ID: 1105284990

View in Genome Browser
Species Human (GRCh38)
Location 13:18996282-18996304
Sequence TCAGAAGACCAGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105284983_1105284990 17 Left 1105284983 13:18996242-18996264 CCAGGCAAGAAAGCAGAAGACTA 0: 1
1: 0
2: 3
3: 19
4: 234
Right 1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG 0: 1
1: 0
2: 6
3: 58
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105284990 Original CRISPR TCAGAAGACCAGAGGGCAGA AGG Intergenic
900827852 1:4940961-4940983 TCTGAAAGCCAGAGGGCTGATGG - Intergenic
901703611 1:11058638-11058660 TAGGAAAACCAGATGGCAGAGGG - Intronic
902741899 1:18444672-18444694 ACAGGAGTCCAGAGGTCAGATGG + Intergenic
903861193 1:26365408-26365430 TGAGAAGCCAAGTGGGCAGATGG + Intronic
904836621 1:33341858-33341880 TCTGAATACCAGAAGGCAGGGGG + Intronic
904873266 1:33635015-33635037 TCCGGACACAAGAGGGCAGAAGG - Intronic
904973005 1:34433789-34433811 AGAGAAGACCACAAGGCAGAGGG + Intergenic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
906933742 1:50193976-50193998 TCATAAGAGCAGAAGGCTGATGG + Intronic
907285557 1:53377354-53377376 TCAGAATAGCAGCGGGCAGCTGG + Intergenic
910703690 1:90103978-90104000 TCAGACCACAAGAGGCCAGAAGG + Intergenic
911231343 1:95364775-95364797 GCAAAAGACCAGAGGGCAGGAGG + Intergenic
911922534 1:103783909-103783931 ACAGAAGACCAAAGGGGAGCAGG + Intergenic
912515587 1:110214813-110214835 TCAGAAAACCCAGGGGCAGATGG + Intronic
914419670 1:147517842-147517864 GCAGGACACCAGAGGGCAGCGGG + Intergenic
914973084 1:152329218-152329240 TCAGCAGCCCAGAGGCCAGATGG - Intergenic
915059023 1:153164444-153164466 TCTGAAGAGGAGAGGGGAGAAGG + Intergenic
915083202 1:153366125-153366147 ACAGAGGACAGGAGGGCAGAAGG - Intergenic
915799097 1:158769597-158769619 TAAGAAGACCGGAGGGCAGAAGG - Intergenic
916492424 1:165313697-165313719 GCAGAAGAGCTGAAGGCAGAAGG - Intronic
916511162 1:165473560-165473582 TCAGAACGCCAGAAGGGAGACGG + Intergenic
917389733 1:174522228-174522250 GCAGAACAGCAGAAGGCAGAGGG + Intronic
917580097 1:176368233-176368255 TCGGAAGACCAGAGCCCAAATGG - Intergenic
919155146 1:193754725-193754747 TCAGAGGATCAGAGGGAAAAAGG + Intergenic
920111605 1:203591149-203591171 GCAGAGGAACAGAGGGAAGAAGG + Intergenic
920164231 1:204024382-204024404 TGAGATGCCCAGAGGGCAGGTGG - Intergenic
920446185 1:206020541-206020563 TCAGAGGGTCAGAGGTCAGAGGG + Intronic
920650603 1:207834445-207834467 TGAGAAGGCCAAAGGGCAGCCGG + Intergenic
921230584 1:213066224-213066246 ACAGAATACCAGGGGGCAGAAGG + Intronic
921319619 1:213925979-213926001 TGTGAAGGCCACAGGGCAGAAGG + Intergenic
921681458 1:218037711-218037733 TCAGAAGACAACAGTTCAGATGG + Intergenic
921710360 1:218367472-218367494 TCAGAATACCAGGGGGCACAGGG - Intronic
922335924 1:224617913-224617935 TCAGACGCCAAGAGGGCAGATGG - Intronic
922879548 1:228970350-228970372 GCAGAAGAGCAGAGGGGAAAAGG - Intergenic
923086656 1:230707786-230707808 TCAGACGAGCAGAGGGAAGACGG - Intronic
923484405 1:234415226-234415248 TGAGAAGACAGGAGGGAAGAGGG + Intronic
924624438 1:245687606-245687628 TCAGAAGGCCAGCCGGCAGGAGG + Exonic
1062975928 10:1682680-1682702 TAGCAAGACCAGAGAGCAGAGGG + Intronic
1063563199 10:7148290-7148312 TGAGAGCACCAGAGGGAAGAAGG - Intergenic
1063716953 10:8537351-8537373 TCAGAAGAGCAGAGGGTAAAAGG - Intergenic
1063834077 10:9992134-9992156 TCAGAAAACCAAAAGACAGAAGG + Intergenic
1064096384 10:12427419-12427441 TCAGGAGAGCAGAGGGCAAAAGG - Intronic
1064339074 10:14470561-14470583 ACAGAAGTCCAATGGGCAGAAGG + Intergenic
1064516569 10:16155581-16155603 TCAGAAGACCAACCAGCAGATGG - Intergenic
1065450793 10:25854638-25854660 TCAGAAAACCAGATGGAAGGTGG + Intergenic
1069566275 10:69465376-69465398 CCAGAAGACCACAGTGGAGAAGG - Intronic
1069631478 10:69899707-69899729 TCTGAAGAGCAGAGGCCAGATGG - Intronic
1070662380 10:78316573-78316595 CCAGCAGCCAAGAGGGCAGATGG - Intergenic
1070913600 10:80138590-80138612 TCAGAAAATCACAGGGCAGGGGG + Intronic
1072417863 10:95263936-95263958 TCAGAAGAGTAGAGGCCAGCTGG + Exonic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073140454 10:101243669-101243691 TCAGAAGTCCATTGGGTAGACGG - Intergenic
1073761446 10:106632867-106632889 TCAGAAGACCTGAAAGAAGAAGG + Intronic
1074154027 10:110782876-110782898 TCCCAAGACTAGAGGTCAGAGGG - Intronic
1074306928 10:112287679-112287701 CCAGAAGCCCAGAGGGAGGAAGG + Intronic
1074454604 10:113586371-113586393 CCAGAAGACCAGTGGCTAGAAGG + Intronic
1074501125 10:114025855-114025877 TCAGAGGAACAGAGGACAGTTGG - Intergenic
1075167695 10:120084110-120084132 TCTGAATTCCAGAGTGCAGAGGG - Intergenic
1075536562 10:123276581-123276603 TCAGAGTACTAGAGGACAGAAGG - Intergenic
1076357763 10:129865464-129865486 CCAGAAGACCACAGGGGAGGTGG - Intronic
1076543706 10:131230147-131230169 TCAGACCACCAAAGAGCAGAGGG + Intronic
1076707600 10:132310122-132310144 GCAGAAGACAAGAGTGCAGGGGG + Intronic
1076922423 10:133461256-133461278 TCAGGAGACCGCAGGTCAGATGG - Intergenic
1077358701 11:2130265-2130287 CCAGAAGTCCTGAGGGCGGAGGG - Intronic
1077367736 11:2167925-2167947 CGAGAAGCCCTGAGGGCAGAGGG + Exonic
1078834193 11:15011086-15011108 TCAGAGGACCAGAAGGTAGGTGG - Intronic
1079133463 11:17762871-17762893 TTAGAAGACCAGAGCACTGATGG - Intronic
1079662657 11:23059856-23059878 TCAGAAGATCAGATGTTAGATGG - Intergenic
1081344667 11:41969152-41969174 TCAGAAGAAGAGAGGGTATATGG - Intergenic
1081524608 11:43917720-43917742 TCAGACAACCAGAGGGCAGTGGG - Intronic
1081674136 11:44958545-44958567 TCAGAAACCCAGGGGACAGAAGG - Intergenic
1081908859 11:46687228-46687250 TCTGAAGAGCAGTGGGAAGAGGG + Intronic
1082751561 11:57023950-57023972 ACAGAAGACAAAAGGGAAGAAGG + Intergenic
1082787253 11:57324051-57324073 TCAAGAGACCAGGGGGTAGAGGG + Intronic
1084002627 11:66305363-66305385 TCTGAAGAACAGAAGGCAGCAGG - Intergenic
1084095355 11:66907688-66907710 TTAGAAGAGCAGAGGGTAGAAGG - Intronic
1084204140 11:67581736-67581758 ACAAAAGATCACAGGGCAGAAGG - Intergenic
1084510969 11:69603494-69603516 TCTGAAGACAGGAGGGCAGGGGG + Intergenic
1085795056 11:79531713-79531735 TCAGGAGACCACAGTGCAGAGGG - Intergenic
1087793325 11:102430174-102430196 TGAGAAGACCAGAGTGCAGGTGG + Intronic
1088140622 11:106611703-106611725 TCTCAAGACCAAAGGGCATAGGG + Intergenic
1089522863 11:119077228-119077250 TCATAAAACAAGAGGGGAGATGG - Intronic
1089966809 11:122660084-122660106 TAAGAGGACCAGAGGGCTGCAGG + Intronic
1090096115 11:123742946-123742968 TCTGAAGGCCAGAGAGCAGGAGG + Intergenic
1090379736 11:126318053-126318075 TCTGAAGTCCAGAAAGCAGAGGG - Intronic
1091287495 11:134415835-134415857 TGAGAAGAGAGGAGGGCAGAGGG - Intergenic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091808638 12:3376635-3376657 TCAGCAGCTCAGGGGGCAGATGG - Intergenic
1092231956 12:6780910-6780932 AGAGAAGAGCAAAGGGCAGAAGG + Intergenic
1093384664 12:18537498-18537520 ACAAAAGACCAGAGAGAAGATGG - Intronic
1093394866 12:18668828-18668850 TCAGAATACACGAGTGCAGAAGG + Intergenic
1093972244 12:25385939-25385961 TCAAAAGAGCGGGGGGCAGAAGG - Intergenic
1094371672 12:29745273-29745295 CCAGAACACCAAAGGGCACAGGG + Intronic
1095092669 12:38121487-38121509 TCAGAAGCAGAGAAGGCAGATGG - Intergenic
1095323162 12:40854794-40854816 TCAGAAGAGCAGATGGCGGAAGG + Intronic
1095870256 12:47018796-47018818 TCAGAAGACCCGGGTGCAGGTGG - Intergenic
1095925813 12:47578103-47578125 TCAGAGGACAAGAGGTCAGCTGG + Intergenic
1096345815 12:50845400-50845422 ACAGAATGACAGAGGGCAGAGGG - Intronic
1096622993 12:52876011-52876033 TCTTAGGCCCAGAGGGCAGAGGG - Intergenic
1098046212 12:66403283-66403305 TCAGAAGAAGAGAGGGTAGACGG - Intronic
1101553531 12:105785492-105785514 TCAGCAGAGCAGAAGGAAGAAGG + Intergenic
1102290301 12:111693701-111693723 AGAGAAGACCAGAGACCAGAGGG - Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102620611 12:114191671-114191693 CCAGAAGATCAGAGGGCGGGAGG + Intergenic
1104521607 12:129480862-129480884 ACAGAGGACCAGAGGGCACATGG + Intronic
1104630803 12:130400471-130400493 GCAGATGACCAGCAGGCAGATGG - Intronic
1105253995 13:18727469-18727491 TAAGAAGACCAAAGTCCAGAAGG - Intergenic
1105284281 13:18992153-18992175 GGAGAAGGCCAGAGGACAGAAGG + Intergenic
1105284285 13:18992175-18992197 GCAGAAGGCTAGAAGGCAGAAGG + Intergenic
1105284308 13:18992332-18992354 ACAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284385 13:18992753-18992775 ACAGAAGGACAGAAGGCAGAAGG + Intergenic
1105284487 13:18993280-18993302 CCAGAAGGCAAGAGGACAGAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284561 13:18993722-18993744 CCAGAAGGCCAGAAAGCAGAAGG + Intergenic
1105284609 13:18994024-18994046 GCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284615 13:18994060-18994082 GCAGAAGGCCAGAAGCCAGAAGG + Intergenic
1105284633 13:18994145-18994167 CCAGAAGGCAAGAAGGCAGAAGG + Intergenic
1105284639 13:18994173-18994195 CCAAAAGGCCAGAAGGCAGAAGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284765 13:18994947-18994969 CAAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284767 13:18994970-18994992 TCAGAAGACCAGCAAGCAGAAGG + Intergenic
1105284789 13:18995089-18995111 CCAGAAGGCCAGAGGGTAGAAGG + Intergenic
1105284837 13:18995375-18995397 GCAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284908 13:18995804-18995826 ACAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284955 13:18996079-18996101 AAAGAAGACCAGAGGACAGAAGG + Intergenic
1105284975 13:18996189-18996211 CTAGAAGGCCAGAAGGCAGAGGG + Intergenic
1105284979 13:18996204-18996226 GCAGAGGGCCAGAGGGCAAAAGG + Intergenic
1105284985 13:18996254-18996276 GCAGAAGACTAGAAGGAAGAAGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1105285074 13:18996752-18996774 GCAGAAGGCCAGAGGCCAGAAGG + Intergenic
1105309321 13:19192260-19192282 TCAGAAAACATGAGGCCAGAAGG + Intergenic
1105528271 13:21195881-21195903 TCAGAAAACATGAGGCCAGAAGG - Intergenic
1105593927 13:21818234-21818256 TCAGGAGCCCACAGGGCAGGGGG - Intergenic
1106020036 13:25905715-25905737 TCAGAAGGCAAGAGGTCAGCTGG - Intronic
1106436703 13:29729660-29729682 GGAGAAGAACAGAGGCCAGAGGG - Intergenic
1106555076 13:30802629-30802651 TCAGAAGACCACAAGGCTGAAGG - Intergenic
1107753017 13:43589441-43589463 ACAGAAGACCAGATCTCAGATGG + Intronic
1107975432 13:45683861-45683883 TGGGAGGACCAGAGGACAGAAGG - Intergenic
1108694802 13:52893626-52893648 ACAGAAGCCCAGAGAGCTGATGG - Intergenic
1109170530 13:59091545-59091567 TCAGGAGACCAGTGTCCAGATGG + Intergenic
1109338657 13:61026097-61026119 ACAGAAGAACAGAGGTCTGATGG + Intergenic
1111292466 13:86186852-86186874 TCTGTAGACCTGAGGACAGATGG + Intergenic
1112719571 13:102227857-102227879 TCAGCAGACAAGACGCCAGATGG - Intronic
1113274642 13:108715141-108715163 TCAGCAGAGCAGAGCGCAGAGGG - Intronic
1113352402 13:109542323-109542345 GGAGAAGGCAAGAGGGCAGAAGG + Intergenic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1113875562 13:113592569-113592591 ACAGAAGACCAGGGTGCACAGGG - Intronic
1114731755 14:25000495-25000517 CCAGAAGACAGGAGGGCAGGAGG - Intronic
1115165530 14:30444819-30444841 ACAGAAGACCAGAGAGCAGAAGG + Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116868554 14:50050803-50050825 TCAGAAGAGTAGAGGCCAGCTGG - Intergenic
1117289739 14:54320861-54320883 GCAGGAGACCAGAGGGCAAGAGG + Intergenic
1118686968 14:68300885-68300907 AGAGAAGACAAGAGGGCAGCTGG + Intronic
1119199557 14:72742511-72742533 TCTGAAGAGCACACGGCAGAGGG + Intronic
1121029423 14:90645518-90645540 TCAGAACACCAGAGCTCCGAGGG - Intronic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1121564160 14:94896143-94896165 TTGGAAGACTAGAGGGCAGAAGG + Intergenic
1121660672 14:95632773-95632795 GCTGTAGAGCAGAGGGCAGAAGG + Intergenic
1121738400 14:96234647-96234669 CCCGAAGTCCAGAGGGCAGGCGG - Intronic
1121803773 14:96797146-96797168 CTAGAAGACCAGGGAGCAGAAGG + Intergenic
1121862484 14:97331381-97331403 TCAGAAGATCAGATTGCAGAAGG - Intergenic
1122152374 14:99731994-99732016 TCTCAGGGCCAGAGGGCAGAGGG + Intergenic
1122573443 14:102724907-102724929 ACATAAAACCTGAGGGCAGAAGG - Intronic
1124890387 15:33726676-33726698 TGAGAAGACAAGAGAGCAGCTGG - Intronic
1125126382 15:36227053-36227075 TCGGGATACCAGAGGGCAGAGGG + Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126758152 15:51944265-51944287 TCAGAACAATGGAGGGCAGAAGG + Intronic
1127318277 15:57817790-57817812 TCAGAGGCCCAGAAGGAAGAGGG - Intergenic
1127766815 15:62194331-62194353 TCTGAAGACTAGAAGGCACAGGG - Intergenic
1128343119 15:66836520-66836542 ACTGAAGCCCAGAGGGGAGATGG + Intergenic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128558785 15:68650911-68650933 TCATCTGACCAGAGGGCAGCAGG - Intronic
1129106069 15:73308124-73308146 TCAGAAGTCCAGGGGGCAAAGGG + Intergenic
1129121124 15:73397400-73397422 TCACAAGAGCAGAGTGGAGAGGG + Intergenic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1130843447 15:87723239-87723261 CCAGAAGCCCTGAGGGCTGATGG - Intergenic
1131075139 15:89490772-89490794 TCAGATGACCAGGGGGGTGAGGG + Intronic
1131232179 15:90667250-90667272 TCACACAACCACAGGGCAGAGGG - Intergenic
1131943466 15:97593102-97593124 TCAGAAGAACAGCTCGCAGAGGG - Intergenic
1132177635 15:99728019-99728041 TCAGAACACCTGAGGGAGGAAGG - Exonic
1132925134 16:2425337-2425359 TCAGAAGGCCAGAGGCCTGGTGG - Intergenic
1133072609 16:3256482-3256504 GCAGAACACCAGTGTGCAGAAGG - Exonic
1133542092 16:6765970-6765992 TCAGAAGATGGGAGGGTAGAAGG + Intronic
1133981370 16:10635520-10635542 TGAGAAGACCACAGTGCACAGGG + Intronic
1134227726 16:12404338-12404360 TCAGAAAATCAGAGAGGAGACGG - Intronic
1134670217 16:16049115-16049137 TCAGAGGACAACAGGGCAGTGGG - Intronic
1134812196 16:17177197-17177219 TCAGGAAACCACTGGGCAGAGGG + Intronic
1135118072 16:19740475-19740497 GCAGCAGAACAGAAGGCAGAGGG - Intronic
1135349143 16:21714008-21714030 TCAGAAGGCAAGAGGTCAAAAGG + Intronic
1135918134 16:26624404-26624426 CCAGAAAACCAGAGGGGAGGAGG + Intergenic
1136598752 16:31269860-31269882 ACAGAAGACTAGAGGGAGGAGGG - Intronic
1137436188 16:48455845-48455867 TCTGAAGACCAGAGCACAGTTGG + Intergenic
1137567466 16:49542547-49542569 CCAGAAGGCCAGAGGCCAGGAGG + Intronic
1138531009 16:57634368-57634390 GCAGAGGAGCAGTGGGCAGAGGG - Intronic
1138592517 16:58009847-58009869 GAAGAAGCCCAGAAGGCAGAGGG - Intronic
1139663144 16:68435781-68435803 TCAGAAGACCACTGGTGAGAAGG + Intronic
1139811000 16:69616864-69616886 TCAGAAGCCTAGAGGGGAGGGGG - Intronic
1140481366 16:75264679-75264701 GCAGATGACCAGAGGGAAGCTGG - Intronic
1140888345 16:79263903-79263925 TCAGGAGACCAGAGGGATTAAGG - Intergenic
1141526815 16:84617314-84617336 TCGGATGTCCAGAGGGGAGAAGG + Intronic
1142023767 16:87801344-87801366 TCGGAAGACCAGGGAGGAGATGG - Intergenic
1142125228 16:88406859-88406881 TCAGGAGACCTGGGGGCCGACGG - Intergenic
1142427594 16:90008916-90008938 TCAGAGGCTCTGAGGGCAGAGGG + Exonic
1142715632 17:1745494-1745516 TCTGGAGTCCAGAGGCCAGAAGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143682002 17:8482504-8482526 ACAAAACACCAGAGGCCAGATGG - Intronic
1144320488 17:14113282-14113304 ACACAAGAACAGAGGACAGAAGG - Intronic
1144352251 17:14408363-14408385 TGGGAAGGCCAGAGGGCAAAGGG + Intergenic
1144385877 17:14748725-14748747 TCAGAAAACAAGAGGGCTGCTGG - Intergenic
1144401964 17:14913455-14913477 TCAGAAAACCATAGGGAAAATGG + Intergenic
1144483848 17:15648886-15648908 TAAGCAGACCAGAAAGCAGAGGG + Intronic
1144879752 17:18425240-18425262 CTAGAAGACCAGAGGGGAGGAGG + Intergenic
1146584561 17:34071054-34071076 TCAGAAGTCCAGAAGTCAGTAGG + Intronic
1146584605 17:34071380-34071402 TCAGAAGAGAACAGTGCAGATGG - Intronic
1148246450 17:46034089-46034111 TCAGAAGAGAAGAGGGAAAAAGG + Intronic
1148336966 17:46848445-46848467 TCAGGAGCCCACAGGGCAGAGGG + Intronic
1148611622 17:48968468-48968490 TGAGATGACCCGAGAGCAGATGG - Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1149124428 17:53210540-53210562 TCACATGACAAGAGGGCAAAAGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150712337 17:67542598-67542620 TCATAAGTCCACAGGGCAGTGGG + Intronic
1151994499 17:77600229-77600251 TCAGAAGACAGGAGGAAAGATGG - Intergenic
1152694932 17:81739250-81739272 TCCGAAAGCCAGAGTGCAGACGG - Intergenic
1153603912 18:6811580-6811602 TCAGAAGTGCAGAGGGCTGTGGG + Intronic
1154437044 18:14353377-14353399 TAAGAAGACCAAAGTCCAGAAGG + Intergenic
1155368363 18:25071961-25071983 GCTGAGAACCAGAGGGCAGAAGG + Intronic
1156538694 18:37888711-37888733 TCAGAGGACAAGAGGGCAAAGGG + Intergenic
1158401597 18:57126488-57126510 TCAGATGGCCTGAAGGCAGAAGG - Intergenic
1158897349 18:61927512-61927534 CCAGAAGACCCCAGGGCAGATGG - Intergenic
1159670458 18:71214834-71214856 TCAGAAGAATAGATGGTAGATGG + Intergenic
1160003206 18:75047407-75047429 GCAGAAGGGCAGAAGGCAGAGGG - Intronic
1160053708 18:75460185-75460207 TCAGAAGACAGGATTGCAGATGG + Intergenic
1160351547 18:78185960-78185982 TCAGAAAACTAGAGTGTAGAAGG + Intergenic
1160374095 18:78397908-78397930 CCTGAAGAAGAGAGGGCAGAAGG + Intergenic
1160622368 18:80180225-80180247 TCAGCAGCCCAGGTGGCAGAGGG + Intronic
1160755734 19:756218-756240 TAACAAGACCAGCGGGAAGAGGG + Intronic
1161592185 19:5133860-5133882 CTAGAAGAACAGAGGGGAGAGGG - Intronic
1162736037 19:12747672-12747694 GCAGGAGGCTAGAGGGCAGAGGG - Intronic
1163246067 19:16095211-16095233 TCAGAAGTACAGGGGACAGAAGG - Intronic
1163389806 19:17023486-17023508 TCAGAAGAAAAGAGGGTAAAGGG + Intronic
1163763024 19:19147206-19147228 TCAGAGGACCCCAGGCCAGATGG + Intronic
1164549127 19:29193570-29193592 TAAGAAAACCAGGAGGCAGAGGG - Intergenic
1164675398 19:30097192-30097214 CCAGCAGGCCAGTGGGCAGATGG - Intergenic
1164974841 19:32564703-32564725 ACAGAAGAGCTAAGGGCAGAAGG - Intergenic
1165162235 19:33823582-33823604 TCAGGAGACTGGAGGGCAGAAGG + Intergenic
1165795705 19:38517820-38517842 TCAAAAGACCAGGGGTCAGCTGG + Intronic
1166656730 19:44617845-44617867 GCAGAAGAGGAGAGGGCAGCGGG - Intronic
1166798190 19:45440423-45440445 TCAGGAGACCTGCGGGCTGAGGG + Intronic
1166811403 19:45516563-45516585 TTAGCAGAGCAGAGGGCAGGAGG - Intronic
1167694862 19:51009405-51009427 TGAGAAGCCTAGAGGGCAGGAGG + Intronic
925127879 2:1474562-1474584 TCAGAAATCCAGAGGTCAGATGG - Intronic
925350648 2:3198788-3198810 ACAGAAGATCACAAGGCAGAAGG + Intronic
925557494 2:5147679-5147701 TCAGAAAACCAGAAACCAGAGGG + Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
926333988 2:11849610-11849632 ACAGAAGCCCAGAGAGGAGAAGG - Intergenic
927489816 2:23513688-23513710 TCAGAGGACAGGAGGGCAGAGGG + Intronic
928419905 2:31130369-31130391 TCTACAGAGCAGAGGGCAGAGGG + Intronic
928495064 2:31823095-31823117 TCAGAAGAACAGAGAGGAGCTGG - Intergenic
928653257 2:33423712-33423734 TGAGAAGAGGAGAGGGCATACGG - Intergenic
929220715 2:39462323-39462345 CCAGAAGAACAGGGAGCAGAAGG + Intergenic
929899653 2:45989506-45989528 TCAGAAGGGAAGAGGGCAGTTGG - Intronic
929913632 2:46115235-46115257 GCAGAAGACCAGATGGCAAGAGG - Intronic
930173906 2:48281743-48281765 TCAGAAGATCCAAGGCCAGATGG + Intergenic
931418353 2:62102582-62102604 ACAGGAGAGCAGGGGGCAGAAGG - Intronic
931878807 2:66544173-66544195 TCACTAGACCTGTGGGCAGAAGG + Intronic
932715838 2:74100362-74100384 ACAGAAGGCAAGATGGCAGAGGG - Intronic
933585773 2:84178083-84178105 TCAGAAGGCGAGACGGCAGGGGG - Intergenic
933920316 2:87039344-87039366 TCCCAACACCAGAGGGCAAAGGG - Intergenic
933931308 2:87154442-87154464 TCCCAACACCAGAGGGCAAAGGG + Intergenic
934002681 2:87730555-87730577 TCCCAACACCAGAGGGCAAAGGG + Intergenic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
934561452 2:95315591-95315613 TCTGAAGAAGAGAGGGCCGAAGG - Intronic
934901769 2:98165526-98165548 ACAGAGGTGCAGAGGGCAGAGGG + Intronic
935840219 2:107101138-107101160 ATAGAAGATCAGAAGGCAGATGG + Intergenic
936027527 2:109045051-109045073 TCAGAAGATCTGAGGGCAGAGGG + Intergenic
936092524 2:109510573-109510595 TCTGCAGCCCAGAGGGCTGATGG + Intergenic
936361812 2:111810989-111811011 TCCCAACACCAGAGGGCAAAGGG - Intronic
937683493 2:124669615-124669637 TCATAAGACCAGTAGGCAGGTGG - Intronic
937993976 2:127679540-127679562 CCTGAACCCCAGAGGGCAGAAGG - Intronic
938115886 2:128602738-128602760 TCAGAAGACAAGGCGGCAGGTGG + Intergenic
938265965 2:129928451-129928473 TCAGAAAATCACAGGGCAGGGGG - Intergenic
939281249 2:140068063-140068085 TCAGGAGACAACAGGGCAGGTGG - Intergenic
939475363 2:142679960-142679982 TCAGAAGCACAGAGTGAAGAAGG + Intergenic
940841905 2:158593504-158593526 TCAGAAGACCATATGGGAAAGGG - Intronic
942204962 2:173610944-173610966 GCAGAAGAAGAGAGGGCAGCTGG - Intergenic
942901220 2:181121585-181121607 TCAGAGGACCAGAAGGAAGCTGG + Intergenic
943188694 2:184648038-184648060 TCAGCAGAACAAAGGCCAGATGG + Intronic
944325789 2:198401963-198401985 ACAGTGGAACAGAGGGCAGAAGG - Intronic
944770691 2:202911624-202911646 AGAGGAGACCGGAGGGCAGAAGG - Exonic
945014528 2:205501236-205501258 TCAGAAGTGCACAGTGCAGATGG + Intronic
945225361 2:207528125-207528147 ACATAAGACCAGAGGGAAGAGGG + Intergenic
945781899 2:214185776-214185798 TGTGGAGACCAGAGAGCAGAGGG + Intronic
945932644 2:215871013-215871035 AGAGAAAGCCAGAGGGCAGAGGG - Intergenic
946112934 2:217436224-217436246 TCTGAAGACCAGAGCGGAAAGGG + Intronic
946118257 2:217483269-217483291 ACAGAAGATCACAGGGCATATGG - Intronic
946226391 2:218266160-218266182 ACAGATGAAGAGAGGGCAGAGGG + Intronic
946538460 2:220657716-220657738 CCAGCAGACCAGCGGACAGAAGG - Intergenic
947046245 2:225989964-225989986 TCAGGAGATCAGAGGGTAGCAGG - Intergenic
947073240 2:226314910-226314932 TCAGCAGAGAAGAGGGAAGAAGG + Intergenic
947670653 2:231933600-231933622 GCAGCAGAGCAGTGGGCAGACGG + Intergenic
948872341 2:240809295-240809317 AAAAAAGACCAGAGGGCAGAGGG + Intronic
1169298102 20:4417317-4417339 ACAGATGCACAGAGGGCAGATGG + Intergenic
1169551529 20:6706446-6706468 GGAGATGACCAAAGGGCAGAAGG + Intergenic
1170306934 20:14948582-14948604 GCAAAAGACCAGAAGACAGATGG - Intronic
1170907412 20:20528551-20528573 TCAGAAGACGAGGTGGGAGAAGG + Intronic
1171091784 20:22292326-22292348 ACAGAAAATCAGAGGCCAGAAGG - Intergenic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1171998579 20:31753216-31753238 TCACAAGGTAAGAGGGCAGAAGG + Intronic
1172173465 20:32958672-32958694 TCAGAAGGCCAGAGGCTTGAGGG + Intronic
1173562132 20:44013457-44013479 TCAGAAGACCAGAGGACCAAGGG - Intronic
1173638965 20:44585776-44585798 GCAGGAGACTAGAGGGCACAGGG - Intronic
1173705578 20:45108066-45108088 ACAGAAGCCCAGAGTGCAGAAGG + Intergenic
1173926242 20:46783513-46783535 GCAGAAGACCAGAAGACAGGTGG - Intergenic
1174265085 20:49325501-49325523 TGAGAGGAGCAGAGGGCAGGAGG - Intergenic
1174349611 20:49957522-49957544 TCAGAAGAACAGAGAGGAGCTGG + Intergenic
1175766843 20:61598176-61598198 TCAGCAGATCAGAGGGCAGTGGG - Intronic
1176739383 21:10585954-10585976 TCAGAAGAAAAAAGGGGAGAAGG - Intronic
1176839994 21:13832265-13832287 TAAGAAGACCAAAGTCCAGAAGG - Intergenic
1178286449 21:31329241-31329263 TAAGGAGACAATAGGGCAGAAGG - Intronic
1178471922 21:32901520-32901542 GCAGAATACTAGAGGGGAGAGGG + Intergenic
1179099773 21:38346422-38346444 TCAGGGGAGCAGAGAGCAGAAGG + Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179229551 21:39489170-39489192 ACAAAAGACCAGATGGAAGAGGG + Intronic
1179393768 21:41018449-41018471 GCAGAATACCAGAGGGAAGGAGG + Intergenic
1179511135 21:41874548-41874570 ACAAAAGGCCAGAGGCCAGAGGG + Intronic
1179938746 21:44624286-44624308 TCAAAAAACCAGAGGACAAATGG - Intronic
1179959778 21:44761749-44761771 TCTGAAGAACAGAGAGCAAAGGG + Intergenic
1180928580 22:19573512-19573534 GCAGAAGGGCAGAAGGCAGAAGG + Intergenic
1181403491 22:22665879-22665901 TCAGGAGAACAGAGAGCAGTGGG - Intergenic
1181405805 22:22684309-22684331 TCAGGAGAACAGAGAGCAGTGGG - Intergenic
1181413820 22:22745362-22745384 TCAGGAGAACAGAGAGCAGTGGG - Intronic
1181608408 22:23995036-23995058 TTAGAAGCCCAGAGCCCAGAGGG - Intergenic
1181615296 22:24050069-24050091 AAGGAAGACCAGAGGGCAAAAGG - Intronic
1181688490 22:24545056-24545078 CCAGAGGGACAGAGGGCAGATGG + Intronic
1182385671 22:29938614-29938636 TCTGAATACCAGTGGGCTGAGGG - Intronic
1182450901 22:30420403-30420425 TCAGAGAACCACAGGCCAGAGGG - Intronic
1183165369 22:36143586-36143608 TCAGAAGATCAAAGGGCATGTGG - Intronic
1183710754 22:39502067-39502089 GCAGAAGTTCAGAGGGCAGGAGG - Intronic
1183960665 22:41410183-41410205 TCTGAAGCCCAGATGGCAGGAGG - Intergenic
1184298159 22:43539273-43539295 TAAGTAGAGCAGAGGGAAGAGGG - Intronic
1184315795 22:43688108-43688130 TCAAAAGACATGAGGACAGAAGG + Intronic
1184355354 22:43975875-43975897 AGAGAAAACCAGAGGGAAGAAGG - Intronic
1184366060 22:44052146-44052168 TTAGAAGATCAAAGGCCAGATGG - Intronic
1184416867 22:44357137-44357159 TCAGAACAGCGGAGGGCACAGGG - Intergenic
1184467414 22:44677013-44677035 TCACATGGCCAAAGGGCAGAGGG - Intronic
1185159527 22:49214843-49214865 TCAGAAGCCCAAAGTGCGGAGGG - Intergenic
1185418664 22:50723117-50723139 GGAGAAGGCAAGAGGGCAGATGG - Intergenic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
950080315 3:10217121-10217143 ACAGAAGTTCAGAGGGGAGAGGG + Intronic
950566058 3:13770400-13770422 TATGCAGACCAGAGGGGAGAAGG + Intergenic
950829398 3:15859537-15859559 TGAGAAGACCTGCGGGCAGGGGG + Exonic
951663345 3:25095051-25095073 TCACTGGACCAGAGGCCAGAAGG - Intergenic
951948688 3:28173226-28173248 GCAGAAAATCAGAGGGCAGGAGG - Intergenic
952196878 3:31085173-31085195 TCAAAAGATCAGAGGAAAGAGGG + Intergenic
952746621 3:36787799-36787821 TGAGTAGGGCAGAGGGCAGAGGG - Intergenic
953085571 3:39663255-39663277 TCAGAAGGCAGCAGGGCAGAGGG + Intergenic
953847329 3:46438225-46438247 TGAGAAAACCATGGGGCAGAAGG + Intronic
953851716 3:46469995-46470017 GGAGAGGGCCAGAGGGCAGAGGG - Intronic
954277352 3:49551294-49551316 GTAGAAGACCAGAGGGAAAATGG - Intergenic
955671482 3:61407619-61407641 TCTGATGACCCAAGGGCAGAAGG - Intergenic
956085600 3:65606195-65606217 TCACAAAGCCAGAGGACAGAAGG + Intronic
957002690 3:74904902-74904924 TATGAGGACCAGAGGGCAAAGGG + Intergenic
957168728 3:76709914-76709936 TCAGAAGAGCTGTTGGCAGAAGG - Intronic
957284548 3:78201564-78201586 TCATAGAAACAGAGGGCAGAAGG + Intergenic
958652851 3:96960457-96960479 TAAGAATAGCAGAGGCCAGATGG - Intronic
958856318 3:99390509-99390531 TCTGAAGACCAGAAGGAAGCAGG - Intergenic
960674417 3:120180822-120180844 GCAGCAGACCAGAGGGTGGATGG + Intronic
960683749 3:120275969-120275991 GCAGAAGATCAGAGTGAAGAGGG - Intronic
960928794 3:122823123-122823145 GCATAAGACTAGAGGGTAGAGGG - Intronic
961346693 3:126267882-126267904 TTAGAAGACCTGAGAGCAGGCGG - Intergenic
961578075 3:127854869-127854891 TTAGAAGATAAAAGGGCAGAAGG + Intergenic
961623474 3:128243148-128243170 TAAGGAGCCCAGAGGTCAGAGGG - Intronic
963320860 3:143807787-143807809 TCAGAAACCCAAAGGCCAGAGGG + Intronic
964557722 3:157958670-157958692 TTAGAAGACCTCAGCGCAGAGGG - Intergenic
965638843 3:170812109-170812131 TCAGAAGAGGAGAGGGGAGGAGG - Intronic
966532088 3:180992464-180992486 TCAGGAGATCAGAAGGCAGGAGG + Intergenic
966885140 3:184373338-184373360 CTAGAAGACCTGAGGGAAGAAGG - Intronic
967111870 3:186301084-186301106 GCAGAAGAACAGTGGACAGAAGG - Intronic
967763888 3:193256294-193256316 TGAGAAGTGCTGAGGGCAGAAGG + Intronic
967973416 3:195015932-195015954 TCATAAGACCGCAGGGCAGATGG + Intergenic
968377092 4:52883-52905 TCAAAAGACTAGCGGCCAGAAGG + Intergenic
969079367 4:4606579-4606601 TGAGAAGCACAGAGGGAAGAAGG - Intergenic
970712596 4:18880841-18880863 TCAGAAAATAAGTGGGCAGAGGG - Intergenic
973896804 4:55421798-55421820 TCAGAATACAGGAGGGCAGAGGG - Intronic
974713820 4:65639682-65639704 TCAGAAGAAGAGAGGCCAAATGG - Intronic
975819496 4:78255130-78255152 TCAGAAGCCCAGTGCACAGAAGG - Intronic
976005232 4:80422052-80422074 TCAGCAGACCTAAGGGCTGATGG + Intronic
976277556 4:83292853-83292875 TCAGAAGGGAAGAGGGCGGAAGG + Exonic
976315286 4:83653423-83653445 CCAGAAGAGCAGATGGCACAGGG - Intergenic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
980577231 4:134699100-134699122 ACAGAAGATCACAAGGCAGAAGG - Intergenic
982274265 4:153623171-153623193 TCAGGAGTGCAGAGGACAGATGG + Intronic
982720838 4:158858074-158858096 GTTGAAGACCAGGGGGCAGAAGG + Intronic
984706001 4:182847698-182847720 CCAGAAGGGCAGAGAGCAGAGGG + Intergenic
985396078 4:189545670-189545692 TCAGAAGACCACAGAAGAGAGGG - Intergenic
985846551 5:2353935-2353957 TCAGAGCACCACAGTGCAGAGGG - Intergenic
986075312 5:4330827-4330849 GGAGTAGAGCAGAGGGCAGAGGG + Intergenic
986264646 5:6181377-6181399 TCAGGAGGCCACAGGGCATATGG + Intergenic
986623583 5:9702727-9702749 CCAGAAGACATAAGGGCAGAAGG + Intronic
990785077 5:59409612-59409634 TCAGAAGACAAAAGGGGAGTAGG - Intronic
991075407 5:62531028-62531050 GCAGACTACTAGAGGGCAGAGGG - Intronic
992368379 5:76116465-76116487 TGGGAAGAGCAGAAGGCAGAGGG - Intronic
992447950 5:76850726-76850748 ACAGAAGAAGAGAGGGAAGAGGG + Intronic
992623449 5:78616042-78616064 GGAGAAGAACAGAGGGCAGAAGG - Intronic
992643239 5:78788031-78788053 ACAGAAGCCAAGAGAGCAGAGGG + Intronic
992904993 5:81337233-81337255 TCAGAGGAGCTGAGGGCAGGTGG + Intronic
995180974 5:109229865-109229887 TGAGAAGAGCAGGAGGCAGAGGG + Intergenic
995487484 5:112653757-112653779 TCAGCAGTCCACAGGGCAGATGG + Intergenic
996034275 5:118740452-118740474 TCAGATGAACAGAGGAGAGAAGG - Intergenic
997113698 5:131102779-131102801 TCAGAAGAGATGAGGGAAGAAGG + Intergenic
997578048 5:134997795-134997817 TGAGATGCCCAGAGGGCAGCTGG - Intronic
997697671 5:135874244-135874266 TCAGGAGACCAGGGGGCTGCTGG + Intronic
997738034 5:136228819-136228841 ACAGAAGTCCAGAGCCCAGAGGG + Intronic
998140983 5:139699300-139699322 TGAGAAGACCAAAGGCTAGAGGG + Intergenic
998182507 5:139955353-139955375 GCAGAGGCCCAGAGGGGAGAGGG + Intronic
998865689 5:146498665-146498687 TTCGAAGACCAGAGGTGAGAAGG + Exonic
999081879 5:148852251-148852273 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999082092 5:148854331-148854353 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999093402 5:148957121-148957143 GCAGAAGGCCACAGGGGAGACGG + Intronic
999438533 5:151582914-151582936 ACAGAAGAGCAGACGGGAGAGGG + Intergenic
999872107 5:155763308-155763330 ACAGAAGGTGAGAGGGCAGAGGG + Intergenic
1000010528 5:157227220-157227242 TCAGAGGTCCAGAGAGTAGAAGG + Intronic
1001133347 5:169081886-169081908 TGAGAAGACCAAAGCACAGAGGG + Intronic
1002306530 5:178286912-178286934 TCACAGGTCCAGAGGGGAGAGGG - Intronic
1002401492 5:178993838-178993860 GCAGGAGACCAGAGCTCAGAAGG + Intronic
1002461150 5:179374491-179374513 TCAGAGGACGTCAGGGCAGAGGG + Intergenic
1005811194 6:29517741-29517763 TAGGAAGGGCAGAGGGCAGAGGG - Intergenic
1006713547 6:36097519-36097541 TAAGAGGACCTAAGGGCAGAGGG + Intronic
1006904371 6:37523153-37523175 TCTGAAGACCCCAGGGCAGTGGG + Intergenic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007597495 6:43060387-43060409 TTTGAAGACCTGTGGGCAGAGGG + Intronic
1009560114 6:65229588-65229610 AGAGAAGACAAGAGTGCAGATGG + Intronic
1010682230 6:78810249-78810271 TCAGTAGATCAGTGTGCAGATGG - Intergenic
1012439910 6:99253316-99253338 TCTGTAGACCTGAGGACAGATGG + Intergenic
1012678878 6:102153746-102153768 TGAGAAGAAAAGAGGGAAGAGGG + Intergenic
1012779245 6:103535886-103535908 TCAGAAAAACAGAGGGAAGAGGG - Intergenic
1013179797 6:107708183-107708205 TCAGCAGCCCAGAGTGCAGAAGG + Intronic
1014583576 6:123168817-123168839 TCAGTAGAACACAGGGCACAGGG - Intergenic
1014775990 6:125510588-125510610 TCAAAATAGCAGAGGACAGATGG + Intergenic
1015533241 6:134241951-134241973 TCACAAGATGGGAGGGCAGAGGG + Intronic
1016369599 6:143358740-143358762 TCATATGACAAGAAGGCAGAGGG + Intergenic
1016534177 6:145092132-145092154 TCAGAAGCCAAGAGGTAAGAAGG + Intergenic
1018022920 6:159778899-159778921 TCAGAGGACCAAAGTACAGATGG + Exonic
1018775715 6:167013534-167013556 GAAGAAGACAAGCGGGCAGAAGG + Exonic
1018849761 6:167578492-167578514 TTAGAAGTCCAGAGGTCTGAGGG + Intergenic
1019140884 6:169941413-169941435 TCAGAAGAACAGGGAGAAGATGG + Intergenic
1019737473 7:2657856-2657878 ACAGAAAGCCAGAGGGCAGCAGG + Intronic
1022468886 7:30669615-30669637 CAAGAAGACTAGAGAGCAGATGG - Intronic
1022953751 7:35362984-35363006 ACAGAAGACAAAAGGGCAGCAGG - Intergenic
1023959088 7:44912069-44912091 TCACAAGGCCAGGAGGCAGATGG + Intergenic
1023974838 7:45021068-45021090 TCAGAAGGGCAGAGGTCAGGTGG + Intronic
1026329748 7:69341464-69341486 TCAGATGCACAGAGGGCAGGTGG + Intergenic
1026877268 7:73886846-73886868 TCCGGAGACCAGAGGGCACCTGG + Intergenic
1027710493 7:81594990-81595012 TTAGAAGAAAGGAGGGCAGAGGG - Intergenic
1028522219 7:91744030-91744052 TGAGAACAACATAGGGCAGAGGG + Intronic
1028675048 7:93449957-93449979 TCTGAAGACCATAGCGCAAAGGG - Intronic
1028990584 7:97044992-97045014 TCAGCAGACCTGAGTGCAAAAGG + Intergenic
1029236530 7:99124346-99124368 TAAAAAGGCCAAAGGGCAGAAGG + Intronic
1029592770 7:101518303-101518325 TCTGAACCCCAGAGGGCTGAGGG - Intronic
1029602779 7:101579111-101579133 TCAGAAGAGAAGAGAGCAAATGG - Intergenic
1029605890 7:101599205-101599227 TCACATGCCAAGAGGGCAGAGGG - Intergenic
1030170631 7:106599266-106599288 GCAGAAAACCAGAGAGCAAAAGG + Intergenic
1032167542 7:129557369-129557391 TCTGAAGACTAGAAGGCAAAAGG - Intergenic
1033233027 7:139616463-139616485 TCAGAAGAGTGGAGAGCAGAGGG - Intronic
1033534292 7:142298093-142298115 TCAGGAGGACTGAGGGCAGATGG + Intergenic
1035305573 7:157929272-157929294 TCAGAGGAGCAGAGAGCGGATGG - Intronic
1035947602 8:3982692-3982714 TCATAAGATCAGGAGGCAGAGGG + Intronic
1036406872 8:8462874-8462896 TCTTAAGTCCAGAGGGCAGAAGG + Intergenic
1036738219 8:11338472-11338494 TCAGAATAGCAGAGGACAGATGG + Intergenic
1036760169 8:11503260-11503282 TCAGAAGCCCAGGGGCTAGAAGG - Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037794285 8:21978841-21978863 GCAGGAGATTAGAGGGCAGAGGG - Intronic
1038562230 8:28590361-28590383 TCAGAAGCACAGGGGGCAGTGGG - Intergenic
1039391205 8:37182110-37182132 ACTGAAGACCAGAGGACAGAAGG - Intergenic
1039486353 8:37913123-37913145 TCAGAGGACCTGTGGACAGAAGG + Intergenic
1039497736 8:37993696-37993718 TTAGAACACAAAAGGGCAGAGGG + Intergenic
1040542566 8:48373045-48373067 TCAGAAGACTATGGGGCAGAGGG + Intergenic
1041712704 8:60908752-60908774 TTAGAAAAGCAGAGGACAGAGGG - Intergenic
1041732950 8:61081239-61081261 TCTGAAGAAGAGAGAGCAGAAGG + Intronic
1041807257 8:61865543-61865565 GCTGAAGACCAGAAGGGAGAAGG + Intergenic
1041939107 8:63367180-63367202 GAAGAAGACAAGAGGGCAGGTGG + Intergenic
1042074675 8:64978864-64978886 TGACAAGACCTAAGGGCAGAGGG - Intergenic
1043355618 8:79408850-79408872 TCAGAAGGGGAGAGGGCAGAGGG - Intergenic
1044130446 8:88517216-88517238 TCAGAAGAAAATAGGGGAGAGGG - Intergenic
1045349169 8:101322588-101322610 ACAGATGACCAGGGAGCAGATGG + Intergenic
1046577333 8:116047261-116047283 TAAGAGGACCAGAGAGTAGAGGG + Intergenic
1046687273 8:117241653-117241675 TCAGAAGAGCAGAGAACAAAGGG + Intergenic
1046783107 8:118236912-118236934 TGAGAAGACCAAAGGGCAGAAGG + Intronic
1047523661 8:125614936-125614958 GCAGGAGACCAAAGGGCAAAGGG + Intergenic
1048289392 8:133168922-133168944 TGAGAAGACACGAGAGCAGAGGG + Intergenic
1048375088 8:133816284-133816306 AAAGAAGCCCACAGGGCAGAAGG - Intergenic
1048831958 8:138486296-138486318 TCAGAGGATCAGAGGGTAGTAGG + Intronic
1049660081 8:143815930-143815952 GCTGAAGACCGGAGGGCGGAGGG - Intergenic
1052391366 9:27882111-27882133 TCTCAATACCAGAGGGCTGATGG - Intergenic
1052915511 9:33922191-33922213 GAAGAAGACCTGAAGGCAGATGG + Exonic
1052975351 9:34406045-34406067 ACAGAAGCCCAGAGGGCAGGTGG - Intronic
1053025253 9:34723983-34724005 GCTGAAGACCAGAGGCCAGCAGG - Exonic
1053036782 9:34833045-34833067 GCTGAAGACCAGAGGCCAGCAGG - Intergenic
1053238839 9:36479515-36479537 CCAGAAGACCAGGGAGCAGAAGG + Intronic
1053377226 9:37617883-37617905 TCTAAAGACCAGAGGGCTGCTGG - Intronic
1053900866 9:42794300-42794322 TCAGCAGACTAGAGGGCAGGAGG - Intergenic
1054704309 9:68447230-68447252 TCAGAAGGCCAGTGGTGAGATGG - Intronic
1056516102 9:87351878-87351900 GCAGAAGAGCAAAGGGCAGTAGG - Intergenic
1057176079 9:93000607-93000629 TTTGCAGACCAGAAGGCAGAGGG - Intronic
1057610679 9:96540772-96540794 TCAGGAGACCAAAGGGCAACAGG - Intronic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057882344 9:98802041-98802063 GCAGGAGATCAGAGGGCAGGAGG - Intergenic
1059335600 9:113566731-113566753 CCAGAAGGCCTGAGGGCAGCAGG - Intronic
1059795088 9:117685679-117685701 TCAGAAAACGAGAGGACAGGAGG - Intergenic
1060207864 9:121693209-121693231 TCTGAGGCCCAGAGGGCAGTGGG - Intronic
1060394339 9:123305094-123305116 GCAGAAGCACAGAGGGCAAAAGG + Intergenic
1060790631 9:126483226-126483248 TCAGAGGCTCGGAGGGCAGAGGG - Intronic
1060903114 9:127279101-127279123 TCAGAACACTAAAGGGCAAAAGG - Intronic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1061136875 9:128739817-128739839 ACAGAAGACCAGAAGGAAGGTGG + Intronic
1061194573 9:129100765-129100787 TCAGAAGAGCCCAGGGCAGGAGG - Intronic
1061715064 9:132513848-132513870 TGAGAAGATGGGAGGGCAGATGG - Intronic
1062058585 9:134482350-134482372 GCAGAAGATCAAAGGGAAGATGG + Intergenic
1062110395 9:134779063-134779085 TCTGACCACCAGAGGGCAGCCGG + Intronic
1062428515 9:136516918-136516940 TCAGAAGGCCGGGGTGCAGACGG + Intronic
1203572145 Un_KI270744v1:141363-141385 TCAAAAGACTAGCGGCCAGAAGG - Intergenic
1187358543 X:18602091-18602113 TCACAAGACAAGAGGAGAGAGGG - Intronic
1188540838 X:31248739-31248761 GCAGAAGCCTAGAGGGCAGGCGG + Intronic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1190152763 X:47961999-47962021 ACAAAAGATCACAGGGCAGAAGG + Intronic
1190444105 X:50505772-50505794 TCAGAGGCCCAAAGGGTAGAGGG + Intergenic
1191046442 X:56143078-56143100 GCAGAAGCCCAGAGTGCATAAGG - Intergenic
1192616859 X:72633993-72634015 TCAGATGACAGGAGAGCAGAAGG - Intronic
1197880954 X:131165882-131165904 CCAGAAGAACAGAGGTCAGATGG + Intergenic
1198266416 X:135013261-135013283 TGAGAGGACCAAATGGCAGATGG + Intergenic
1198597084 X:138248396-138248418 TCAGAAGACCATAATGCAGGAGG + Intergenic
1199519749 X:148722162-148722184 TCAGAAGGGCAGAGGAAAGAGGG + Intronic
1199661259 X:150053106-150053128 GCAGAAGACCAGAGGACATCTGG + Intergenic
1200259195 X:154603042-154603064 TGAGAAGAGCAGAGGGCAAAGGG - Intergenic
1201501637 Y:14649869-14649891 TCAGAAGACCACACAGCAGTAGG + Intronic
1201767810 Y:17589071-17589093 TCAGAAGCAGAGAAGGCAGATGG + Intergenic
1201833743 Y:18316914-18316936 TCAGAAGCAGAGAAGGCAGATGG - Intergenic