ID: 1105280734

View in Genome Browser
Species Human (GRCh38)
Location 13:18961138-18961160
Sequence CAGAGGGAAGTGCCCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 322}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105280734_1105280741 8 Left 1105280734 13:18961138-18961160 CCCATCCTGGGCACTTCCCTCTG 0: 1
1: 0
2: 1
3: 35
4: 322
Right 1105280741 13:18961169-18961191 AAGCTCAGGACTTCACATTTAGG 0: 1
1: 0
2: 2
3: 14
4: 167
1105280734_1105280744 18 Left 1105280734 13:18961138-18961160 CCCATCCTGGGCACTTCCCTCTG 0: 1
1: 0
2: 1
3: 35
4: 322
Right 1105280744 13:18961179-18961201 CTTCACATTTAGGGAGCAATGGG 0: 1
1: 1
2: 1
3: 18
4: 131
1105280734_1105280742 9 Left 1105280734 13:18961138-18961160 CCCATCCTGGGCACTTCCCTCTG 0: 1
1: 0
2: 1
3: 35
4: 322
Right 1105280742 13:18961170-18961192 AGCTCAGGACTTCACATTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 157
1105280734_1105280743 17 Left 1105280734 13:18961138-18961160 CCCATCCTGGGCACTTCCCTCTG 0: 1
1: 0
2: 1
3: 35
4: 322
Right 1105280743 13:18961178-18961200 ACTTCACATTTAGGGAGCAATGG 0: 1
1: 0
2: 2
3: 10
4: 138
1105280734_1105280739 -6 Left 1105280734 13:18961138-18961160 CCCATCCTGGGCACTTCCCTCTG 0: 1
1: 0
2: 1
3: 35
4: 322
Right 1105280739 13:18961155-18961177 CCTCTGCCAGAGTCAAGCTCAGG 0: 1
1: 1
2: 1
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105280734 Original CRISPR CAGAGGGAAGTGCCCAGGAT GGG (reversed) Intergenic
900351795 1:2238511-2238533 CAGAGGGAAGTCTCAAGGCTGGG - Intronic
900563382 1:3319731-3319753 CAGAGGAAAGAGCCCCAGATTGG - Intronic
900878260 1:5361602-5361624 CAGAAGCATGTGCCCTGGATGGG + Intergenic
901671422 1:10858338-10858360 AAGAGGGAAGTGCCTGGGAGGGG + Intergenic
901931740 1:12600409-12600431 CATAGGGAAGTGGCCCGGAGAGG + Intronic
902222790 1:14977465-14977487 CACAGGTCAGTGCCCAGGACAGG - Intronic
903177709 1:21590547-21590569 CAGACGGAAGCGCCCAGCACAGG + Intergenic
904613870 1:31739429-31739451 CAGGGGGAGGGGCCCAGGAACGG - Exonic
905111114 1:35595179-35595201 CAGAGAGAAGTGGGCAGGAGGGG + Exonic
905457295 1:38096990-38097012 CAGAGGGAAGTGCTGAGGCCTGG + Intergenic
907871702 1:58449449-58449471 CAGATGGAACTTCCCAGGATGGG + Intronic
907947352 1:59147555-59147577 CAGAGGAAAACGCCCTGGATTGG - Intergenic
908815486 1:68028568-68028590 GAGAGGGAAGTGCCTAGCAAAGG + Intergenic
910376859 1:86581996-86582018 GAGAGGGAAGTAACCAGGCTGGG - Intergenic
911358494 1:96849149-96849171 CACATGGAAGTGCCAAGGTTTGG - Intergenic
912381731 1:109251179-109251201 TAGAGGCAAGTGACCAGGGTCGG + Exonic
914389699 1:147208834-147208856 CACAGGTATGTTCCCAGGATGGG - Exonic
914988061 1:152476549-152476571 CACAGGGCAGTGCCCAGGTGGGG + Intergenic
915020642 1:152775740-152775762 TAAAGGGCAGAGCCCAGGATGGG + Intronic
915165212 1:153944521-153944543 CAGGGGGAAGAGTTCAGGATTGG - Intronic
915480041 1:156178214-156178236 GAGAGAGATGTGGCCAGGATGGG - Intergenic
915905313 1:159872793-159872815 CAGAGGGATGAGCCCTGGGTGGG + Intronic
916628777 1:166589174-166589196 CAGAGAGAAGTTACCAGGTTGGG - Intergenic
917567577 1:176229231-176229253 CAGAGGGAAGAAACCAGGAGTGG + Intergenic
918744727 1:188184858-188184880 CAGAGGTTGGTGCCTAGGATGGG + Intergenic
920077018 1:203344605-203344627 AAGAGGGAAGTGGCGAGGAGAGG + Intronic
920534686 1:206729839-206729861 TGGTGGGCAGTGCCCAGGATAGG + Intronic
921049669 1:211502013-211502035 CACAGGGAGGTGCCCAGCCTCGG - Intergenic
921317999 1:213909971-213909993 GAGAGGGAAGAGCACTGGATAGG + Intergenic
923106950 1:230861733-230861755 CAGAGGGAGCTGTCCAGCATGGG + Intronic
1062772729 10:115929-115951 CTGGGGGAGGTGCCCAGAATGGG + Intergenic
1063573052 10:7234413-7234435 CACAGGTATGTGCCCAGGATGGG + Intronic
1064181040 10:13115948-13115970 AAGAGGGAACTGCCAAGGAAAGG + Intronic
1065249419 10:23795665-23795687 CAGAAGGAAGTTCTCAGGTTTGG + Intronic
1065389522 10:25168483-25168505 GAAAGGAAAATGCCCAGGATTGG + Intergenic
1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG + Intergenic
1067695657 10:48533976-48533998 GAGAGGGCCGTGCCCAGGAGGGG + Intronic
1068656743 10:59583709-59583731 AAGAGGGTTGTGGCCAGGATGGG - Intergenic
1069915229 10:71783078-71783100 TAGGGGGAAGGGCCCAGAATGGG - Intronic
1070326554 10:75393335-75393357 CAGCGGGATGAGCCCTGGATTGG + Intergenic
1070556153 10:77529284-77529306 CAGAGGGAATAGCACAGGAAAGG - Intronic
1070654787 10:78263894-78263916 GAGAGGGAAGGGCGCAGGATTGG - Intergenic
1070955630 10:80461579-80461601 AAGTGGCATGTGCCCAGGATGGG + Intronic
1071737311 10:88316301-88316323 CAGAGGGAAGGACTCAGGAGTGG + Intronic
1072546323 10:96442264-96442286 CTGAGGGAAGCGCCCAGTTTCGG - Intronic
1073074415 10:100814846-100814868 AAGAGGGAAGTGCCCAAGGCAGG + Intronic
1073593387 10:104777387-104777409 CAGTGGGAAGTGCACAGCCTGGG - Intronic
1075928395 10:126272000-126272022 CAGAGGGAAGAGCCCAGTCAAGG - Intronic
1076207753 10:128616605-128616627 GAGAGAGAAGTGCCCAGCAAAGG - Intergenic
1076873842 10:133206455-133206477 CACAGGGCAGTGCCCAGCTTGGG - Intronic
1076909163 10:133378950-133378972 CAGAGGGAAGCGCCCCGCGTGGG - Intergenic
1076909453 10:133379767-133379789 CAGAGGGAGGGGCGCAGGGTGGG - Intronic
1078580752 11:12537883-12537905 CAGAGGGAAGTGTCAAGGCTTGG - Intergenic
1079421415 11:20293020-20293042 TAGAAGGAAGTGCCCAAAATTGG + Intergenic
1079451043 11:20599908-20599930 CCGAGGACAGTGCCCGGGATCGG - Intronic
1080023609 11:27590732-27590754 CAAAGGGAAGTGACAAAGATGGG + Intergenic
1082695293 11:56356231-56356253 AAGAGGGAGGTGCATAGGATGGG + Intergenic
1083824186 11:65188999-65189021 AGGAGGGAAGGGCCCAGGAAAGG - Intronic
1084266058 11:68005700-68005722 GTGATGGAAGAGCCCAGGATGGG - Intergenic
1084607171 11:70179205-70179227 CAGAGAGCAGGCCCCAGGATTGG + Intronic
1085198777 11:74688820-74688842 CAGAGGGCATGGCCCAGGGTGGG - Intergenic
1086495955 11:87404695-87404717 AAGAGGGAAGTGCCAAGTATGGG + Intergenic
1086816155 11:91373687-91373709 GAGAGGGAAGTGTCCAGCAGAGG - Intergenic
1087730152 11:101769176-101769198 CATAGGGAACTGCCCAAGACTGG + Intronic
1088596886 11:111447833-111447855 CAGAGAGAAATGCCCAGGAAGGG - Intronic
1089603340 11:119628001-119628023 CAGGGGGATGGGCCCAGGAGGGG - Intronic
1089787161 11:120915939-120915961 CAGTGAGAAGAGCCCAAGATTGG - Intronic
1090840735 11:130486119-130486141 AAGAGTGCAGAGCCCAGGATGGG - Intergenic
1092778900 12:11967279-11967301 CAGAGGGAAATGGCCAGGTGCGG - Intergenic
1093561465 12:20546448-20546470 CAGAGGTCAGTGCTCTGGATTGG - Intronic
1093570341 12:20660165-20660187 AAGAGAGAAGTGCCAAGGAAAGG - Intronic
1094357662 12:29595553-29595575 TTGAGGGCAGTGCCCAGGAAGGG - Intronic
1095653906 12:44647130-44647152 TAGAGGGAAATGCCAAGGAGTGG + Intronic
1096180280 12:49546813-49546835 CAAAGCCAAATGCCCAGGATAGG - Intronic
1096585591 12:52617745-52617767 CAGAGGCAAGGGACCAGGGTTGG - Intronic
1097188331 12:57207736-57207758 CAGTGGGAAGTGGCAAGGATGGG - Intronic
1097210381 12:57363940-57363962 AAGAGGAAACTGTCCAGGATGGG - Intronic
1097572872 12:61355879-61355901 CAGAGAGGAGTGCACAGAATGGG + Intergenic
1098607332 12:72407498-72407520 CAGAGGAAAGTGTCAAGGAGAGG + Intronic
1098761736 12:74433917-74433939 GAGAGGGAAGTGCCAAGCAAAGG - Intergenic
1100217895 12:92471560-92471582 TAGAGGAAAATGACCAGGATAGG + Intergenic
1102746437 12:115253156-115253178 GAGAGGGCAGAGCCCAGGAATGG - Intergenic
1104210752 12:126685961-126685983 GAGAGGGAGAGGCCCAGGATGGG - Intergenic
1105280734 13:18961138-18961160 CAGAGGGAAGTGCCCAGGATGGG - Intergenic
1105291345 13:19055661-19055683 AACAGGGAAATGCCCAGGACAGG - Intergenic
1106335254 13:28777900-28777922 CAGTGGGAAGTGCCCTGGTGGGG + Intergenic
1106391444 13:29338963-29338985 CAGTGGGAAGTGCCCTGGTGGGG + Intronic
1106466669 13:30019917-30019939 CAGGGGGAATTGCCCGGGGTGGG + Intergenic
1106493366 13:30249716-30249738 AAGAGGTAAGTGGCAAGGATTGG + Intronic
1106686340 13:32064167-32064189 CAGAGGGGAGTACCAAGGAGTGG + Intronic
1107736274 13:43401631-43401653 GAGAGGGAAGTGCAAAGGCTGGG + Intronic
1107869626 13:44734921-44734943 AAGAGGGGAGGACCCAGGATTGG - Intergenic
1108587775 13:51885742-51885764 CAAAGGGAAGTGCCTAGGAGGGG - Intergenic
1112851220 13:103708793-103708815 CAAAGGGAGGTGCGCAGGAGAGG + Intergenic
1113902981 13:113806745-113806767 CAGAGAGAAGCCCCCAGGACAGG - Intronic
1114645150 14:24251940-24251962 CTGAGGGAAATTCCCAGGAAGGG + Intronic
1114754877 14:25247757-25247779 CAAAGGGAAGGGTCCAGCATTGG - Intergenic
1117014960 14:51508684-51508706 GAGAGGGGAGTGCTCAGGATGGG - Intronic
1117062776 14:51980318-51980340 CAGTGGACAGTGCCCAGGCTTGG + Intergenic
1118349792 14:64965569-64965591 CAGAGAGAAGAGCCAAGGAGAGG + Intronic
1121258648 14:92550131-92550153 AAGATGGAAGTGCCCAGAGTGGG - Intronic
1122389141 14:101368365-101368387 CAGAGGGAAGTGACGGGGCTGGG + Intergenic
1123137261 14:106039548-106039570 CAGAGGGGAGTGCAAAGGTTAGG - Intergenic
1123754453 15:23386055-23386077 GGGAGGGCAGTGCCCAGCATGGG - Intergenic
1128058514 15:64718517-64718539 CAGAGCCCCGTGCCCAGGATGGG - Intergenic
1128091981 15:64925475-64925497 TAGAGGGAAGTGGCCTGGGTTGG - Intronic
1128610797 15:69071572-69071594 CAGAGTGAAGTGGCAGGGATGGG + Intergenic
1129085310 15:73083365-73083387 TAGAGGGAGATGCCAAGGATGGG + Intronic
1130551223 15:84891036-84891058 GATAGGAAAGGGCCCAGGATGGG + Intronic
1132474304 16:125739-125761 CAGAGGGAAGTGCCCAAGCCTGG + Intronic
1132646802 16:1003002-1003024 CGGAGGGCAGTGCCCAGGGCTGG + Intergenic
1133218960 16:4310239-4310261 CAGTGGGAAGTGCACAGAAAGGG - Intergenic
1134042792 16:11081156-11081178 CAGAGGGATCTGCCAAGGACAGG - Intronic
1134461916 16:14436938-14436960 GGGAGGGCAGTGCCCAGCATGGG + Intronic
1135094840 16:19556201-19556223 CTGAGGGCTGTGCCTAGGATAGG - Intronic
1135187398 16:20327165-20327187 GATAGGGAAGCACCCAGGATTGG + Intronic
1135868947 16:26131128-26131150 CAGAAAGAAGTGCTCAGAATAGG - Intronic
1136143640 16:28302593-28302615 CAGAGGAAAGTGCCAGGGAGGGG - Intronic
1136682032 16:31973374-31973396 CAGAGGGCAGTGCCCAGATAAGG - Intergenic
1136782340 16:32914876-32914898 CAGAGGGCAGTGCCCAGATAAGG - Intergenic
1136887449 16:33938975-33938997 CAGAGGGCAGTGCCCAGATAAGG + Intergenic
1139407485 16:66730583-66730605 CAGAAGGCAGAGCTCAGGATGGG + Intronic
1139464657 16:67147935-67147957 CAGGGGCCAGTGCCCAGGGTTGG - Exonic
1140796389 16:78442465-78442487 TAGAGGGCAGTTCCCAGGAGGGG - Intronic
1140900613 16:79363960-79363982 CAGAGGGAACTGCACAGAAGAGG - Intergenic
1141012178 16:80412898-80412920 CAGAGGTAAGTGTTCAGGACTGG - Intergenic
1141854129 16:86669604-86669626 CTGAGGACTGTGCCCAGGATGGG - Intergenic
1203085004 16_KI270728v1_random:1178863-1178885 CAGAGGGCAGTGCCCAGATAAGG - Intergenic
1143115561 17:4580102-4580124 CCCAGGGCAGTGCCCAGGAGAGG - Intergenic
1143472419 17:7184242-7184264 CAGAAGGAAGTACCCAGGCCTGG + Intergenic
1144573739 17:16416281-16416303 CAGAGGGAAGTGGAGAGGGTAGG - Intronic
1144743412 17:17597038-17597060 CAGAGCTAGGTGCCCAGGACAGG - Intergenic
1144758221 17:17693122-17693144 CAGAGGCATCTGCCCAGGGTGGG + Intronic
1147217443 17:38908909-38908931 CAAAGGGGACTGCCCAGGCTGGG + Intronic
1147677679 17:42219134-42219156 CTGGGGGAGGTGCACAGGATGGG + Intronic
1147688357 17:42300437-42300459 CTGGGGGAGGTGCACAGGATGGG - Intronic
1150851077 17:68704172-68704194 CAGAGGAAAGTGATGAGGATGGG + Intergenic
1150925380 17:69526982-69527004 CAGAGGGAAGACCTCAGGATAGG + Intronic
1151593458 17:75062256-75062278 CAGAGGCAACTGCCCAGGGAAGG - Intronic
1152434871 17:80270259-80270281 ACAAGGGAAGTGCCCAGGATAGG - Intronic
1152477375 17:80526937-80526959 CAGGGCTAAGGGCCCAGGATGGG - Intergenic
1154312034 18:13274253-13274275 CAGAGGGAGGAGGCCTGGATGGG + Intronic
1156373031 18:36488510-36488532 CTGAGTGCAGTGCCCAGGAAAGG + Intronic
1157184220 18:45524435-45524457 GAGAGGGATGTGCCCTTGATGGG + Intronic
1157192042 18:45589810-45589832 AAGAGGGAAGTGGCAAGGCTGGG + Intronic
1157231574 18:45921522-45921544 ATGAGAGAAGTGCCCAGGAATGG - Intronic
1157853593 18:51082754-51082776 GAGAGGGAAGAGACCAGGAGGGG - Exonic
1159112275 18:64073333-64073355 CATAGGGCAGAGTCCAGGATGGG + Intergenic
1159521203 18:69527409-69527431 GAGAGGGAAGTGCCAAGCAAAGG + Intronic
1160791048 19:923922-923944 CAAAGGGAAGGGCACAGGGTGGG - Intergenic
1160848921 19:1180427-1180449 CCGAGGGAGGTGCCCAGGGAGGG + Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161167957 19:2798611-2798633 CATTGGGAATTGCCCAGCATGGG + Intronic
1162054845 19:8056333-8056355 CAGAGGGGGGTGCCCAGGTTAGG - Intronic
1162339591 19:10084394-10084416 CTGAGGGAAGTGGCGAGGTTTGG - Intergenic
1163279736 19:16308399-16308421 CTGAGTGAAATGCCCAGAATAGG + Intergenic
1163327008 19:16611097-16611119 AAGAGGGAAATGGCCAGGGTTGG + Intronic
1163648084 19:18501654-18501676 CAGTGGGAAGTGCCTGGGATTGG - Intronic
1163722703 19:18905821-18905843 CTGGGGGAGGTACCCAGGATGGG + Intronic
1163774868 19:19212150-19212172 CAGGGAGAAGTCCCCAGAATGGG + Intronic
1164201796 19:23025254-23025276 CTGAGGAAAGAGCCCAGGAAGGG + Intergenic
1164522677 19:28990919-28990941 CAGAGGGAAGGGCCAAGCTTGGG + Intergenic
1164729266 19:30490117-30490139 CAGAGAAAAGTGCACATGATTGG + Intronic
1164998901 19:32744658-32744680 GAGAGGGAACTGCCCAGGGCAGG - Intronic
1165273812 19:34732127-34732149 CAGAGGGCAGGGCCCAGGGCAGG - Intergenic
1168065018 19:53914399-53914421 TAGAGGGGAGACCCCAGGATGGG - Intronic
1168655121 19:58121932-58121954 CAAAGTGAAGTGCCCAGCCTGGG + Intergenic
925192237 2:1893923-1893945 CTGAGGACAGTGCCCAGGCTGGG + Intronic
925237422 2:2292021-2292043 CAGAGAGCAGCGCCCTGGATGGG - Intronic
926060158 2:9800187-9800209 GATAGGGAACTGCCCAGAATTGG - Intergenic
926216599 2:10909451-10909473 CAGAGGAAAGAGTCCAGGATTGG - Intergenic
926299182 2:11590050-11590072 GAGAGGAAAGTGCCAAGGTTTGG + Intronic
928123747 2:28602277-28602299 CAGAAGGCAGTGCCCAGCCTGGG - Intronic
929588919 2:43132828-43132850 CAGTGGGAAGTGCACAGGCCCGG - Intergenic
930615125 2:53585566-53585588 CAGAGGGAAGAGACAAGGAGGGG - Intronic
930972609 2:57415386-57415408 CAGAGGGGAGTGAGGAGGATAGG - Intergenic
932401248 2:71482475-71482497 CACAGGGAAGCGCCCAGGCCGGG - Intronic
933778138 2:85784126-85784148 CAGGGGGAAGGTCTCAGGATAGG - Intronic
933993893 2:87653524-87653546 CAGAGAACAGTGCCCAGGACAGG + Intergenic
934989486 2:98911354-98911376 CAGAGGGATGTGGACAGGGTCGG + Intronic
935452208 2:103222775-103222797 CAGGGAGAAGTGCCCAGCAAAGG - Intergenic
936018623 2:108978077-108978099 CATAGGGAAGAGCCCAGGGTAGG + Intronic
936299970 2:111297359-111297381 CAGAGAACAGTGCCCAGGACAGG - Intergenic
936411279 2:112260396-112260418 AAAAGGAAAGTGCCCTGGATTGG - Intergenic
937509239 2:122574934-122574956 TAGAGGGAAGAGCCCAGGCTGGG + Intergenic
938737392 2:134198698-134198720 CTCAGGGAGGTGCCCAGGAGTGG + Intronic
939172488 2:138711744-138711766 CAAAGGGATGTGCCCAACATGGG - Intronic
941312879 2:163955847-163955869 CATATGGAGGTGTCCAGGATAGG + Intergenic
942381172 2:175392669-175392691 CAGAGGAAAGTGAACAGGAATGG - Intergenic
946905880 2:224415538-224415560 CAGAGGGAAGGGCCTAGTCTAGG + Intergenic
947838169 2:233189824-233189846 CAGAGAGAAGGGCACAGGACTGG - Intronic
948562482 2:238863902-238863924 CACAGGGATGCCCCCAGGATAGG - Intronic
948868698 2:240787709-240787731 CAGAGAGAGGTGCTCAGGACAGG - Intronic
1169765329 20:9142216-9142238 GAGAGGGAAGTGCACAAAATGGG + Intronic
1171255456 20:23686345-23686367 CAGAGGGAAGAACCCAGGGCAGG + Intronic
1171262798 20:23748267-23748289 CAGAGGGAAGAACCCAGGGCAGG + Intronic
1171275807 20:23855773-23855795 CAGAGGGAAGAACCCAGGGCAGG + Intergenic
1172773592 20:37395217-37395239 GAGAGGGAAGTGGCCAGCCTGGG - Intronic
1173838429 20:46140394-46140416 CAGAGGGGAAAGCCTAGGATGGG + Intergenic
1173955428 20:47028744-47028766 CAGAGTGAAGAGCACAGGCTTGG - Intronic
1174848505 20:53967891-53967913 CAGAGTGAATTGGCCAGGAGAGG + Intronic
1175857400 20:62129619-62129641 CAGAGGGAATGGCCCAGTCTGGG + Intronic
1176660413 21:9629804-9629826 CAGAGCTTAGTGCCCAGGGTGGG - Intergenic
1178766994 21:35463720-35463742 TAGACGGAGGTGCCCAGGGTAGG + Intronic
1179108166 21:38422132-38422154 CAGACGGAAGTGCTCAGGACTGG + Intronic
1179414522 21:41187353-41187375 TAGAGTCAAGTGCCCAGGAAGGG + Intronic
1179594530 21:42433496-42433518 CAGAGGGCAGAGCTCAGGAGAGG - Intronic
1179709332 21:43203932-43203954 CAGAAGGAAAAGCCCAGGACTGG - Intergenic
1180142849 21:45902734-45902756 CAGAGCGAAGGTCCCAGGAGCGG - Intronic
1180708819 22:17825995-17826017 GAGAGGGAAGAGCAGAGGATGGG - Intronic
1181031267 22:20149781-20149803 CTGAGGGTGGGGCCCAGGATGGG + Intronic
1181496216 22:23288764-23288786 CAGAGGGAAGTGCCCAGAGAAGG - Intronic
1182045047 22:27267674-27267696 CAGAGGGATGTTCTGAGGATGGG + Intergenic
1183193582 22:36337506-36337528 CAGATGGAGGTCCCCAGGAAGGG + Intronic
1183370455 22:37428840-37428862 AACAGGGAACGGCCCAGGATGGG + Intergenic
1183475662 22:38034502-38034524 GAGACCGAAGTGCCCAGCATGGG + Intronic
950027767 3:9832580-9832602 CAGAGAGAAGGGTCCAGGAGAGG - Intronic
950615252 3:14152833-14152855 GGGAGGGAAGTGTCCAGGAGGGG + Intronic
952826054 3:37526134-37526156 CAGAGGAAAGAGCCCATGAATGG - Intronic
953659573 3:44882320-44882342 CACAGAGCAGTGCCCAGGAGAGG + Intronic
953947095 3:47159127-47159149 AAGAGAGAAGGGCCAAGGATTGG - Intronic
954438240 3:50507396-50507418 CCCAGGGATGTGCCCAGGAAGGG + Intergenic
954684183 3:52361595-52361617 CAGAGGGAGGTGCCCAGATTGGG + Intronic
955794459 3:62621241-62621263 TAGAGGGAAGTACGGAGGATGGG + Intronic
961063750 3:123856317-123856339 CACTGGGAACTGCCCAGAATTGG + Intronic
961583751 3:127904810-127904832 CAGTGGAAAGAGCCCAGGACAGG - Intergenic
962035024 3:131642722-131642744 CAAAGGGAAGTGCCAAGCAAAGG - Intronic
962419736 3:135217235-135217257 CTGAGGGCAGTGCTGAGGATAGG + Intronic
963057845 3:141201911-141201933 AACAGGGAAGTCCCCAGGAAGGG + Intergenic
965506985 3:169527230-169527252 CAGAGGGAAGTGAGCAGGAATGG + Intronic
965626157 3:170685839-170685861 CAGAGGGAGGTACTGAGGATAGG + Intronic
967158072 3:186711634-186711656 CAGGGGGAAGTGGACAGGAGTGG - Intergenic
967460395 3:189739441-189739463 TAGTAGGAAGTGCCCTGGATAGG - Intronic
967839039 3:193989554-193989576 AAGAGAGATGTGCACAGGATTGG - Intergenic
968556134 4:1247433-1247455 CAGAGGGAGGTGGCCAGGCCCGG + Intronic
968668469 4:1834488-1834510 CAGAGGGCAATGCCCAGCAGAGG + Intronic
969456177 4:7300931-7300953 CAGAGGGAGCTGCCCAGGCACGG - Intronic
969666665 4:8561262-8561284 CACAGGAAAGTGCCTAGGCTGGG + Intronic
971184076 4:24356993-24357015 CTGAGGGCTGTTCCCAGGATGGG - Intergenic
974538401 4:63199185-63199207 CAGTGGGAAGTTCCCAGCATAGG + Intergenic
976422937 4:84866509-84866531 AAGGGGAAAGTGCCCTGGATGGG + Intronic
976662020 4:87549698-87549720 CAGTCTGCAGTGCCCAGGATGGG + Intergenic
978091985 4:104728478-104728500 TAGAGGGAAGTTCCAGGGATGGG - Intergenic
979929818 4:126616970-126616992 GAGAGGGCAGGGCCCAGGACAGG + Intergenic
980079601 4:128330047-128330069 CTCAGGGAAGAGCCCAGGACTGG - Intergenic
982034545 4:151332596-151332618 CAGAGGGGTGGACCCAGGATTGG - Intergenic
982130397 4:152224102-152224124 GGGAAGGAAGTGGCCAGGATAGG + Intergenic
983932113 4:173463679-173463701 CAGAGGAAAATGACCAAGATAGG - Intergenic
985414944 4:189726613-189726635 CAGAGCTTAGTGCCCAGGGTGGG + Intergenic
985610372 5:884669-884691 CCCAGGCAAGTGCCCAGGGTGGG - Intronic
985768796 5:1796151-1796173 CACCCGGCAGTGCCCAGGATGGG + Intergenic
985861602 5:2475861-2475883 CAGGTGGAAGTTCCCAGGAGTGG + Intergenic
985982469 5:3482328-3482350 CAGAGGGTTTGGCCCAGGATTGG - Intergenic
986018681 5:3780850-3780872 CAGATGGGAGGGCCCAGGATGGG + Intergenic
987140894 5:14945145-14945167 CAGAGGAAAGCTCCCAGGAGTGG - Intergenic
988681643 5:33489521-33489543 CAGAGGAAAGTGCCCCAAATGGG + Intergenic
990727955 5:58777144-58777166 CAGTGAGAAGTGACAAGGATAGG - Intronic
990835009 5:60008568-60008590 TAAAGTGAATTGCCCAGGATTGG + Intronic
991023582 5:62006628-62006650 CAAAGGTCAGTGCCCAGGAGAGG - Intergenic
991256797 5:64622805-64622827 CAGAGGGCAGTTCTCAGGAGAGG + Intergenic
991258063 5:64637366-64637388 CAGAGGGAAGTGCCCCGGTGGGG - Intergenic
992015060 5:72567129-72567151 TTGGGGGAAGTGCCCAGGCTTGG - Intergenic
992400923 5:76410589-76410611 CAGAGGGTTTTGCCGAGGATAGG + Intronic
992626971 5:78645107-78645129 CAGAGGGAAGTGATCTGGCTGGG - Intronic
994840208 5:104914223-104914245 CAGTGCTAATTGCCCAGGATTGG - Intergenic
995670102 5:114593594-114593616 CTGATGGAAGTGCCCAATATGGG + Intergenic
996663022 5:126026850-126026872 CAGAGGGAAGGGACCAAGAGTGG + Intergenic
996714083 5:126572575-126572597 CAGATGGAAGTGACCAGGCAGGG - Intronic
997396055 5:133560761-133560783 CAGAGGAAAGGGACCAGAATAGG + Intronic
997841563 5:137245586-137245608 CAGATGAAAGTGCCCAGGCATGG + Intronic
999231452 5:150064602-150064624 GAGATGGAAGTGGCCAGGAGAGG - Intronic
999245790 5:150153958-150153980 CTGGGGGAAGAGCACAGGATGGG + Intronic
1000192104 5:158921176-158921198 CAGAGGGAAGAACCCAGCAAGGG + Intronic
1002299112 5:178247627-178247649 CAGAGGGCAGAGCCCAGGACAGG - Intronic
1002787960 6:418899-418921 CAGAGGGAAGTTCACAGGCTGGG - Intergenic
1002988616 6:2216845-2216867 CAGAGGCACCTGCCCAGGAGAGG - Intronic
1003179157 6:3777376-3777398 CAGAGGAGAGGGGCCAGGATAGG + Intergenic
1003373518 6:5551819-5551841 CAGAGGGAAGTGGCAGGGCTTGG - Intronic
1003685812 6:8300899-8300921 CAGAGAAAAGTGACCAGCATGGG - Intergenic
1006141817 6:31933902-31933924 GAGAAGGAAGTGCCCAGGGCAGG - Exonic
1006829535 6:36960592-36960614 CAGAGGGAAAGGGCCAGGAAGGG - Intronic
1007408469 6:41648187-41648209 CAGAGGGCAGAGGCCAGCATGGG - Intronic
1007636881 6:43305000-43305022 CTGTGGGAAGAGCCCTGGATAGG + Exonic
1009925322 6:70113794-70113816 AAGAGGAAAGTGACCAGAATGGG - Intronic
1012644882 6:101666224-101666246 CATAGGGAAGAGTCCAGGAGAGG + Intronic
1013287795 6:108695875-108695897 CAGAGGTAAGTGTGCAGGAAGGG - Intergenic
1018083288 6:160277278-160277300 CAGCTGGCAGTGCCCAGGAGAGG - Intronic
1018952411 6:168387715-168387737 CAGAGAGAAGGCCCCAGGCTTGG - Intergenic
1019200246 6:170307905-170307927 GAGAGGGAAAAGCCCAGAATGGG + Intronic
1019439959 7:1041018-1041040 ACGTGGGAGGTGCCCAGGATGGG - Intronic
1019705364 7:2494838-2494860 CAGAGGGAAGTGACAAGGCAAGG - Intergenic
1021549140 7:21851250-21851272 CAGAGAGAAGTGCCCAGCAAAGG - Intronic
1022796462 7:33735303-33735325 CAGAAGGAGGAGCCCATGATAGG + Intergenic
1025605244 7:63035515-63035537 CAGAGGGAGGTGTCTAGGACAGG - Intergenic
1025625499 7:63217743-63217765 GAGAGGGAAATGGCCAGGACTGG - Intergenic
1029619220 7:101679438-101679460 CCAAGGGAAGCCCCCAGGATCGG + Intergenic
1032386575 7:131529680-131529702 CAAAGGGAAGAGCGCAGGCTGGG + Intronic
1032417324 7:131746094-131746116 CAGCTGGAAGTGCCCAGGAGTGG + Intergenic
1032883586 7:136115376-136115398 CCGAGGGAAGTGCACAGCACTGG - Intergenic
1033635016 7:143204290-143204312 CAAAGAGAAATGCCCAGGATGGG + Intergenic
1034935008 7:155193371-155193393 AAGAGGACAGTTCCCAGGATGGG + Intergenic
1035168467 7:157005331-157005353 AAAAGGGAAGCGCCCAGGACCGG + Exonic
1035257640 7:157641942-157641964 CAGAGGGCAGTTCACAGAATTGG - Intronic
1035305479 7:157928835-157928857 GAGAGGGCAGTGCAGAGGATAGG + Intronic
1035604796 8:922941-922963 TAGAGGGAGGTGCCCAGGGCTGG + Intergenic
1037689491 8:21170393-21170415 TAGAGGGAAGACCCCAGGGTGGG - Intergenic
1037693922 8:21207497-21207519 CTGAGGGAACAGCCAAGGATTGG + Intergenic
1037837418 8:22222271-22222293 CAGAGGGAAGAGTCCTGCATAGG - Intronic
1038407588 8:27333671-27333693 CAGGGGGAAGCGGCCAGGCTGGG - Intronic
1039544332 8:38397756-38397778 CAGAGGGTAGAGCCAAGGAAGGG + Intronic
1040786556 8:51172319-51172341 GAGAGGGCAGTGCACAGGAAGGG - Intergenic
1040855307 8:51942900-51942922 GAGAAGGAAGTGCCCAGGCAAGG - Intergenic
1042730381 8:71927086-71927108 GAGAGGGAAGTGCCCTGACTGGG - Intronic
1043675622 8:82949142-82949164 AAGGGGAAAGTGCCCTGGATTGG + Intergenic
1048782621 8:138018149-138018171 GAGAGAGAAGTGCCAAGGAAAGG - Intergenic
1048971853 8:139649582-139649604 CAGGAGGAAGGGCCCAGGAGTGG - Intronic
1049071893 8:140361990-140362012 CTGAGGGAAGAGCTCAGGAAGGG - Intronic
1049507220 8:143009180-143009202 CAGAGGGAAGGCACCAGGAGTGG - Intergenic
1049580618 8:143408969-143408991 CAGAGGAGAGAGCCCAGCATGGG + Intergenic
1049692632 8:143969326-143969348 CAGAGGAATCTGCCCTGGATGGG - Intronic
1049692999 8:143970971-143970993 CAGAGGAATCTGCCCTGGATGGG + Intronic
1050999022 9:12257053-12257075 CAGAGGGTGGGACCCAGGATTGG + Intergenic
1055373307 9:75623952-75623974 CAGTGTGATTTGCCCAGGATGGG + Intergenic
1055764268 9:79644706-79644728 CACAGGGAAGGGCCCAGGACTGG - Intronic
1055828619 9:80356203-80356225 CAGACGGAAGAGGCAAGGATGGG + Intergenic
1055847429 9:80583380-80583402 CAGTGGGAAATGACCTGGATTGG - Intergenic
1056323230 9:85456344-85456366 TAGAAGGAAGTGTCCAGGCTGGG - Intergenic
1056600599 9:88043855-88043877 AAGAGGGAAGTGGCCAGAGTGGG - Intergenic
1057198865 9:93129932-93129954 TAGAGGCAAGTGCCCAGGACTGG - Intronic
1057272140 9:93657404-93657426 CAGAAGGAAGTGCCCAAGATGGG + Intronic
1057491179 9:95521028-95521050 CACAAGGAAGAGGCCAGGATAGG - Intergenic
1057802262 9:98197721-98197743 CAGAGGAAAGTGCCACCGATGGG - Intergenic
1058469095 9:105258551-105258573 CAGCAGGAAGTGCACAGGCTTGG - Intronic
1058899644 9:109431007-109431029 CATGGGCAAGTGCCCAGGAGGGG - Intronic
1059124760 9:111673929-111673951 CAGAGGGAGGAGCTGAGGATGGG + Intergenic
1059466545 9:114472280-114472302 CAGAGGAAAGTCCCCAGACTCGG + Intronic
1060436967 9:123601942-123601964 GAGAAGGAAGAGCCCAGGACAGG + Intronic
1060933865 9:127504985-127505007 CAGAGGGGTGGGCCCAGGCTCGG - Intergenic
1061516894 9:131095335-131095357 GGGAGGGAAGTGCCCAGCAAGGG - Intergenic
1061521617 9:131121580-131121602 CAGAGGGAGGTGCCCTGGACTGG + Exonic
1062075894 9:134589848-134589870 CAGGAGGAAGTGGGCAGGATGGG - Intergenic
1062519979 9:136953744-136953766 CACAGTGAACTGCCCAGGCTGGG - Exonic
1203637983 Un_KI270750v1:131647-131669 CAGAGCTTAGTGCCCAGGGTGGG - Intergenic
1186973144 X:14872097-14872119 GACAAGGAAGTGTCCAGGATAGG + Intronic
1187028079 X:15456626-15456648 CAGAGGGCAGTTCCTAGGAAGGG + Intronic
1187045911 X:15647248-15647270 CAGTGGGAAGTGCCCCGGTGGGG - Intronic
1187051889 X:15703549-15703571 CAGTGGGAAGTGCCCCGGTGGGG - Intronic
1190261999 X:48803056-48803078 CAGAGGGAACTGTCCAGGGTGGG - Intronic
1190317299 X:49159198-49159220 CAGGGGCAGGGGCCCAGGATAGG + Intergenic
1190746974 X:53329824-53329846 CAGAGGGATCTGCCCAGTTTGGG - Intergenic
1190790663 X:53697042-53697064 CAAAGGGAAGAGCCCAGGGATGG - Intergenic
1191665730 X:63700670-63700692 CAGAGGGGAGTGAGCAGGGTAGG + Intronic
1191744212 X:64467989-64468011 CAGAGGGGAGTGAGCAGGTTGGG - Intergenic
1195094046 X:101489235-101489257 CCCAGGGAAGTGGCCAAGATGGG + Exonic
1195696182 X:107669355-107669377 CTGAGGGAGATGCCAAGGATTGG - Intergenic
1196041116 X:111205232-111205254 AAGAGGGAGGTAACCAGGATAGG + Intronic
1197725734 X:129775257-129775279 CAGAGGGGAGTGAACAGGATGGG - Intergenic
1198150935 X:133908593-133908615 CAGAAGATAGTGACCAGGATGGG - Intronic
1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG + Intergenic