGGCACCAGGTGGTGGCATTGG + Intergenic
1002314412 5:178333895-178333917 CAGGGCCCGTGAGGTAGCCAAGG + Intronic
1002574207 5:180162269-180162291 CTGGGCCATGGATGTGGCATTGG + Intronic
1003427696 6:6008661-6008683 CAGGGCCAGGAAGGCTGCATGGG - Intergenic
1004272872 6:14211055-14211077 AGGGGCCCGGGAGGAGGCGTGGG - Intergenic
1005946977 6:30602316-30602338 GAAGGCCCTGGCGGTGGCATGGG - Exonic
1006233991 6:32611570-32611592 TAGAGCCCAGGAGGTGGCAGAGG - Intergenic
1006364404 6:33606937-33606959 CAGGGCCTGGGTGCTGGGATTGG - Intergenic
1006865834 6:37208301-37208323 CTGGGCCAGGGAGGTGGCAGGGG + Intergenic
1006923545 6:37641366-37641388 AAGGGACAGGGAGGGGGCATTGG + Intronic
1006941410 6:37754077-37754099 CAGGGAGCGGGGGGTGGCCTGGG + Intergenic
1007211898 6:40199226-40199248 CAGGGACCGGAAAGTGGCACGGG - Intergenic
1007249000 6:40482933-40482955 CAGGGACAGGGAGCTGGCAGTGG - Intronic
1007498348 6:42277282-42277304 CAGGGCCCTGGAGGTGGAGCAGG - Intronic
1007498618 6:42279175-42279197 CAGGGCCCAGGAGGTGCAGTAGG + Intronic
1010221366 6:73451766-73451788 CAGGGCCCGGGCGGAGGTCTTGG + Exonic
1015372007 6:132464876-132464898 CAGGGGCCTGGAGGTGGAACGGG + Intronic
1017118989 6:151006185-151006207 CAGGGCCGGGAGGGTGGGATGGG + Intronic
1018993587 6:168693166-168693188 CAGGGGCCGGGAGATGGAATTGG + Intergenic
1018993760 6:168694865-168694887 CAGGGGCCGGGAGATGGAATTGG - Intergenic
1019019933 6:168910041-168910063 CAGCGTCGTGGAGGTGGCATCGG + Intergenic
1019195436 6:170279350-170279372 GAGGGCTGGGGAGGTGGCAGGGG - Intergenic
1019383933 7:742982-743004 CTAGGCCAGGGAGGTGACATGGG - Intronic
1019574975 7:1733277-1733299 CAGTGCCCGACAGGTGGCCTTGG + Intronic
1020257008 7:6508103-6508125 CAGGGCACGGGTGGGGGCAGGGG + Exonic
1020347779 7:7183213-7183235 GAGGGCCCGGGAGGAGGGACTGG - Intronic
1021782509 7:24119786-24119808 CAGGGCCCAGGAGGTCTAATGGG + Intergenic
1022129189 7:27388375-27388397 CAGGGCCAAGCAGGTGGCTTTGG - Intergenic
1023731704 7:43197891-43197913 CAGGCCCCTGGAGCTGGCACTGG + Intronic
1026000486 7:66556774-66556796 CAGGGCCCTGGAGGTGGACTCGG + Intergenic
1026015247 7:66666857-66666879 CAGGGGCAGGGAGCTGGCACTGG + Intronic
1026891646 7:73985995-73986017 CAGGGGCAGGGAGCTGGCACCGG + Intergenic
1026906440 7:74065637-74065659 CAGGGCCTGACAGGTGGCATTGG + Intronic
1026964622 7:74431271-74431293 CAGGGTCCTGTAGGTGGCACTGG - Intergenic
1027152110 7:75739745-75739767 CAGGTCCCGGGAGGTGCCCGCGG - Intergenic
1028891320 7:95991525-95991547 CAGGACCTGGGAGCTGGCAAAGG - Intronic
1029114407 7:98229913-98229935 AAGGGCCCGGCAGGGGACATGGG - Intronic
1030227548 7:107169414-107169436 CGGGGGCCGGGAGGAGGCAGGGG + Intronic
1032025815 7:128441447-128441469 CAGATCCCTGGAGGTGGGATGGG + Intergenic
1034466391 7:151232498-151232520 CAGGGGCTGTGAGGTGGCAGCGG + Exonic
1034992567 7:155557516-155557538 AAGGGGCCGCGAGGTGGCAGAGG - Intergenic
1035171495 7:157019675-157019697 ATGGGGCCGGGAGGTGGCAGTGG - Intergenic
1036101275 8:5788523-5788545 CAGCGCCCTGGAGGTGGAACTGG + Intergenic
1036653937 8:10663441-10663463 CAGGCCCCTGGAGATGGCAAGGG - Intronic
1037470287 8:19201943-19201965 CAGGGCTGGGGAGGTGGAGTTGG - Intergenic
1037754579 8:21702748-21702770 CATGGCACCGGAAGTGGCATGGG - Intronic
1038324740 8:26564355-26564377 CAGGGCCAGGGAGATGGGAACGG + Intronic
1039476445 8:37841613-37841635 CAGGGCCCGGGGCGGGGCATGGG - Exonic
1039542254 8:38382038-38382060 GAAGGCTCGGGAGGTGGGATGGG + Exonic
1039612948 8:38933420-38933442 CAGTGCCCTGCAAGTGGCATGGG - Intronic
1040276319 8:46015884-46015906 CAAGGCCCAGGAGGGGGCCTGGG - Intergenic
1040471465 8:47738336-47738358 CAGGGCCGGGGAGGGGGCCCCGG - Exonic
1041722871 8:60992101-60992123 CTGGGCCCAGGGGATGGCATGGG - Intergenic
1044828403 8:96220784-96220806 CAGGAAGCAGGAGGTGGCATGGG - Intergenic
1047204623 8:122793284-122793306 CAGGGACCAGGAAGTGGCCTGGG + Intronic
1048439904 8:134452203-134452225 CAGGGCCAGTGAGGTGGCAGGGG + Intergenic
1048603735 8:135946190-135946212 CAGGGGCCTGGAGATGGCAAGGG + Intergenic
1048945470 8:139443163-139443185 CAGGGACCCGGAGGTGGCCGTGG + Intergenic
1049194100 8:141306174-141306196 CGAGGCCCGGGAGGTGGCCCTGG + Intronic
1049354373 8:142180250-142180272 CAGGACCCGGGCGGTGACAGGGG + Intergenic
1049442252 8:142614779-142614801 CAGCGCCCGGGAGGGGGCGTGGG - Intergenic
1049575249 8:143386846-143386868 CAGTGCCCTGGAGGTGGCTAAGG - Intergenic
1049583563 8:143423152-143423174 CAGGGCCCGGGAAGTGGGACCGG - Intronic
1049607338 8:143535884-143535906 AAGGGCCCTGGAGGAGGCAGAGG + Intronic
1049656813 8:143802677-143802699 CAGGGCCCCTGGGATGGCATGGG + Intronic
1052173341 9:25427882-25427904 CAGGGGCAGGGAGCTGGCAGGGG - Intergenic
1052472854 9:28922005-28922027 CAGGGCCTGGGGGAGGGCATGGG - Intergenic
1056220480 9:84446563-84446585 GAGGCCTTGGGAGGTGGCATGGG - Intergenic
1057274583 9:93669587-93669609 CAGGGCCTGGGAGGTGGCATTGG + Intronic
1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG + Intronic
1057903095 9:98964685-98964707 CATGACCCGGAAGATGGCATGGG - Intronic
1060221459 9:121766223-121766245 AAGGGCCGGGCAGGTGGGATGGG - Intronic
1060299872 9:122368946-122368968 CAGGGAAGGGGAGCTGGCATGGG - Intergenic
1060773135 9:126347168-126347190 CAGGGCCCTTGAGGGGGCAGAGG + Intronic
1060828774 9:126701055-126701077 CAGGGCCCGGGTGGAGGAAGGGG + Intergenic
1061052801 9:128205966-128205988 CAGGGCAGGGGAGGGGGCTTAGG + Intronic
1061227930 9:129291440-129291462 CCTGCCCCGGGAGGTGGCACAGG + Intergenic
1061295092 9:129672575-129672597 CAGGGGCCGTGAGGTGGCCCGGG + Intronic
1061516115 9:131091465-131091487 CAGGGGCTGGGAGGTGCCCTGGG + Intronic
1061874263 9:133536046-133536068 CGGGGATCGGGAGGCGGCATAGG + Intronic
1062016453 9:134293576-134293598 CAGGACCCGGGGGGTGGCTGGGG + Intergenic
1062255247 9:135617755-135617777 CCGGGCCTGGGAGGTCGCAGAGG + Intergenic
1062263749 9:135677125-135677147 CAGGACCCAGGAGCTGGCATGGG + Intergenic
1062309584 9:135928773-135928795 AGGAGCCCGGGAGGTGGCACTGG + Intergenic
1062422190 9:136488154-136488176 CAGGGCCCAGGAGGCAGCCTTGG + Intergenic
1062476315 9:136729065-136729087 CGGGGTGCGGGAGCTGGCATAGG + Intergenic
1188619682 X:32204894-32204916 CAGGGCCTGGTAGGTGTGATTGG - Intronic
1189204508 X:39226385-39226407 AAGGGCCTTGGAGGTGGGATGGG + Intergenic
1189324706 X:40105456-40105478 CAGGGCCCGGGTGGTCGCCTGGG - Intronic
1192177642 X:68895810-68895832 CGGGGGCAGGGAGGTGGGATGGG - Intergenic
1195352204 X:104006263-104006285 CAGGGGCAAGGAGGTGGTATGGG + Intergenic
1200067583 X:153511455-153511477 CAGGGCCCCAGCTGTGGCATAGG + Intergenic
1200085571 X:153602864-153602886 CAGGGCCAGGGAGGGAGCACAGG + Intergenic
1200247660 X:154534612-154534634 CAAGGCACGGGAGGTGGCCACGG - Intronic
1200773889 Y:7152383-7152405 AGGGGCCGGGGAGGTGGAATGGG + Intergenic