ID: 1105284514

View in Genome Browser
Species Human (GRCh38)
Location 13:18993454-18993476
Sequence CCAGGAGGCCAGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 927
Summary {0: 1, 1: 2, 2: 14, 3: 117, 4: 793}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105284506_1105284514 13 Left 1105284506 13:18993418-18993440 CCAAACAAAAGAAGGAAGGCCTG 0: 1
1: 0
2: 2
3: 53
4: 515
Right 1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG 0: 1
1: 2
2: 14
3: 117
4: 793
1105284509_1105284514 -6 Left 1105284509 13:18993437-18993459 CCTGGAGTTCCAGAAAGCCAGGA 0: 1
1: 0
2: 3
3: 70
4: 753
Right 1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG 0: 1
1: 2
2: 14
3: 117
4: 793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105284514 Original CRISPR CCAGGAGGCCAGAAGGCAGA AGG Intergenic
900078824 1:839766-839788 GATGGAGGCCAGAAGGCAGTGGG + Intergenic
900179439 1:1304832-1304854 CCCGGAAGACAGGAGGCAGATGG + Intronic
900691099 1:3981114-3981136 CCAGGCAGGAAGAAGGCAGAGGG + Intergenic
900729942 1:4250867-4250889 CAAGAAAGCCAGAAGGCAGTGGG - Intergenic
900999515 1:6141796-6141818 CCAGGAGGCTGGAAGGAGGAAGG + Intronic
901054348 1:6441803-6441825 CCCGGAGGGAAGAAGGCAGATGG + Intronic
901412959 1:9097804-9097826 CTTGGAGGTCAGAAGGAAGATGG - Intergenic
901490010 1:9591852-9591874 CCAGCAGGGCAGACGGCAGAGGG - Intronic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902411748 1:16215950-16215972 CCAGGAGGCAAGAACACGGAAGG + Intergenic
902434742 1:16391175-16391197 CCATGGGGCTAGAAGGGAGATGG + Intronic
902455638 1:16532159-16532181 CCATGAGGACAGACAGCAGAAGG - Intergenic
902479960 1:16706531-16706553 CCCGGAGGGAAGAAGGCAGATGG - Intergenic
902488414 1:16763396-16763418 CCAGGAGTTCAGAAAGCACAGGG - Intronic
902496535 1:16875756-16875778 CCATGAGGACAGACAGCAGAAGG + Intronic
902741899 1:18444672-18444694 ACAGGAGTCCAGAGGTCAGATGG + Intergenic
902751630 1:18516668-18516690 CGTGGATGCCAGAAGGCAGTGGG + Intergenic
902885804 1:19403879-19403901 CCAGGAGGGAGGCAGGCAGAAGG - Intronic
903040000 1:20522516-20522538 CCAGGAGCACAGAATGGAGAAGG + Intergenic
903446316 1:23424692-23424714 GCAGGAGGCGCGAAGGCGGAGGG + Exonic
904358507 1:29957251-29957273 TCAGGAGGCCAGAAGGCCAAGGG + Intergenic
904391372 1:30188477-30188499 ACAGGAGGCCAGAAGCCACAGGG - Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904561212 1:31398462-31398484 CCAGGAGGAGAGAAGCCACATGG + Intergenic
904976430 1:34460480-34460502 CCAGGAGGCAAGTTGGCAGAAGG - Intergenic
905006582 1:34714747-34714769 CCAGGAGACAAGGAGGTAGAAGG - Intronic
905645855 1:39624763-39624785 CCAGGAGGACAGCAGTCTGATGG + Exonic
906765715 1:48430301-48430323 ACTGGAGGTCAGAAGGCAGTAGG + Intronic
906892556 1:49733104-49733126 AAAGGAGGCCAGAAGGCAGTAGG + Intronic
907242212 1:53087094-53087116 ACAGGCGGCCAGAGTGCAGACGG - Intergenic
910126522 1:83848624-83848646 GCAGGAAGCCATCAGGCAGAGGG - Intergenic
910226936 1:84945183-84945205 CAAGGAGGGCAGCAGGCGGAAGG + Intronic
910418276 1:87025420-87025442 GCAGGAAGCCAGATGGCAAATGG + Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
910986982 1:93014769-93014791 CCACCAAGCCAGAAGGAAGAAGG + Intergenic
911204580 1:95079495-95079517 CAAGGCTGGCAGAAGGCAGAAGG - Intergenic
912572165 1:110632741-110632763 CCTGGAGGGCAGAAGTAAGAAGG + Intergenic
912953413 1:114136011-114136033 CCGGCTGGCCAGCAGGCAGACGG - Intronic
913074314 1:115328521-115328543 CCAGGCTGCCACAATGCAGAGGG - Intronic
913377897 1:118174783-118174805 CCTGCAGGCCAGAAGGCACTGGG + Intronic
913527616 1:119709136-119709158 CCAGGAGGTGAGACTGCAGAGGG - Intronic
914232111 1:145772546-145772568 CATGGAGGCTAGAAGGCAGTGGG - Intronic
914386187 1:147172295-147172317 CCCGCAGGCCAGGAGGGAGAGGG - Intronic
915225658 1:154409351-154409373 GGAGGAGAGCAGAAGGCAGAGGG - Intronic
915316888 1:155033741-155033763 CCAGGAGCACAGAAGTCAGCGGG - Exonic
916300260 1:163266015-163266037 CCTGGAGTCCAGTAGGCAGTTGG - Intronic
916511162 1:165473560-165473582 TCAGAACGCCAGAAGGGAGACGG + Intergenic
916637999 1:166694800-166694822 CCATGAAGGCAGAAGTCAGATGG - Intergenic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
917004123 1:170393763-170393785 TCTGGAGGCCAAAAGGCAGTGGG - Intergenic
917033973 1:170726186-170726208 TTAGGAGGCAAGAAGGCATAAGG - Intronic
917176548 1:172242198-172242220 CCAGAACGCCAGCAGCCAGATGG - Intronic
917450497 1:175143878-175143900 CCAGGATGAGAGAAGGCCGAGGG + Intronic
917510487 1:175665401-175665423 CCTGGGGCCCAGAAGGCAGGTGG + Intronic
917631865 1:176898310-176898332 CGAGGGGACCAGAAGGCAGTGGG - Intronic
918215974 1:182392032-182392054 CCGGGAGGGCTGAGGGCAGAGGG + Exonic
919148164 1:193661084-193661106 AAATGAGGCCAGAATGCAGATGG - Intergenic
919919692 1:202160678-202160700 ACAGGAGGGCAGAATGCAGCTGG - Exonic
920200299 1:204256137-204256159 CCAGGAGGCCAGAGTGGAGGAGG - Intronic
920288402 1:204898643-204898665 CCAGTGGGCCAAAAGGCAGGCGG + Intronic
920354435 1:205360161-205360183 AAAGGAGGCCAGAGAGCAGAGGG + Intergenic
920704536 1:208242050-208242072 CCTGGAGGTCAGAGGGGAGAGGG + Intronic
920848324 1:209611704-209611726 TCAAGAGGCCACAAGGCAAAGGG + Intronic
920853064 1:209641942-209641964 ACAGGCGGCCGGAAGGCAGCTGG - Intronic
920917908 1:210272904-210272926 GCAGGAGGCCGGGAGGCTGAGGG - Intergenic
921894493 1:220385367-220385389 AATGGAGGCCAGAAGGCAGTGGG - Intergenic
922286016 1:224171312-224171334 AGTGGAGGCCAGAAGGCAGTGGG - Intergenic
922662968 1:227446470-227446492 GCAAGAGGCCAGAAAGTAGAAGG + Intergenic
922737405 1:227994893-227994915 CCCGGAGGGGAGGAGGCAGATGG + Intergenic
922873168 1:228919227-228919249 ACGGTGGGCCAGAAGGCAGAAGG - Intergenic
922966574 1:229695904-229695926 CCTGGAGGCCAGAATGGAGTGGG + Intergenic
923149108 1:231217980-231218002 CCAGGAGCCCAGAAGCAATACGG + Intronic
923245499 1:232127357-232127379 CATGGAGGCCACAAGGCAGTGGG - Intergenic
923532027 1:234819120-234819142 CCAGGAGTTCAGAAAGCACAGGG + Intergenic
923703560 1:236323272-236323294 TTAGCAGGCCAGAAGGCAGTGGG + Intergenic
923975436 1:239257021-239257043 CCAGGAGGGGAGCATGCAGATGG + Intergenic
1062923856 10:1299736-1299758 CCAGGAGGTCAGGAAGCAGAAGG - Intronic
1062989463 10:1802605-1802627 TAAGGAGGCCAGAAGGAACATGG + Intergenic
1063219732 10:3956029-3956051 GCAGGTGGCCAGTTGGCAGATGG + Intergenic
1063288110 10:4712382-4712404 CCAGGAGGCAGGAAGGTAGCAGG - Intergenic
1063306475 10:4907159-4907181 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1063366535 10:5494183-5494205 CCAGGATGCCAGACTGAAGAAGG - Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1064288271 10:14011524-14011546 CCAGGAGATTGGAAGGCAGATGG - Intronic
1064531939 10:16319344-16319366 CAAGGAGGTAAGAAGCCAGATGG - Intergenic
1064673297 10:17737268-17737290 GCAGGAGGCCAAAGGGCAGCAGG - Intergenic
1065113578 10:22463017-22463039 GAAGGAGGCCACAAGACAGATGG + Intergenic
1065117305 10:22495319-22495341 CCAGAAGGAGAGCAGGCAGAGGG + Intergenic
1065702851 10:28442439-28442461 CCAGGAGGCCACAAGGCCAAAGG + Intergenic
1065937277 10:30531868-30531890 CTGGGAGGCAAGAAGGCAGTAGG + Intergenic
1066170058 10:32832500-32832522 TATGGAGGCCAGAAGGCAGTAGG + Intronic
1066668746 10:37814707-37814729 CTTGGAGGCCAGAAGGCAGTGGG - Intronic
1067330556 10:45312739-45312761 CTTGCAGGCCAGAAGGCAGGGGG + Intronic
1067841671 10:49685661-49685683 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1069635402 10:69921905-69921927 CCAGGAGGCCAGGAAGCCCAGGG - Exonic
1069898615 10:71694519-71694541 CCAGGAGGGCAGGTGGCAGAAGG + Intronic
1070170118 10:73926564-73926586 TTAGGAAGTCAGAAGGCAGACGG - Intergenic
1070565880 10:77603563-77603585 CCAGGATGCCAGAGGTTAGAGGG - Intronic
1070662380 10:78316573-78316595 CCAGCAGCCAAGAGGGCAGATGG - Intergenic
1070724468 10:78778783-78778805 CCAGGAGGACAGATGGGAGCTGG + Intergenic
1070779065 10:79127087-79127109 GCAGGAGGGAAGGAGGCAGAAGG - Intronic
1070939530 10:80331460-80331482 CTTGGAGGACAGAAGGCAGTGGG + Intergenic
1071471069 10:85984384-85984406 CCAGGTGGCCAGGTGGTAGATGG - Intronic
1072307478 10:94121413-94121435 CTAGGAGGGATGAAGGCAGATGG + Intronic
1072550658 10:96474778-96474800 CCTGGAGGCTAGAAGTCTGAAGG + Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1072867251 10:99077031-99077053 CCTGCAGGCCAGAAGGAAAAGGG - Intronic
1072966920 10:99981782-99981804 GCAGGAGGTCTGAAGGCAGAGGG + Intronic
1073016250 10:100401942-100401964 ACAGAAAGCAAGAAGGCAGAAGG + Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073066363 10:100761728-100761750 CCTGGAGACCAGTAGCCAGAGGG - Intronic
1073129647 10:101179103-101179125 CCAGGGGGCCAGAAAGGAGGAGG + Intergenic
1073242189 10:102066043-102066065 GCAGGAGGCCAGCAGCCCGAAGG - Exonic
1073323849 10:102631323-102631345 CCAGGATGCCAGAAAGGAGAGGG - Exonic
1074048721 10:109863346-109863368 TCTGGAGGCCAGAAGGCAGTGGG + Intergenic
1074444715 10:113511552-113511574 AATGGAGGCCAGAAGGCAGTGGG - Intergenic
1074484520 10:113861476-113861498 TTTGGAGGCCAGAAGGCAGTGGG + Intronic
1074765122 10:116694827-116694849 CCAGGCGGCAAAAGGGCAGAAGG - Intronic
1074825158 10:117209402-117209424 CAAGGAGGGGAGATGGCAGAAGG + Intronic
1075026257 10:118985730-118985752 TTTGGAGGCCAGAAGGCAGTGGG + Intergenic
1075518913 10:123132402-123132424 CAAGGAGCCAAGAGGGCAGAAGG - Intergenic
1075758606 10:124837639-124837661 GCAGGAAGCCTGAAGGCAAATGG + Intergenic
1076013088 10:127006255-127006277 GCAGGAGAGCAGAAGGCAGGAGG - Intronic
1076258104 10:129044846-129044868 CCAGGAGGCCAGTGGGCAGTCGG + Intergenic
1076471205 10:130719552-130719574 CCATCATGGCAGAAGGCAGAAGG - Intergenic
1076615437 10:131751526-131751548 CCGGGAGGCCAGAGGTCAGGTGG - Intergenic
1076623841 10:131809654-131809676 CCAGCAAGGCACAAGGCAGAGGG - Intergenic
1076998318 11:310240-310262 GCAGGAGGCCCGAAACCAGAAGG - Intronic
1077000424 11:319518-319540 GCAGGAGGCCCGAAACCAGAAGG + Intergenic
1077119370 11:899722-899744 CCAGGAGGGTAGCAGGCAGCTGG + Intronic
1077208210 11:1354195-1354217 CCAGCAGGGCAGCAGGCAGGTGG - Intergenic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077240314 11:1507292-1507314 CCAGGAGGCCAAGAGCCAGGTGG + Intergenic
1077252313 11:1566107-1566129 GCAGGATGCAACAAGGCAGAGGG + Intronic
1077325076 11:1960213-1960235 GGAGGAGGACAGAAGACAGAGGG - Intronic
1077635452 11:3838919-3838941 TAAGGATGCCTGAAGGCAGAGGG + Intronic
1077813081 11:5658335-5658357 TGAAGAGGCCAGAAGGAAGATGG - Intergenic
1077848070 11:6046628-6046650 CCAGGAGGAAAGGAGGCTGAGGG + Intergenic
1078145099 11:8717103-8717125 CCAGGATGTCAGGAGGCAGGTGG - Intronic
1078426314 11:11253857-11253879 CCAGGACACCTGCAGGCAGAAGG - Intergenic
1078820666 11:14877775-14877797 CCCCCAGGACAGAAGGCAGATGG + Exonic
1079034842 11:17013135-17013157 CCCGGAGCTCAGCAGGCAGAGGG + Intronic
1079136633 11:17779295-17779317 CGAGGAGGGCACAAGGCAGGGGG - Intronic
1079203748 11:18396138-18396160 GCATCGGGCCAGAAGGCAGAAGG - Intronic
1079716325 11:23750775-23750797 GCATGAGGCCAGGAGGCAGAAGG + Intergenic
1080177405 11:29381917-29381939 CATGGATGCCAGAAGGCAGTGGG + Intergenic
1080225758 11:29958085-29958107 CCAGGAGTCAACATGGCAGAAGG - Intergenic
1080235355 11:30062320-30062342 CATGGAGGCCAGAAGGAAGTGGG + Intergenic
1080680234 11:34469107-34469129 CCAGGAAACCAGAAGTGAGAGGG - Intronic
1081118759 11:39237699-39237721 ATCGGAGACCAGAAGGCAGAAGG - Intergenic
1081794054 11:45807721-45807743 CCAAGAGGGGAGAAGGGAGAAGG + Intronic
1081827642 11:46072753-46072775 CCAGGAGGCCACCAGGTAAAGGG + Intronic
1081882463 11:46465256-46465278 CCAGGGAGTCAGGAGGCAGAAGG - Intronic
1082890451 11:58133345-58133367 GCAGGAGGGCTGAAGGCATAAGG + Intronic
1083030678 11:59589080-59589102 CATAGAGGCCAGAAGGCAGTGGG + Intronic
1083108828 11:60385302-60385324 CCAAGAGGCCAGGAGGCAAAAGG + Intronic
1083146734 11:60765673-60765695 CCTGGACGCCACAAAGCAGAGGG - Intronic
1083285755 11:61657690-61657712 CATGGCGGCCACAAGGCAGATGG + Intergenic
1083410450 11:62488905-62488927 CCAGGAAGACAGGGGGCAGAGGG + Intronic
1083603190 11:63961523-63961545 CTAGGGGCTCAGAAGGCAGAGGG + Intergenic
1083724496 11:64621214-64621236 CGAGGGGGCAAGAATGCAGAAGG - Intronic
1083725251 11:64624452-64624474 CCAAGAGGCCAAGAGGCAGAGGG + Intronic
1083758477 11:64803426-64803448 CCCGGGAGCCAGAAGACAGAGGG + Intergenic
1084601694 11:70149574-70149596 CCAGGAGGCGAGATTGCAGTGGG + Intronic
1084625164 11:70300606-70300628 CCAGGAGGGGAGCTGGCAGAGGG - Intronic
1084767741 11:71323532-71323554 ACAGGAGGCCTGAAGGCAGGTGG + Intergenic
1084927041 11:72522278-72522300 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1084977954 11:72813751-72813773 CTGGGAGGACAGGAGGCAGAAGG - Intergenic
1085064222 11:73477643-73477665 ACCGGAGGCCAGAAGACAGGAGG + Intronic
1085296555 11:75434820-75434842 CCAGCAGACCTCAAGGCAGAAGG - Exonic
1085446779 11:76606076-76606098 CCGAGAGGGCATAAGGCAGAGGG - Intergenic
1085473901 11:76776625-76776647 TTTGGAGGCCAGAAGGCAGTGGG - Intergenic
1085520926 11:77138430-77138452 CCAGGAGGGGAGAAGGGAGGGGG + Intronic
1086595458 11:88565646-88565668 ACAGGAGTCAGGAAGGCAGATGG + Intronic
1088457367 11:110047155-110047177 GCAGGAGGCAGGCAGGCAGATGG - Intergenic
1088544532 11:110946220-110946242 CCAGGGTCCCAGGAGGCAGAGGG + Intergenic
1088771302 11:113038267-113038289 CAAGGAGGCCAGAGAGCAGTGGG - Intronic
1088771716 11:113042385-113042407 GAAGGAGGCCAAAGGGCAGAGGG - Intronic
1088889920 11:114036310-114036332 CCAGAAGGGGAGAAGGCTGACGG - Intergenic
1089829998 11:121318894-121318916 TCAGGAGGCCAGAAGAGACAAGG + Intergenic
1090255499 11:125280915-125280937 CCAGGAGGCCAAGAGTCTGAGGG + Intronic
1090404295 11:126467781-126467803 CCTTGAGGCCAGAGGCCAGAGGG + Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090549933 11:127808669-127808691 CCAGGATGCCAGGAGGCAGCTGG - Intergenic
1091249653 11:134132245-134132267 CTTGGAGGCCAGAAGGAAGTGGG + Intronic
1091336277 11:134769116-134769138 CCTGCAGGCCAGAAGGGAGCAGG + Intergenic
1202808058 11_KI270721v1_random:15392-15414 GGAGGAGGACAGAAGACAGAGGG - Intergenic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091750710 12:3019800-3019822 CCTGGGGGACAGAAGGCAGCAGG - Intronic
1092115959 12:6005689-6005711 CTTGCAGGCCAGAAGGGAGATGG + Intronic
1092125714 12:6073846-6073868 CCTGGAAGCCTGAAGACAGAGGG - Intronic
1092698944 12:11205478-11205500 CCAGGAGGGCAGTATGCACAGGG - Intergenic
1092822543 12:12366036-12366058 GCAGCAGCCCAGCAGGCAGAGGG - Intronic
1093114690 12:15194898-15194920 CCAGGCTGCCAGATGGCACATGG + Intronic
1093251800 12:16814291-16814313 CATGGAAGCCAGAAGGCAGTGGG + Intergenic
1094490991 12:30960507-30960529 CCTGGAGGAAAGCAGGCAGAGGG - Intronic
1094613232 12:32013506-32013528 CCAGGAGGGCAGAAGAAAAAGGG - Intergenic
1094822040 12:34233607-34233629 TCAGGAGCAGAGAAGGCAGATGG + Intergenic
1096504359 12:52083173-52083195 CTCAGAGGCCAGAAGGCAGGGGG - Intergenic
1096542170 12:52314043-52314065 CGAGGAGGCCAGAAGTCAGCCGG - Intergenic
1096839305 12:54370804-54370826 CCAGGGGGCCAGATGGGAGGGGG - Intronic
1097686256 12:62693776-62693798 ACAGGAGGCCTGAAGGATGATGG + Intronic
1098012468 12:66069902-66069924 TCAGGAGGCAAACAGGCAGAGGG - Intergenic
1098380449 12:69863972-69863994 CATGGAGGCTAGAAGGCAGTGGG - Intronic
1099975879 12:89545004-89545026 GCAAGAGGCCAGAGGGCAGGAGG - Intergenic
1101905374 12:108820867-108820889 CGATGAGGTCGGAAGGCAGAGGG - Intronic
1102430343 12:112878215-112878237 CCAGGATGAGGGAAGGCAGAAGG - Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102963812 12:117111454-117111476 CCTGGAGGCCAGACAGCCGAGGG - Intergenic
1103215985 12:119201881-119201903 CCAGCTGGCTAGAAGGCAGTTGG - Intronic
1103351614 12:120287568-120287590 CCAGGTGGAGAGAAGGGAGAAGG - Intergenic
1103456755 12:121073864-121073886 CATGGAGGCCAAAAGGCAGTGGG + Intergenic
1104365078 12:128169490-128169512 CCAGCAGCCCAGAAGACAAATGG - Intergenic
1104637401 12:130446944-130446966 CCCTGAGGCCAGAAAGCCGAGGG - Intronic
1104664232 12:130635975-130635997 CTCGGAGGCTGGAAGGCAGAGGG - Intronic
1104672005 12:130686866-130686888 CTACGAGCCCAGAAGGCAGCGGG + Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1104953671 12:132453666-132453688 CCAGGAACCCAGGAGCCAGAGGG + Intergenic
1105054755 12:133088045-133088067 GCTGGAGCCCAGGAGGCAGAGGG + Intronic
1105284282 13:18992160-18992182 GCCAGAGGACAGAAGGCAGAAGG + Intergenic
1105284285 13:18992175-18992197 GCAGAAGGCTAGAAGGCAGAAGG + Intergenic
1105284304 13:18992309-18992331 ATAGAAGGCCAGAAGGTAGAGGG + Intergenic
1105284308 13:18992332-18992354 ACAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284325 13:18992410-18992432 GCCAGAGGCCAGAAGGGAGAAGG + Intergenic
1105284385 13:18992753-18992775 ACAGAAGGACAGAAGGCAGAAGG + Intergenic
1105284401 13:18992861-18992883 GCAGAAGGCCAAAAGACAGAAGG + Intergenic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1105284481 13:18993252-18993274 ACAGAACGCCAGAAAGCAGAAGG + Intergenic
1105284487 13:18993280-18993302 CCAGAAGGCAAGAGGACAGAAGG + Intergenic
1105284494 13:18993316-18993338 CCAGAAGGCCAGAAGACAGCGGG + Intergenic
1105284498 13:18993339-18993361 CCAGAAGGCCAGAAAACAGAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284561 13:18993722-18993744 CCAGAAGGCCAGAAAGCAGAAGG + Intergenic
1105284577 13:18993821-18993843 CCTGAAGGCCAGAAGTAAGAAGG + Intergenic
1105284584 13:18993867-18993889 CCAGAAGGCCAGAAAAGAGAGGG + Intergenic
1105284609 13:18994024-18994046 GCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284615 13:18994060-18994082 GCAGAAGGCCAGAAGCCAGAAGG + Intergenic
1105284630 13:18994130-18994152 CCAGGAGGCAGAAAGCCAGAAGG + Intergenic
1105284633 13:18994145-18994167 CCAGAAGGCAAGAAGGCAGAAGG + Intergenic
1105284639 13:18994173-18994195 CCAAAAGGCCAGAAGGCAGAAGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284753 13:18994868-18994890 CCAGAATGTCAGAAGGCAGAAGG + Intergenic
1105284765 13:18994947-18994969 CAAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284789 13:18995089-18995111 CCAGAAGGCCAGAGGGTAGAAGG + Intergenic
1105284806 13:18995184-18995206 CCAGAAGGCCAGAAAACAGAAGG + Intergenic
1105284837 13:18995375-18995397 GCAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284908 13:18995804-18995826 ACAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284915 13:18995832-18995854 CCACAAGGTCAGAAGGCAAAAGG + Intergenic
1105284961 13:18996109-18996131 CCCGGAGGCCAGAATGCAGAAGG + Intergenic
1105284975 13:18996189-18996211 CTAGAAGGCCAGAAGGCAGAGGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105285074 13:18996752-18996774 GCAGAAGGCCAGAGGCCAGAAGG + Intergenic
1105285075 13:18996759-18996781 GCCAGAGGCCAGAAGGCAGAAGG + Intergenic
1105285080 13:18996790-18996812 ACCAGAGGCCAGAATGCAGAAGG + Intergenic
1105685432 13:22776384-22776406 CCTGGAGTCCAGCAGGCAGCTGG - Intergenic
1105917424 13:24929448-24929470 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1106371376 13:29137176-29137198 ATTGGAGGCCAGAAGGCAGTGGG - Intronic
1106548970 13:30755150-30755172 CCAAAAGGCTAGAACGCAGAGGG + Intronic
1106548976 13:30755183-30755205 CCAAAAGGCTAGAACGCAGAGGG + Intronic
1106548982 13:30755216-30755238 CCAAAAGGCTAGAATGCAGAGGG + Intronic
1108004353 13:45932184-45932206 CCAGGAGGCTGATAGGCAGACGG + Intergenic
1108584409 13:51856568-51856590 CCTGGAGGTCAGAAGCAAGATGG + Intergenic
1109152430 13:58860916-58860938 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1109459855 13:62642389-62642411 AACGGAGGCCAGAAGGCAGTGGG + Intergenic
1109814185 13:67557858-67557880 CATGGAGGCCAGAAGGTAGTTGG + Intergenic
1111096634 13:83524006-83524028 TCAGGAAGGCAGAAGGCAGAAGG - Intergenic
1111630355 13:90841110-90841132 CGAGGAGGCGAGAGGTCAGATGG - Intergenic
1113055215 13:106260191-106260213 TCTGGAGGCCAGAAGTCTGACGG - Intergenic
1113080703 13:106516796-106516818 CCAGGAGGCCAGGAACCAAAAGG + Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1113814361 13:113161276-113161298 CCAGGAGCCCAGGAGCCAGGCGG - Intronic
1113869906 13:113553018-113553040 CCAGGAGAGGAGAAGGCAGCAGG - Intronic
1113898483 13:113782531-113782553 CCGGTAGGCCAGAAGCAAGATGG - Intronic
1114353844 14:21885404-21885426 CATGGAAGCCAGAAGGCAGTAGG + Intergenic
1114442589 14:22762195-22762217 CCTGGATGCCAGAACGCAGTGGG + Intergenic
1116472906 14:45306123-45306145 CCAGCAGGCAAGAAGGCACATGG + Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117329060 14:54694723-54694745 CCAGGAGGTCAGAAATCTGAAGG + Intronic
1118141087 14:63083836-63083858 TCTGGAGGCCAGAAGGCAGTGGG + Intronic
1118347726 14:64951863-64951885 CCAGGAGGGCAGTTGGCAGGAGG - Intronic
1118912750 14:70075511-70075533 CCAACAAGGCAGAAGGCAGAAGG - Intronic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1119484949 14:74981088-74981110 ACAGGAGACCAGCAGGCAGCAGG - Intergenic
1119859003 14:77923341-77923363 CCCTGAGGCCAGAAAGCACACGG + Intronic
1121242777 14:92441910-92441932 GCTGGAGGGCAGATGGCAGAGGG + Intronic
1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG + Intronic
1121249795 14:92490866-92490888 TCCGGAGGCCAGAAGCCTGAAGG + Intronic
1121304362 14:92896865-92896887 CCTGGGGGCCAGGAGGCAGAAGG + Intergenic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1121682591 14:95806143-95806165 CAAAGAGGCCAGAAGGCAGTGGG - Intergenic
1121916431 14:97840272-97840294 CCAGGAGACCAGAAGGCATCTGG - Intergenic
1122323474 14:100868961-100868983 CCAGGATGACAGAGGCCAGATGG - Intergenic
1122766808 14:104078042-104078064 CCAGGACGCCAGACGAAAGAAGG - Intergenic
1122817347 14:104320201-104320223 CCAGGAGGACAGAAACCTGAAGG + Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123029646 14:105445593-105445615 CCACGAGGCCAGGATGCCGATGG - Intronic
1123413891 15:20081358-20081380 TCAGGAGGCAAGAAGGGTGATGG + Intergenic
1123523233 15:21088469-21088491 TCAGGAGGCAAGAAGGGTGATGG + Intergenic
1123799302 15:23803901-23803923 CCAGGAGCCCAGCAGGAGGAAGG + Intergenic
1124245204 15:28064117-28064139 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1124567990 15:30833952-30833974 CCAGGTGGCCAGGCAGCAGAAGG - Intergenic
1125085391 15:35723789-35723811 CCAGCAGGGCTGAAGGCATAAGG - Intergenic
1125494603 15:40180602-40180624 CAAGGAGGCCAGAAGACAGTGGG - Intronic
1125762112 15:42103872-42103894 CCAGGAGGGAAGCAGGGAGAAGG + Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126196572 15:45938103-45938125 CCAGGAGGCAATAGGGAAGAGGG + Intergenic
1127309123 15:57736833-57736855 CCATCGGGCCAGAATGCAGAAGG - Intronic
1127819914 15:62645662-62645684 CAAGATGGCCACAAGGCAGAGGG - Intronic
1127983387 15:64050451-64050473 CTAGGAGGGCAGATGGCACAGGG - Intronic
1128229664 15:66025682-66025704 CCGAGAGGCCTGAAGGCAAAAGG - Intronic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128390972 15:67182252-67182274 TCTGGGGGCTAGAAGGCAGAAGG - Intronic
1128551733 15:68601960-68601982 CCAGCATGGCGGAAGGCAGAAGG + Intronic
1128737397 15:70060923-70060945 CCCACAGGCCAGAAGGCAGACGG - Intronic
1129155292 15:73713792-73713814 CAAAGAGGTGAGAAGGCAGAGGG - Exonic
1129209422 15:74058930-74058952 CCAGGAGGGCACCAGGCATAGGG - Intergenic
1129245532 15:74276669-74276691 CCAGGAGGCTGGAGGGCACAGGG - Intronic
1129607488 15:77031914-77031936 CAAGGAGGCGAGGAGGCAGCAGG - Intronic
1129690746 15:77712040-77712062 CCAGGAAGTTCGAAGGCAGAGGG - Intronic
1129736770 15:77970855-77970877 CCAGGAGGGCTGAAGACAGTAGG - Intergenic
1129849305 15:78782778-78782800 CCAGGAGGGCTGAAGACAGTAGG + Intronic
1130252989 15:82312975-82312997 CCAGGAGGGCTGAAGACAGTAGG - Intergenic
1130646811 15:85735556-85735578 TTAGGAGGCGAGAAGGAAGAGGG + Exonic
1130866077 15:87934243-87934265 CTATGAGGCCAGAAGGCAAATGG + Intronic
1131086014 15:89576044-89576066 ACAGGGGGCCAGGAGGAAGACGG - Exonic
1131252039 15:90837311-90837333 CCGGGAGGCAGGAAGGCACACGG + Intergenic
1131400344 15:92120440-92120462 GCAGGGAGACAGAAGGCAGATGG - Intronic
1131817202 15:96234074-96234096 CCAGCAGGCCTGAAGGCACTGGG - Intergenic
1132234416 15:100208339-100208361 GCATAAGGCCAGAAGACAGAAGG + Intronic
1132671490 16:1103833-1103855 CCAGGAGGCCCGGAGGCTGCAGG + Intergenic
1132859103 16:2061315-2061337 ACAGGAGGCCAGGCAGCAGAAGG + Intronic
1133949225 16:10376389-10376411 CAAGGAGGTCAGAAGACAGTGGG - Intronic
1134205538 16:12234806-12234828 CTATGATGCCAGTAGGCAGACGG - Intronic
1134849314 16:17468121-17468143 CCAGGAGACCAGAAGGGGGCAGG - Intronic
1135118072 16:19740475-19740497 GCAGCAGAACAGAAGGCAGAGGG - Intronic
1135305192 16:21361904-21361926 CCAGGAAGCCTGAGGGCAGGTGG - Intergenic
1135690003 16:24528754-24528776 GCTGGAGCCCAGAAGGCTGAAGG - Intergenic
1136015137 16:27392927-27392949 CCACAAGGCCAGAAGACAGAAGG + Intergenic
1136301936 16:29341069-29341091 CCAGGAAGCCTGAGGGCAGGTGG - Intergenic
1136371177 16:29837023-29837045 TCTGGAGGAGAGAAGGCAGAGGG - Intronic
1136470049 16:30473891-30473913 CCAAGGGGCCCCAAGGCAGAGGG - Intronic
1136569725 16:31089369-31089391 CCAGGAAGCCAGCAGGCCCAGGG - Intronic
1136589204 16:31207232-31207254 GCAGGAGGCCACATGGCAAAGGG - Intergenic
1136749866 16:32624995-32625017 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1136778041 16:32882003-32882025 CCAGCAGGCCAGCAGACAAAGGG + Intergenic
1136892580 16:33979511-33979533 CCAGCAGGCCAGCAGACAAAGGG - Intergenic
1137308143 16:47225615-47225637 CCAGGAGGCTAGAAGGCAATAGG + Intronic
1137409179 16:48213527-48213549 CAAGGAGGCCAGCATGCTGAAGG + Exonic
1137567466 16:49542547-49542569 CCAGAAGGCCAGAGGCCAGGAGG + Intronic
1137690030 16:50419316-50419338 TATGGAGGCCAGAAGGCAGTGGG - Intergenic
1137756402 16:50905847-50905869 CCAGGAAGCCAGCAGGGAGGAGG + Intergenic
1138396045 16:56705539-56705561 CCAGGAGGTCAGAGGCCAGCAGG + Intronic
1138475702 16:57269570-57269592 CCACGAGGCAGGAAGGCAGCCGG + Intronic
1138592517 16:58009847-58009869 GAAGAAGCCCAGAAGGCAGAGGG - Intronic
1138610750 16:58121954-58121976 CTAGGATGCCAGATGGCTGAGGG - Intronic
1138819490 16:60241907-60241929 CTTGGAAGCCAGAAGGCAGTGGG - Intergenic
1139466475 16:67156650-67156672 CCAGGAGGTGAGATGGCAGCTGG - Exonic
1139476642 16:67206101-67206123 ACAGGAGGCCAGAAGTCAGGAGG - Intergenic
1141196577 16:81865626-81865648 CCAGGAGCCCAGACAGCAGCAGG - Intronic
1141309652 16:82900977-82900999 CCAGGAGCCCAGAATGCCAAGGG + Intronic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1141625241 16:85258137-85258159 CTAGAAGGCCAGCAGGCAGCAGG + Intergenic
1141694182 16:85612139-85612161 CCAGGGCGCCAGAAGGCGGCAGG + Intronic
1141824885 16:86472002-86472024 CCAGGACTGCAGAAGTCAGAGGG + Intergenic
1141873743 16:86807173-86807195 CAAGGAGGCTGGAAGGCAGCGGG + Intergenic
1142007809 16:87698190-87698212 CCAGGCGGCGAGAAGGAACAGGG - Intronic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1203052000 16_KI270728v1_random:884193-884215 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1203080460 16_KI270728v1_random:1144112-1144134 CCAGCAGGCCAGCAGACAAAGGG + Intergenic
1142591969 17:1010217-1010239 CCAGGAGCAGAGAAGGCTGAAGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142847830 17:2690704-2690726 CCAGGAGGCCAGCAGAAACAGGG - Exonic
1142903187 17:3026178-3026200 TCAGCTGGCCAGGAGGCAGAGGG - Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143096165 17:4479611-4479633 CCAGGCTGCCAGGAGGCAGAAGG - Intronic
1143311557 17:5995395-5995417 TCAGGAGGAAAGAAGGCTGAAGG + Intronic
1143341382 17:6213998-6214020 CCAGGAGGCCAGCATGGGGAGGG + Intergenic
1144753745 17:17667481-17667503 CCAGGTTCCCAGAAGCCAGAGGG + Intergenic
1145006622 17:19342191-19342213 CAGTAAGGCCAGAAGGCAGAGGG + Intronic
1145073090 17:19828082-19828104 TCTTGAGGCCAGAAGGCAGTGGG + Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146292498 17:31620134-31620156 CATGGAGGACAGAAGGCAGTGGG - Intergenic
1146657558 17:34643985-34644007 ACAAGAGGCCAGGAGCCAGATGG + Intergenic
1146947658 17:36884831-36884853 CCAGGAGGGGAGAAGGCAAGGGG + Intergenic
1146948916 17:36892376-36892398 CCAGGAGGCCCGAGAGAAGAGGG - Intergenic
1146982624 17:37179331-37179353 TCAGCATGTCAGAAGGCAGAGGG + Exonic
1147196238 17:38768683-38768705 GGAGGAGGTCAGAAGGAAGAAGG + Exonic
1147197099 17:38774353-38774375 CCATCAGGCCACCAGGCAGAAGG - Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147720684 17:42537524-42537546 CCAGGAGGCCATCTGGCAGCGGG + Exonic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1147951565 17:44110681-44110703 CAAGGATGCCAGATGACAGAGGG + Intronic
1148336966 17:46848445-46848467 TCAGGAGCCCACAGGGCAGAGGG + Intronic
1148468448 17:47878606-47878628 CCAAAAGGGCAGAAAGCAGAGGG + Intergenic
1149387749 17:56158387-56158409 CCAGGATGGAAGAAGGCAAATGG - Intronic
1150170980 17:62994254-62994276 CCAGGAACCCAGGAGGCAGAGGG - Intergenic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150211603 17:63445132-63445154 CCAGGAGGCTGGAGTGCAGAGGG - Intronic
1150243206 17:63652650-63652672 CAATGAGGTGAGAAGGCAGATGG + Exonic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150335474 17:64327501-64327523 CCTGGAGGCCAGGAGGCAGCTGG - Intronic
1150487106 17:65551446-65551468 CCAGGAGGCCAGGGGACAGCAGG + Intronic
1150713400 17:67550536-67550558 CCAGGAGGCTGGAAGGGACATGG - Intronic
1150718591 17:67594547-67594569 GCAGGAGGCCACAAGGCAGAGGG - Intronic
1151183340 17:72345533-72345555 CCAGGAAGGCAGAAAGAAGAGGG + Intergenic
1151336980 17:73445847-73445869 GCAGGAGGCCAAGAGGCAGTGGG + Intronic
1151405706 17:73884869-73884891 ACAGGAGACCAGAAGGCGGGAGG - Intergenic
1151436304 17:74099903-74099925 CCAGGAGGCCTGCAGGGGGAAGG - Intergenic
1151487705 17:74411781-74411803 CCAGAGGGCCAGAAGGCTTAGGG + Intergenic
1151715185 17:75827605-75827627 CAGGAAGGCCAGGAGGCAGATGG + Exonic
1151736054 17:75941030-75941052 GCGGGAGGCCAGACGGCTGAGGG - Exonic
1152000178 17:77640433-77640455 CCAGGAGGCCAGGAGCTAGGTGG + Intergenic
1152467963 17:80476384-80476406 CCCGGCGCCCAGGAGGCAGAGGG + Exonic
1152622448 17:81372160-81372182 CCATGGGCCCAGAAGGCACAGGG + Intergenic
1152736491 17:81999897-81999919 CCAGGGGGACAGAAAACAGAGGG - Intronic
1153310175 18:3669679-3669701 TGAGGAAGCCAGAAGGAAGATGG - Intronic
1154300070 18:13184835-13184857 CCAGGAGGGGTGAAGGCAGAAGG + Intergenic
1154503121 18:15006178-15006200 CCAGGAAGCTGGAAGGCAGAAGG + Intergenic
1155090870 18:22509520-22509542 CATGGAAGCCAGAAGGCATAAGG - Intergenic
1155955544 18:31953878-31953900 CCTGCAGGCCAGAAAGCAGATGG - Intergenic
1156452986 18:37277116-37277138 CCAGCAGGGCAGAGGGCAGGAGG - Intronic
1156501439 18:37562051-37562073 CCTGGAGGCCAGAAAGCAATTGG - Intronic
1156678660 18:39562445-39562467 CTAGGATGCTTGAAGGCAGATGG + Intergenic
1156875520 18:42005948-42005970 CCAGTAGGCCAGAAGTCAGAAGG - Intronic
1157220520 18:45825739-45825761 CAAGCAGGCCAGCAGCCAGATGG - Exonic
1157431066 18:47627130-47627152 CCAACAGGGCAGAAGGCTGAAGG - Intergenic
1157575851 18:48742485-48742507 CAAGGAGGCCCGAATGCAGAAGG - Intronic
1157725198 18:49958792-49958814 CCAGGAGCTCAGCAGGGAGAGGG - Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158401597 18:57126488-57126510 TCAGATGGCCTGAAGGCAGAAGG - Intergenic
1158618904 18:59013208-59013230 GAAAGAGGGCAGAAGGCAGAGGG - Intergenic
1159976804 18:74723539-74723561 CAAGGAAGAGAGAAGGCAGATGG - Intronic
1160003206 18:75047407-75047429 GCAGAAGGGCAGAAGGCAGAGGG - Intronic
1160390404 18:78527210-78527232 CCAGGAGGAATGAAGGCTGATGG - Intergenic
1160556728 18:79730371-79730393 CCAGGAAACCAGGAGGGAGACGG - Intronic
1160606636 18:80056270-80056292 AATGGAGGCCAGAAGGCAGTGGG - Intronic
1161246270 19:3254052-3254074 CCAGGAGGGAAGATGGAAGAGGG + Intronic
1161353831 19:3808475-3808497 CCAGGAGCTCAGAGGACAGAGGG - Intronic
1162274849 19:9644935-9644957 TCAGGAGGCCGGAAGTCAGCAGG - Intronic
1162453992 19:10771531-10771553 CAAGGAGCCCACAAGGTAGAGGG - Intronic
1162736037 19:12747672-12747694 GCAGGAGGCTAGAGGGCAGAGGG - Intronic
1162793661 19:13075786-13075808 TCAGGAGGCAAGAAAACAGATGG - Intronic
1162804265 19:13128903-13128925 GCAGGAGGCCACAGGGCAGCTGG - Intronic
1163173010 19:15545766-15545788 CCCTGAGGCCATAAGGCAAAAGG - Intronic
1163303722 19:16463973-16463995 CCAGGGGGCCACAGAGCAGAGGG + Intronic
1163512264 19:17742400-17742422 CCTTGAGCCCAGGAGGCAGAGGG - Intergenic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1164157502 19:22605482-22605504 CCAGGAGGCCAGGAGTAGGAAGG - Intergenic
1164161383 19:22627606-22627628 CCAAGAGCCTAGAAGGCAGTTGG - Intergenic
1164675398 19:30097192-30097214 CCAGCAGGCCAGTGGGCAGATGG - Intergenic
1164781487 19:30896929-30896951 CCTGGAGACCAGAAGGCCCAGGG + Intergenic
1164840259 19:31387860-31387882 CCAGGAGGCCACAAAGCCGCAGG - Intergenic
1164847922 19:31450190-31450212 CCAGGGAGCAAGCAGGCAGAGGG - Intergenic
1165050652 19:33139366-33139388 CCATGAGGCCAGGCTGCAGAAGG + Intronic
1165159909 19:33810027-33810049 CCAGGCGGCCAGCAGGTGGAAGG + Intronic
1165216083 19:34273836-34273858 CCAGGTGGCGAGAAGGAAGATGG + Intronic
1166007747 19:39918675-39918697 GCTGGAGGCCAGATGGCACAGGG - Intronic
1166347386 19:42175193-42175215 CCAGGAGGCCACAAGGAAGTAGG + Intronic
1166361080 19:42253348-42253370 GCGGCAGGCCAGGAGGCAGACGG + Intronic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1167920212 19:52777293-52777315 GCTTGAAGCCAGAAGGCAGAGGG + Intronic
1168317876 19:55491884-55491906 GTAGGAGGCCGGCAGGCAGAGGG + Intronic
1168725850 19:58581573-58581595 CCAGGAGGCCACACTGCAGGCGG + Intergenic
1202702784 1_KI270713v1_random:844-866 CCAGGAGTTCAGAAAGCACAGGG + Intergenic
1202706525 1_KI270713v1_random:28508-28530 CCATGAGGACAGACAGCAGAAGG - Intergenic
1202713996 1_KI270714v1_random:32437-32459 CCCGGAGGGAAGAAGGCAGATGG - Intergenic
925200691 2:1965651-1965673 CTATGATGCCAAAAGGCAGAGGG - Intronic
925213732 2:2073909-2073931 CCAGGAGGCCAGAGTGCTGAGGG - Intronic
925298462 2:2793369-2793391 CCAGGAGGGCAGCAGGAACACGG - Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
925834326 2:7929309-7929331 TCTGGAGTCCAGAATGCAGAGGG - Intergenic
925901780 2:8514060-8514082 GCAGGAGGCCAGGAGACAGAGGG + Intergenic
926196655 2:10768223-10768245 CCAGTCGGCCAGAAAGCAGGAGG + Intronic
926206166 2:10835511-10835533 GCTGGAGGCCTGAAGGCAGGTGG + Intronic
926407684 2:12571425-12571447 CAAGGAGGGGAGAAGTCAGATGG - Intergenic
926413506 2:12628169-12628191 CAAGGAGGGTAGAAGTCAGATGG - Intergenic
926644940 2:15280346-15280368 GGAGGAGGCAAGAAGGAAGAAGG + Intronic
927484096 2:23477198-23477220 CCAGGAGGCCACCGGTCAGAAGG - Intronic
927517259 2:23679764-23679786 GGAGGAGGGCAGAGGGCAGAGGG + Intronic
927915529 2:26933757-26933779 CCAGGAGGCTAAAAGGAAGCTGG - Intronic
928223608 2:29426476-29426498 AATGGAGGCCAGAAGGCAGTGGG + Intronic
928326387 2:30322815-30322837 GCAAAAGGGCAGAAGGCAGAGGG + Intronic
928335598 2:30395373-30395395 CCAGGAGCCCTGAACCCAGAGGG + Intergenic
929177637 2:38997635-38997657 CATGGAGGCCAGAAGGCAGTGGG + Intronic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929670979 2:43876265-43876287 CCAAGAGGCAAAAGGGCAGAGGG - Intronic
929763611 2:44826205-44826227 TCTGGAGGGCAGAAGGTAGAAGG - Intergenic
929774608 2:44921159-44921181 ACAGGGGGCCAGGAGTCAGAGGG + Intergenic
930699095 2:54441201-54441223 CTAGGAGGGAAGAAGGGAGAAGG - Intergenic
932030909 2:68183541-68183563 CCAGGATTCCAGAAGGAAAATGG - Intronic
932093034 2:68823641-68823663 ACAGGAGGCCAGGACGCAGTAGG + Intronic
932335227 2:70927312-70927334 CCAGGAGCCCAGGAGCCAGGTGG + Intronic
932715838 2:74100362-74100384 ACAGAAGGCAAGATGGCAGAGGG - Intronic
932744140 2:74317712-74317734 CTAGGAGTCCAGCAGGCAAAGGG - Intronic
933333969 2:80930579-80930601 CCTGGAGGCTAGAAGGGAGTGGG + Intergenic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
935257574 2:101325608-101325630 CATGGAGGCCAAAAGGCAGTGGG - Intergenic
935374990 2:102386857-102386879 ACAGGACTCCAGAAGGCAAATGG + Exonic
935720519 2:105975089-105975111 CCTGGAGCAGAGAAGGCAGAGGG - Intergenic
935725647 2:106021674-106021696 CCAGGAGGCCACGCTGCAGAAGG + Intergenic
936026451 2:109034516-109034538 GCAGCAAGCCAGCAGGCAGAGGG + Intergenic
936053782 2:109245174-109245196 CCAGGAGCACAGAAGCCACATGG - Intronic
936076563 2:109405171-109405193 CCAGGAAGCCAGCAGGTAGTTGG - Intronic
936472522 2:112811685-112811707 CAGGGAGGCCACAAGGCTGATGG + Intergenic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
937235652 2:120430571-120430593 CCAGACAGCAAGAAGGCAGAGGG + Intergenic
937512870 2:122617453-122617475 CATGCAGGTCAGAAGGCAGAGGG - Intergenic
937671520 2:124542510-124542532 CCTGGAGGCTGGAAGGCAGCTGG - Intronic
937722255 2:125115112-125115134 CCTAGAGACCAGAAGGCAGTTGG + Intergenic
937955096 2:127417670-127417692 CCGGGGTGCCAGAAGGGAGAAGG - Intergenic
937986210 2:127639230-127639252 GCAGGAGGGGAGAAGGCGGAGGG + Exonic
938146606 2:128839616-128839638 TCAGGAAGCCAGATGGGAGAAGG + Intergenic
938502291 2:131836348-131836370 CCAGGAAGCTGGAAGGCAGAAGG + Intergenic
938760209 2:134418457-134418479 CCAGGAGGGCAGGATGCAGAGGG + Intronic
938844021 2:135189749-135189771 CTTGGAGGCCAGAAGGCAGTAGG + Intronic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
939936063 2:148294874-148294896 AATGGAGACCAGAAGGCAGAGGG - Intronic
941643512 2:168014936-168014958 CCAGGAGTCCTGAAAACAGAAGG - Intronic
942037866 2:172028363-172028385 CCAGGAGGCCAGAGGGAGGTGGG + Intronic
942057009 2:172193447-172193469 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
942194395 2:173503188-173503210 CCAGGAGCCCTGAAGACAAATGG - Intergenic
942291699 2:174478865-174478887 GAACAAGGCCAGAAGGCAGATGG + Intronic
943710346 2:191087099-191087121 CCAGGAGGCGACATTGCAGATGG - Intronic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
945267504 2:207905383-207905405 CCAGGACGCCATAAGGCTGGTGG + Intronic
945682076 2:212926348-212926370 TCAGGAAGCCAGAAGGTAGAAGG + Intergenic
946095072 2:217267515-217267537 CCATGAGGCTAGAAGCAAGATGG - Intergenic
946177989 2:217933556-217933578 CCAGGAAGCCAGAAGGGGAAAGG + Intronic
946201326 2:218072510-218072532 CCAGGCAGCAAGAAGGCTGACGG + Intronic
946440389 2:219690368-219690390 CTAGGAGGCCAGCAGGCCGCTGG + Intergenic
947256675 2:228173506-228173528 AAAGGAGGTCAGAAGTCAGATGG + Intronic
947869993 2:233429726-233429748 GCAGCAGGGCAGAAGGCAGACGG + Intronic
947877999 2:233480505-233480527 CCTGGAGGCCTGAAGACAGCCGG + Intronic
947996191 2:234529759-234529781 GCAGGAGGACAGAGTGCAGAGGG + Intergenic
948077187 2:235174052-235174074 GGAGGAGGTCAGGAGGCAGAGGG + Intergenic
948176245 2:235945844-235945866 CCATCATGGCAGAAGGCAGAGGG + Intronic
948181220 2:235982427-235982449 CTAGGAGGTCAGAAGGAAGGGGG + Intronic
948293860 2:236846818-236846840 ACAGGAGGCCTGATGGCAGGAGG + Intergenic
948644664 2:239396920-239396942 CCAGGACGCCTGGAGGCAGGTGG - Intronic
948937617 2:241177873-241177895 CCAGCAGGGCAGTGGGCAGATGG - Intronic
949021941 2:241745881-241745903 CGAGGAGGCCAGAGGACAGCGGG - Intronic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1168978200 20:1983666-1983688 CAGGGAGGCCAGCAGGGAGAGGG - Intronic
1169039931 20:2484604-2484626 GGAGAAGGCCAGAAGGCAGGAGG + Exonic
1169698754 20:8422783-8422805 CCAGCAATCCAGATGGCAGAGGG + Intronic
1172004213 20:31806750-31806772 CCAGCAGGCTACGAGGCAGATGG - Intergenic
1172097390 20:32467088-32467110 GCAGGAAGCCATAAGGCTGATGG - Intronic
1172265248 20:33606516-33606538 CCAGCAAGCCAGGAGGGAGAAGG - Intronic
1173006467 20:39143163-39143185 CCAGGAGGCATGATGGGAGAAGG - Intergenic
1173849760 20:46210389-46210411 CCAGGAGGCCGGAGGGCGGCCGG + Exonic
1173887530 20:46473924-46473946 CCATTATGCCAGAATGCAGAGGG + Intergenic
1175034475 20:55987129-55987151 CTAGCAGGTCAGAAGCCAGAAGG + Intergenic
1175224621 20:57437786-57437808 CCAGCAGGACAGCAGGGAGAGGG + Intergenic
1175260117 20:57668916-57668938 CCTGGAGGCTGGAGGGCAGAGGG - Intronic
1175787538 20:61721409-61721431 GCAGGAGGGCTGGAGGCAGAGGG - Intronic
1175954316 20:62600767-62600789 CAGGTAGGCCAGGAGGCAGAGGG + Intergenic
1176073320 20:63237778-63237800 CCAGGTGGCAAGAAGGAGGAGGG - Intronic
1176222374 20:63975758-63975780 CCAGGAGGCCCAGAGGCAGGAGG - Exonic
1176785522 21:13251953-13251975 TCAGGAGGTCAGGAGGCTGAGGG - Intergenic
1177036738 21:16053990-16054012 TCAGGATGGAAGAAGGCAGAAGG + Intergenic
1177255167 21:18652176-18652198 ACTGGAACCCAGAAGGCAGAGGG + Intergenic
1177357755 21:20031191-20031213 CAAGGAGAACAGAAGACAGATGG - Intergenic
1177411782 21:20738950-20738972 CCATCAGGGCAGAAGGCAAAAGG - Intergenic
1177887470 21:26763382-26763404 CTTGGAGGTCAGAAGCCAGAAGG + Intergenic
1178268977 21:31172122-31172144 CCAGAAAGCCAGAAAGCAGGAGG + Intronic
1178814124 21:35911944-35911966 CCAAGAAGCAAGAAGGCAAATGG + Intronic
1179255836 21:39714540-39714562 CCTGGAGGCCAGAAGCCTGAGGG + Intergenic
1179490275 21:41736724-41736746 CCAGGACGCCTGACAGCAGAGGG - Intergenic
1180003395 21:45005787-45005809 TCATGAGGCCAGAAAGCAGTAGG - Intergenic
1180928580 22:19573512-19573534 GCAGAAGGGCAGAAGGCAGAAGG + Intergenic
1181688490 22:24545056-24545078 CCAGAGGGACAGAGGGCAGATGG + Intronic
1181854482 22:25772287-25772309 CCAGAAGGCCAGAAGGCCAGAGG + Intronic
1181940247 22:26470263-26470285 CCAAGAGGCTTGAAGGCAGCTGG + Intronic
1182309932 22:29397397-29397419 CCAGGAGGACCCAAGGCTGATGG - Intronic
1182546228 22:31078210-31078232 TCAGGAGGCAAGAAGGGTGATGG - Intronic
1182787642 22:32920827-32920849 GCAGGAGACTGGAAGGCAGAGGG + Intronic
1183185202 22:36287904-36287926 CCCAGAGCCCAGAAGGCTGAAGG + Intronic
1183313115 22:37122256-37122278 CCAGGAAGCCAGGATGCAGACGG - Intergenic
1183473879 22:38025075-38025097 CCAGGACACCAGGAGACAGAAGG - Intronic
1183508331 22:38221377-38221399 CCACCAGGCCAGGAGGCAGCTGG - Exonic
1184050247 22:41998800-41998822 GCAGGAGGCCCGAAGCAAGATGG + Exonic
1184175100 22:42784582-42784604 ACAGGAGGGCAGTGGGCAGATGG - Intergenic
1184508581 22:44918692-44918714 CCTGGAGGCCAGCAGGCCAACGG + Intronic
1184533570 22:45071689-45071711 CCAGGAGGCCACCAGGCACGAGG - Intergenic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
1184635618 22:45826605-45826627 TTTGGAGGCCAGAAGGCAGTGGG + Intronic
1184934875 22:47713983-47714005 CCTGGAGGCCGCAAGGGAGAAGG - Intergenic
1185324353 22:50218405-50218427 GGCGGAGGGCAGAAGGCAGAGGG + Intronic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
1185392672 22:50571086-50571108 CCAGGCAGACAGGAGGCAGAGGG + Intronic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
949482287 3:4505101-4505123 CCAAGAGGCCATAAGGCAGTTGG - Intronic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
949840605 3:8315865-8315887 GCAGGAGGGCTGAAGGCATAAGG - Intergenic
949894014 3:8755927-8755949 CCGGGAGGCAAGAAGGGAAAAGG + Intronic
950086761 3:10264335-10264357 ACTGGAGGCTAGAAAGCAGATGG - Intronic
950622945 3:14221872-14221894 GAAGGAGGCCAGAAGACAGTGGG - Intergenic
951702194 3:25507748-25507770 TCAGGAGGTCAGAAGGAAAATGG + Intronic
952942555 3:38455041-38455063 CCTGGAGGCCCGAAGGAAGAGGG - Intronic
953045936 3:39294277-39294299 CCAGGAGGCCAGGTGGGTGATGG + Intergenic
953355657 3:42254414-42254436 CCATGTGGCCAGCAGCCAGAGGG - Intergenic
953391182 3:42534764-42534786 CCAGGAGGGCTGGGGGCAGAAGG + Intronic
954093639 3:48304751-48304773 CATGGAGGCCAGAAAGCAGTAGG - Intergenic
954286789 3:49625099-49625121 CCAGCAGGCCAGGAGGCTGATGG + Exonic
954737747 3:52720590-52720612 AATGGAGGCTAGAAGGCAGAAGG + Intronic
954749626 3:52806212-52806234 CATGGAGGCCAGAAGGCTGGGGG + Intronic
954889081 3:53906631-53906653 CACGGAGGCCAGAAGGCAGTGGG + Intergenic
954991165 3:54841862-54841884 CCTGGAGGCCAGAAGCCACGTGG - Intronic
955338343 3:58105317-58105339 CCAGGAGGCCAGGAAGCTAAAGG - Intronic
955778726 3:62461590-62461612 CCAGGAGGCAGGAAAGCAGGAGG - Intronic
957741015 3:84268364-84268386 AAAGGAGGCCAGAATGCAGTGGG - Intergenic
958844514 3:99249942-99249964 CCAGGTGGTCTGAAGGGAGAGGG + Intergenic
959926218 3:111924540-111924562 CCAGGAGGCCTGTAGTCACACGG + Intronic
960492608 3:118334889-118334911 CCAGGAGGACATCAGCCAGATGG + Intergenic
960564782 3:119121879-119121901 CATGGGGGCCAGAAGACAGAGGG + Intronic
960936486 3:122907146-122907168 CCATGAAGACAGAAAGCAGATGG - Intergenic
961202240 3:125054734-125054756 CTAGGAGGCTAGAAGGAACAGGG + Intronic
961378404 3:126481991-126482013 GCAGGTGGCCAGGAAGCAGAGGG + Exonic
961404090 3:126666761-126666783 CTTGGAGGCGAGAAGGCAAAAGG - Intergenic
962351795 3:134661735-134661757 GCAGGAGGCAGGAAGGAAGAGGG + Intronic
962531093 3:136280974-136280996 CATGGAGGCCGGAAGGCAGTGGG - Intronic
962957357 3:140278489-140278511 AAAGGAGGCCAGAAGGAGGAGGG - Intronic
963793158 3:149604788-149604810 CTGGCAGGCCAGAAGGCAGGTGG + Intronic
963931914 3:151012464-151012486 ACTGGAGGCCAGAAGGCAAGGGG - Intergenic
963934043 3:151034321-151034343 CCAGGATGAAAGAAGGCTGAAGG - Intergenic
964086967 3:152830731-152830753 ACAGGAGGCCAGCGGGGAGAGGG - Intergenic
966532088 3:180992464-180992486 TCAGGAGATCAGAAGGCAGGAGG + Intergenic
966535233 3:181025373-181025395 CTTGGAGGCCAGAAGGGAGTGGG - Intergenic
968110860 3:196045455-196045477 CCATCATGGCAGAAGGCAGAGGG + Intronic
968197101 3:196715769-196715791 GCTTGAGGCCAGGAGGCAGAGGG - Intronic
968465771 4:749898-749920 GCAGGAGCCCAGGAGGCAGAGGG - Intronic
968543475 4:1181206-1181228 CATGGAGGCCAGTAGGCAGTTGG + Intronic
968791135 4:2663190-2663212 CCAGGGGCCCCGAAGGAAGATGG + Exonic
968898831 4:3421132-3421154 ACAGGCGGCCCGCAGGCAGAGGG - Intronic
969386060 4:6849190-6849212 GCAGGGGTCCAGGAGGCAGATGG + Intronic
970655704 4:18228270-18228292 GCTGGAGGCCAGTGGGCAGAGGG + Intergenic
971009200 4:22413258-22413280 CAAGGAGGCTGGAAGTCAGATGG - Exonic
971161209 4:24135974-24135996 CCAGGAGGGGAGAGAGCAGAGGG + Intergenic
971226419 4:24756824-24756846 AGAGGAGGCCAGAAGACAGTGGG - Intergenic
971947352 4:33298481-33298503 CCAAGAGGCCGGAAGAAAGAAGG + Intergenic
972174429 4:36386142-36386164 GCAGGAGATCAAAAGGCAGAAGG - Intergenic
972261944 4:37417608-37417630 CCTGGAGGCCTGAAGCCAAAAGG + Intronic
972365289 4:38368791-38368813 TCAGGAGGGCATAATGCAGAAGG - Intergenic
972501093 4:39678606-39678628 ACCAGAGGCCAGAAGGAAGATGG - Intergenic
973555794 4:52081418-52081440 CCCTGAGGCCAGAAGGAGGAGGG - Intronic
975191372 4:71466873-71466895 AGAGGAAGCCAGAAGGCAAAGGG - Intronic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
978230762 4:106395754-106395776 TTTGGAGGCCAGAAGGCAGTGGG - Intergenic
978923244 4:114211944-114211966 CCAGTAACCTAGAAGGCAGATGG + Intergenic
978940234 4:114427970-114427992 CCAACAAGCCAGAAGGCAGTGGG - Intergenic
979693283 4:123583580-123583602 GCTGGAGCCCAGGAGGCAGAAGG - Intergenic
980088883 4:128420883-128420905 CCAGGAGGCCACAGGGTACAGGG + Intergenic
980480550 4:133381528-133381550 CCAGGAGCACTGAAGTCAGAAGG - Intergenic
980854172 4:138419400-138419422 CCAGGAGGCTGGAGGTCAGAAGG - Intergenic
981365918 4:143903020-143903042 AAAAGAGGACAGAAGGCAGAGGG - Intronic
981376024 4:144016833-144016855 AGAAGAGGACAGAAGGCAGAGGG - Intronic
981386548 4:144138192-144138214 AAAAGAGGACAGAAGGCAGAGGG - Intronic
981633296 4:146846583-146846605 CAAGGTGGCCAAAAGGAAGAAGG - Intronic
981637577 4:146898350-146898372 CCAGGAGCTCAGAAGGCACCAGG - Intronic
981862326 4:149371524-149371546 CCATCATGCCAGAAGGCTGATGG + Intergenic
981989860 4:150904936-150904958 CAAGTGGGCCAAAAGGCAGAAGG + Intronic
982728459 4:158930127-158930149 CATGGAAGCCAGAAGGCAGGAGG - Intronic
983921433 4:173349818-173349840 CCAGGTGTTCAGAAGGCAGTGGG + Intergenic
984141298 4:176006443-176006465 CCAGGAGGCGGCATGGCAGATGG + Intergenic
984369564 4:178845215-178845237 CATGGAGGCCAGAAGGCAGTGGG + Intergenic
984706001 4:182847698-182847720 CCAGAAGGGCAGAGAGCAGAGGG + Intergenic
984709097 4:182869976-182869998 CCAGGAAGCCAGAGGGCACGGGG + Intergenic
984816815 4:183846126-183846148 CACGGAGGCCAGAAGGCAATAGG - Intergenic
985062293 4:186091439-186091461 CCTGGAGGTCAGAAGCAAGATGG + Intergenic
985552506 5:540788-540810 GCAGCAGGCCAGGAGGGAGACGG - Intergenic
985791201 5:1927883-1927905 CCAGCAGGCAGGAAGGCTGAAGG + Intergenic
985913856 5:2903135-2903157 CCAGCAGGGCAGAAAGCAGATGG - Intergenic
986233423 5:5886557-5886579 CCAGGCGGCCACGAGGCCGAGGG + Intergenic
986264646 5:6181377-6181399 TCAGGAGGCCACAGGGCATATGG + Intergenic
987793973 5:22604961-22604983 CAAGGAGCCCAGAAGAGAGAGGG - Intronic
988601215 5:32640937-32640959 CCACGAGGCCTTAAGACAGATGG + Intergenic
988690182 5:33564098-33564120 CCCACAGGCCAGAAGGCAGGAGG + Intronic
990013047 5:51023415-51023437 CAGGAAGGCCAGAAGGGAGAAGG - Intergenic
991218180 5:64180855-64180877 CCAGGAAGCTACTAGGCAGAAGG + Intronic
991402548 5:66268835-66268857 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
991934047 5:71784266-71784288 TCAGGAGGCCTTGAGGCAGAGGG - Intergenic
992094334 5:73347240-73347262 CATGGAGGCCAGAAGGCAGTAGG + Intergenic
992124560 5:73626751-73626773 CCAGGACCGCAGAATGCAGACGG + Intronic
992626316 5:78638619-78638641 GCAGGCGGCCGGAGGGCAGAGGG - Intronic
993396467 5:87395784-87395806 ACTTGAGCCCAGAAGGCAGAGGG + Intronic
993496248 5:88612588-88612610 CCAGAAGGACAGAAGAAAGAGGG + Intergenic
994276876 5:97849367-97849389 ACAGGAGACCTGAAGGCAGGTGG + Intergenic
994919448 5:106024514-106024536 ACAGGAGAACCGAAGGCAGAAGG + Intergenic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
995190347 5:109312846-109312868 CCAGGAGCCCAGTATACAGAAGG - Intergenic
996351041 5:122542172-122542194 GCAGGAGGCCAGGAGTCTGAGGG - Intergenic
996367506 5:122718768-122718790 CAAGGAGACCAGAAGTTAGATGG - Intergenic
997481448 5:134188090-134188112 ACAGGAGGCCAGAGGGTAAAAGG - Intronic
997519059 5:134510872-134510894 CAAGGAGGCTAGTAGGCAAAAGG - Intergenic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
998306543 5:141083250-141083272 GCTGGAACCCAGAAGGCAGAAGG - Intergenic
998915077 5:147003819-147003841 CGAGGAAGGTAGAAGGCAGAAGG - Intronic
998949729 5:147381225-147381247 TTTGGAGGCCAGAAGGCAGTGGG - Intronic
999096123 5:148979449-148979471 ACAAGAGGGCAGAAGCCAGATGG - Intronic
999096157 5:148979721-148979743 GGATTAGGCCAGAAGGCAGACGG - Intronic
999265804 5:150266137-150266159 ACAGCAGTCCAGAAGGCAGGAGG - Intronic
1000334161 5:160229524-160229546 GCTGGAGGCCAGAGAGCAGAGGG - Exonic
1000783058 5:165508514-165508536 TATGGAGGCCAGAAGGCAGTGGG + Intergenic
1000980268 5:167809443-167809465 GCAGGAGGTGAGAAGGTAGAGGG + Intronic
1001135788 5:169101522-169101544 CAAGGAGTCCTGGAGGCAGATGG - Intronic
1001225974 5:169944841-169944863 ACTGGAGCCCACAAGGCAGATGG - Intronic
1001359554 5:171067709-171067731 CATGGAGGTCAGAAGGCAGTGGG - Intronic
1001418637 5:171569230-171569252 TTTGGAGGCCAGAAGGCAGTGGG - Intergenic
1001845062 5:174915160-174915182 CCAGGAGGGCACCAGGCATAGGG - Intergenic
1001859145 5:175037912-175037934 CCAGGAGGCCAAAAGACATTTGG - Intergenic
1002134064 5:177097423-177097445 CCTGGAGGGGAGCAGGCAGAGGG - Intronic
1002691192 5:181052007-181052029 CGAGGAGGCCAGAGGGTCGAGGG + Intronic
1003651885 6:7968519-7968541 CCAAGATGCCCGAAAGCAGAAGG + Intronic
1003801856 6:9678929-9678951 CCTGGAGGTCAGAAGCAAGATGG + Intronic
1004319019 6:14617981-14618003 CCAGCAGTCCAAAAGGCAAATGG + Intergenic
1004929563 6:20449014-20449036 CCAGGAGGCCAGAAATTGGATGG - Intronic
1004982234 6:21038284-21038306 CCAGTAGGCTAGAAGGCATGGGG + Intronic
1005142952 6:22654938-22654960 CCAGGAGCCCAAACGGTAGAGGG + Intergenic
1005709259 6:28487753-28487775 CCATGAGGCTAGAAGCAAGATGG + Intergenic
1006164075 6:32054238-32054260 CAGGGAGGCCAGTAGGCAGTTGG - Intronic
1006756082 6:36416830-36416852 GCTGGAGGCCAGAATGCAAATGG + Intronic
1006890753 6:37425612-37425634 TCTGGAGGCCAGAAAGCAGTGGG - Intergenic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007158599 6:39770634-39770656 CCAAGACGCTAGATGGCAGATGG + Intergenic
1007174005 6:39884076-39884098 CCAAGAGGCCAGAGGGTATAGGG - Intronic
1007397341 6:41585351-41585373 CCAGGAGCCCAGATGGGACAGGG + Intronic
1007423480 6:41733574-41733596 CCCCGCGGCCAGGAGGCAGACGG + Intronic
1007430793 6:41775605-41775627 CCTGGAGGGGAGAAGACAGAAGG + Exonic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007725480 6:43913352-43913374 CCAGAAGGACGGAAGACAGAGGG - Intergenic
1007843901 6:44738488-44738510 CCAGGAGGGCTGAGAGCAGAGGG + Intergenic
1008019891 6:46564531-46564553 ACAGAAGGCCAGAAGGAAGGAGG + Intronic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1010526722 6:76908786-76908808 CCTGGAAGCCAGAATGCAGTGGG + Intergenic
1010799804 6:80162340-80162362 GCAGGAGGAAAGAAGGCATATGG - Intronic
1010830074 6:80516390-80516412 ACAGGAAGCCAGAAGGCAAGGGG + Intergenic
1010845342 6:80700680-80700702 CATGGAGGCCAGAAGGCATTGGG - Intergenic
1011067669 6:83345104-83345126 TCAGGAGGCTAGAAGGTAGGAGG - Intronic
1011342777 6:86335948-86335970 CCAGGAGTCCAGGAAGCTGAAGG + Intergenic
1013978165 6:116100620-116100642 CTAGGAGCCCAGAAGGCAGTAGG - Intergenic
1014223817 6:118825244-118825266 CCAGGAGACCAAAAGAAAGAGGG + Intronic
1014856860 6:126412376-126412398 CAAGGAGGCCAGAAGGCAGTGGG - Intergenic
1015671330 6:135693257-135693279 CCTGGAGAAGAGAAGGCAGAAGG + Intergenic
1016539431 6:145147724-145147746 GCAGGAGGTGAGAAAGCAGATGG - Intergenic
1016977691 6:149825031-149825053 CCAGGAGGCCAGCAGACCAAGGG + Intronic
1018059821 6:160081426-160081448 ACAAGAGGTCACAAGGCAGAAGG + Intronic
1019092388 6:169550107-169550129 ACAGGGGGCCAGGAGGCACAAGG + Intronic
1019184492 6:170213207-170213229 CCAGGGAGGCAGAAGACAGACGG + Intergenic
1019357812 7:590101-590123 CCTGGAGACCAGAAGACAGAGGG + Intronic
1019451442 7:1100724-1100746 CCGGGAGGCAGGGAGGCAGAGGG - Intronic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019812442 7:3174683-3174705 CCAGCAGGCCAGAGGGAAGGTGG - Intergenic
1021079360 7:16345171-16345193 CATGGAGGTCAGAAGGCAGTGGG + Intronic
1021669138 7:23017186-23017208 ACAGGAAGCCACAAGGCAAAAGG - Intergenic
1021804763 7:24343771-24343793 CCAGGAGGACAGAGAGCATATGG + Intergenic
1022170040 7:27817968-27817990 ACAGGAGGCCAAAAGGCAGGAGG - Intronic
1022488914 7:30801585-30801607 TCAGGAGGCCAGCAATCAGAAGG - Intronic
1022966211 7:35475124-35475146 CTTGGAGGCCTGAAGGCAGTGGG + Intergenic
1023198291 7:37665766-37665788 CCAGCAGGGCAGAAGGAAAAAGG - Intergenic
1023266342 7:38410200-38410222 TCAGGTTGGCAGAAGGCAGAGGG + Intronic
1023631970 7:42173999-42174021 CCAAAAGGCCAAAAGGCAAATGG + Intronic
1023632227 7:42176244-42176266 CCAAGATGCCAGAAGGCAGCTGG + Intronic
1023689826 7:42774238-42774260 GCAGGAGGCCACAATGTAGAGGG - Intergenic
1023959088 7:44912069-44912091 TCACAAGGCCAGGAGGCAGATGG + Intergenic
1024106212 7:46089112-46089134 AGTGGAGGCCAGAAGGCAGTGGG - Intergenic
1024287674 7:47773305-47773327 TCTGGAGGCCAGAAGTCTGAAGG - Intronic
1024440268 7:49408427-49408449 TGAGGAGGCCAGAAGGCGGATGG - Intergenic
1024706567 7:51967508-51967530 CCTGGAAGCAAGAAGGCACATGG - Intergenic
1025092945 7:56078275-56078297 CCTGGGGGCCAAATGGCAGAAGG - Intronic
1025256675 7:57388660-57388682 GCAGGAGGCCAGAGGGGAGCAGG - Intergenic
1025734448 7:64134717-64134739 GCAGGAGGCAAGAAAGCATATGG - Intronic
1026065638 7:67070053-67070075 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1026351928 7:69524681-69524703 CATGGAGCCCAGAAGGCAGTGGG - Intergenic
1026711237 7:72741807-72741829 CATGGAGGCCAGAAGGCAGTGGG + Intronic
1026761633 7:73131235-73131257 GCAAGAGGCCAGAAGGAAGCAGG + Intergenic
1027037973 7:74940056-74940078 GCAAGAGGCCAGAAGGAAGCAGG + Intergenic
1027085588 7:75261418-75261440 GCAAGAGGCCAGAAGGAAGCAGG - Intergenic
1027640433 7:80726909-80726931 CCAGGATGACAGATGGCAGTGGG - Intergenic
1028186861 7:87796621-87796643 TCTGGAGGCCAGAAGGCAGTGGG + Intronic
1028635176 7:92980453-92980475 CATGGAGGCCAGAATGCAGTTGG - Intergenic
1029102725 7:98147063-98147085 CGTGGAGGCTAGAAGGCAGTGGG - Intronic
1029177510 7:98675279-98675301 CCAGGAGGTCACAGGACAGATGG - Intergenic
1029419990 7:100467420-100467442 CCAGCAGCCCAGCAGGGAGAGGG + Intronic
1029538952 7:101171952-101171974 GCAGGAGGGCAGGAGTCAGAGGG + Exonic
1029919550 7:104248452-104248474 CCAGCAAGCCAGAAGACAGTGGG + Intergenic
1029941463 7:104484748-104484770 CCATGAGGGGGGAAGGCAGAAGG + Intronic
1030583010 7:111383655-111383677 CCAGAATCCCAGAAGGCAGGAGG + Intronic
1031144090 7:117978738-117978760 GCAGGAGGCTAGAGGACAGAAGG + Intergenic
1032069428 7:128794680-128794702 CCAGGAGCCCTGCAGGGAGAGGG - Exonic
1032232114 7:130083843-130083865 CCAGGAAGCCAAAAGGGAAAAGG - Intronic
1032326840 7:130936705-130936727 CTTGGAGGCCAGAACCCAGAGGG - Intergenic
1032989559 7:137377613-137377635 CATGGAGTCCAGAAGGCAGCAGG - Intergenic
1033002508 7:137522416-137522438 CCAAGAGTCCAGAAGCCACAGGG + Intronic
1033534292 7:142298093-142298115 TCAGGAGGACTGAGGGCAGATGG + Intergenic
1033658570 7:143388957-143388979 CCGGGAACCCAGAAGGCAGGTGG - Intronic
1034272870 7:149811877-149811899 CCAGGAGGCGGGCAGGCAGGAGG - Intergenic
1034392195 7:150795339-150795361 CAAAGAGGCCAGAAGGCATAGGG - Intronic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1034886674 7:154803710-154803732 CCAGGAGAGGAGCAGGCAGAAGG + Intronic
1035308319 7:157947873-157947895 CATGGAGGCCTGAAGGCAGTGGG + Intronic
1035369664 7:158371999-158372021 CCAGGAGGGCTGATGGCAGAGGG - Intronic
1035526806 8:319918-319940 GATGGAGGCCAGAAGGCAGTGGG - Intergenic
1036159857 8:6377268-6377290 CTTGGAGGCCAGAAGGCAGTGGG + Intergenic
1036519874 8:9481398-9481420 CTTGCAGGCCAGAAGGCAGTGGG + Intergenic
1036755803 8:11470398-11470420 CCTCGAGGCCAGAATGCAGCAGG + Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037603141 8:20415714-20415736 CCAGGTGGTAAGAAGGGAGAGGG + Intergenic
1037662675 8:20940996-20941018 ACAGCAGGCCAGGAGGCACAGGG - Intergenic
1038079520 8:24118072-24118094 TCAGGAACCCAGGAGGCAGAAGG - Intergenic
1039305199 8:36254595-36254617 CCGTGAGGCCAGAAGCAAGATGG - Intergenic
1039466566 8:37789046-37789068 CCAGGAGCCCTGAAACCAGATGG + Intronic
1039714713 8:40095029-40095051 CCAGGAGGCAGGAAGGAGGAAGG - Intergenic
1040969690 8:53121556-53121578 TCAGGAAGCCAGAATGGAGAAGG + Intergenic
1041155702 8:54984234-54984256 TATGGAGGCCAGAAGGCAGTGGG - Intergenic
1041761586 8:61373118-61373140 CTAGGAGTCCAGAAGTCAAAGGG + Intronic
1042213260 8:66402893-66402915 CCAGGAGGGGAGAGGGCAAATGG + Intergenic
1043883754 8:85574591-85574613 ACAGGAGGCTAAAAGTCAGAGGG + Intergenic
1045560910 8:103261697-103261719 ACTGGAGGTCAGAAAGCAGAGGG + Intergenic
1046324012 8:112616716-112616738 CAAACAGGCCAGATGGCAGATGG + Intronic
1046708050 8:117477773-117477795 CCAGGAGGCAGGAAGGCAGTGGG + Intergenic
1047211526 8:122844125-122844147 CCAGGAGGCGGGAAGGAAAAAGG + Intronic
1047565483 8:126039592-126039614 CAAGGAGGGCAGCAGGCAAAGGG - Intergenic
1047574351 8:126136410-126136432 CCAGGAGGCCAACAGGCAAAGGG + Intergenic
1047622063 8:126618054-126618076 CCAGGAGGCAGAAAGGCATAGGG - Intergenic
1048039396 8:130710900-130710922 CCAGGAAGACAGGAGGCAGTAGG - Intergenic
1048099488 8:131333930-131333952 TCCAGAGGCCAGAAGGCAGTTGG + Intergenic
1048356042 8:133654789-133654811 GAAGGAGCCCAGCAGGCAGAAGG + Intergenic
1048517048 8:135120695-135120717 CAAGGACATCAGAAGGCAGAAGG - Intergenic
1048587971 8:135792718-135792740 GCAGCAGGACAGGAGGCAGAAGG - Intergenic
1048767652 8:137862340-137862362 CCAGGACGAGAGAAGGCAGGAGG - Intergenic
1048863999 8:138745991-138746013 CCAGCAGGCAAGCAGGCAGGCGG + Intronic
1048935253 8:139349870-139349892 CCCTGGGGCCAGAAGCCAGAGGG - Intergenic
1049090565 8:140511107-140511129 CCACGAGGCCCGGAGTCAGAGGG + Intergenic
1049099204 8:140567311-140567333 CCACGAGGGCAGGAGGCACATGG + Intronic
1049178309 8:141207115-141207137 CCAGGAAGGCAGAGGGCAGGAGG + Intergenic
1049181546 8:141225695-141225717 CCGGGAGACAAGAAGGCACAGGG + Intronic
1049227946 8:141466607-141466629 CCTGGGAGCCTGAAGGCAGAGGG + Intergenic
1049337099 8:142092388-142092410 CCAGGAGGCTAGAGGGCAGTGGG - Intergenic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1049407431 8:142457950-142457972 CCAGGGGGCTGGGAGGCAGACGG - Intronic
1049496768 8:142939252-142939274 CCAGGAGGCCAGCAGGGGCAGGG + Intergenic
1049541919 8:143212521-143212543 ACACAAGGCCAGAAGGCAGGTGG + Intergenic
1049610342 8:143552361-143552383 CCAGAAAGCCAGAAGCCAGGTGG + Intergenic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1049653793 8:143789016-143789038 CCAGGAGGCCCAGAGGCACAAGG + Intergenic
1049726272 8:144147965-144147987 GCGGGTGGCCAGAAGGCAGCGGG + Intergenic
1049796156 8:144498153-144498175 CCGGGAGGCCTGGAGGCAGAGGG + Intronic
1049866686 8:144943172-144943194 CATGGAGGTCAGAAGGCAGTGGG - Intronic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1050493004 9:6209281-6209303 CATGGAGGCCAGAAGACAGTGGG - Intergenic
1051742314 9:20263827-20263849 CCAGGAGGGCACAAGGGAGAGGG - Intergenic
1051939222 9:22484767-22484789 CAAGGAGGGCATAAGGCAGAAGG + Intergenic
1052191737 9:25670563-25670585 CGAGGAGGGGAGAAGTCAGATGG - Intergenic
1053304804 9:36976851-36976873 ACGGGAGGCCAGATGGCAAAGGG + Intronic
1053586543 9:39464483-39464505 CCGGGAGGGCAGACGGCAGGAGG + Intergenic
1054579764 9:66900750-66900772 CCGGGAGGGCAGACGGCAGGAGG - Exonic
1056061070 9:82885420-82885442 CAAGGAGGGGAGAAGTCAGATGG - Intergenic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057722671 9:97545554-97545576 TCAGGAGGTTAGAAGGCAGCGGG + Intronic
1058689790 9:107510065-107510087 CTAGGAGCCCAGAGGGCACAGGG + Intergenic
1058757186 9:108094049-108094071 CCAGGAGGCCAGGAGGGTGCAGG - Intergenic
1059335600 9:113566731-113566753 CCAGAAGGCCTGAGGGCAGCAGG - Intronic
1059388868 9:113986346-113986368 ACAGGAGGCCAGGACTCAGATGG - Intronic
1060044495 9:120328900-120328922 CCAGGACCCCAGGTGGCAGAAGG + Intergenic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1060770449 9:126327836-126327858 ACAGGAGGGCAAAAGGCAAATGG + Intronic
1061014692 9:127974993-127975015 CCAGGAGGGCAGGATGGAGATGG - Intronic
1061064404 9:128268382-128268404 ACAGGAGGGCAGTGGGCAGAGGG + Intronic
1061179306 9:129014379-129014401 CCAGGAGGCCAGCGGGGAGCGGG + Intronic
1061185032 9:129048123-129048145 CAAGGAGGCGGGAAAGCAGATGG + Intronic
1061318418 9:129812500-129812522 CTGGGAAGCCATAAGGCAGAGGG + Intergenic
1061512220 9:131068270-131068292 CCAGGAGGGAAGAAGGCATCGGG + Intronic
1061669968 9:132183144-132183166 CCAGGAAGCCAGAAGGAGGATGG - Intronic
1061871581 9:133523570-133523592 CCCAGAGGCAAGAAGGCAGGGGG + Intronic
1061881555 9:133571587-133571609 CGTGGGGCCCAGAAGGCAGAGGG - Intronic
1062192825 9:135256486-135256508 CCAGGTGGAGAGGAGGCAGAGGG - Intergenic
1062226780 9:135456871-135456893 CCAGGACTCCAGGAGACAGATGG - Intergenic
1062406448 9:136399082-136399104 CCAGGAAGTCTGAAGGGAGAAGG + Intergenic
1062471881 9:136709745-136709767 CCAGGCTGCCAGGAGGGAGATGG - Intergenic
1062478200 9:136739917-136739939 CCAGGAGGGCAAAGGGCTGAGGG + Intronic
1062497149 9:136837331-136837353 CCAGGAAGCTGAAAGGCAGAAGG - Exonic
1062647322 9:137555287-137555309 GCAGGTGGCCAGGAGGCTGAAGG + Exonic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1186561599 X:10619123-10619145 CGAGGGGGCAAGAAGGCGGAGGG + Intronic
1187684316 X:21801103-21801125 CCAGGAAGGCAACAGGCAGAGGG - Intergenic
1188727347 X:33602151-33602173 CATGGAGGCCAGAAGACAGTGGG - Intergenic
1189189300 X:39084118-39084140 CTTGGAGGCCAGAAGGAAGTGGG + Intergenic
1189231511 X:39455727-39455749 CCAGCAGGTCAGAAGGAACACGG - Intergenic
1189448791 X:41107357-41107379 CTTGAAGGCCAGAAGGCAGTGGG - Intronic
1189453142 X:41158398-41158420 CATTGAGGCCAGAAGGCAGTAGG + Intronic
1190782802 X:53614669-53614691 CCATCAATCCAGAAGGCAGATGG - Exonic
1190990559 X:55545389-55545411 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1191633614 X:63351606-63351628 CCTGGAAGACAGAAAGCAGATGG - Intergenic
1191793545 X:64997167-64997189 CATGGAGGCCAAAAGGCAGTGGG + Intronic
1193076055 X:77356910-77356932 TCATGAAGCCAGAAGGCTGATGG + Intergenic
1193160279 X:78220452-78220474 CTTGGAGGCCAGAAGACAGTGGG + Intergenic
1193993576 X:88339437-88339459 CCAAGAAGACATAAGGCAGAAGG - Intergenic
1194620108 X:96160691-96160713 CCTGGAGGTCAGAAGCAAGATGG + Intergenic
1194641207 X:96406039-96406061 ACAGGAGGCCATCAGGCTGAGGG + Intergenic
1194677146 X:96807631-96807653 TCAGGAGGCCATAAGACTGAGGG - Intronic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195371392 X:104178247-104178269 GCATGAGCCCAGGAGGCAGAGGG - Intronic
1196006649 X:110843901-110843923 TGGGGAGGCCAGAAGGAAGATGG - Intergenic
1196258881 X:113554744-113554766 TGAGGAAGCCAGAAGGGAGATGG + Intergenic
1196346176 X:114661704-114661726 AAAGGAGGTCAGAATGCAGATGG - Intronic
1196649050 X:118150202-118150224 CTTGGAGGCCAGAAGCAAGATGG - Intergenic
1197398534 X:125959204-125959226 CTTGGAGGCCATAAGGCAGTAGG + Intergenic
1197835791 X:130692505-130692527 CCAAGAGTCAAGAAGGCAGTGGG - Intronic
1198078246 X:133214614-133214636 TTAGGAGGCCAGAAGGCAAAAGG + Intergenic
1198444518 X:136698576-136698598 CTTGGAGGCCAGAAGGCAGTGGG + Intronic
1199580063 X:149351857-149351879 TGAGGAGGCCAGAAGGGAGATGG + Intergenic
1199688303 X:150284355-150284377 CATGGAGGCCAGAAGGTAGTGGG + Intergenic
1199880983 X:151974314-151974336 ACAGGACGCCAGAAGGAAGACGG - Intronic
1200101792 X:153692037-153692059 CCAGCAGGCCAGCAGACAAAGGG - Exonic
1200315639 X:155129954-155129976 CATAGAGGCCAGAAGGCAGTGGG + Intronic
1200369481 X:155708340-155708362 AATGGAGGCCAGAAGGCAGTGGG - Intergenic
1200532933 Y:4359442-4359464 CGAGGAGGGGAGAGGGCAGATGG + Intergenic
1202174150 Y:22082105-22082127 TCTTGAGGCCAGAAGGAAGAAGG - Exonic
1202217210 Y:22504277-22504299 TCTTGAGGCCAGAAGGAAGAAGG + Exonic
1202325976 Y:23691782-23691804 TCTTGAGGCCAGAAGGAAGAAGG - Intergenic
1202544795 Y:25978272-25978294 TCTTGAGGCCAGAAGGAAGAAGG + Intergenic