ID: 1105285071

View in Genome Browser
Species Human (GRCh38)
Location 13:18996737-18996759
Sequence CCACATGGCCAGAAAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105285061_1105285071 28 Left 1105285061 13:18996686-18996708 CCAGAAAGCTAGAAGGCAAGAAT 0: 1
1: 0
2: 4
3: 47
4: 343
Right 1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG 0: 1
1: 0
2: 4
3: 44
4: 408
1105285068_1105285071 -8 Left 1105285068 13:18996722-18996744 CCAGATGGCGGTAGGCCACATGG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG 0: 1
1: 0
2: 4
3: 44
4: 408
1105285067_1105285071 -3 Left 1105285067 13:18996717-18996739 CCAGGCCAGATGGCGGTAGGCCA 0: 1
1: 0
2: 1
3: 9
4: 78
Right 1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG 0: 1
1: 0
2: 4
3: 44
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105285071 Original CRISPR CCACATGGCCAGAAAGCAGA AGG Intergenic
900231473 1:1560989-1561011 CCACATGGCAAGTAGGCAGATGG + Intronic
901322705 1:8349258-8349280 TCACATGCCCAGAAAACAGTGGG + Intergenic
901889657 1:12251853-12251875 ACACATTGCCACAAACCAGATGG + Intronic
902819321 1:18933957-18933979 CCACAGAGACAGAAAGTAGAAGG - Intronic
904819230 1:33229830-33229852 CTAGATGGACAGAGAGCAGAGGG - Intergenic
904956036 1:34284701-34284723 CCACAGGGCCAGCCAGCACAGGG + Intergenic
905358090 1:37398884-37398906 CCACATGGCGAGAAGGCTGTGGG + Intergenic
905395106 1:37661712-37661734 CCACCTGGCCAGGAACCAGAGGG + Intergenic
905956678 1:42002802-42002824 CCACATGCTCATACAGCAGATGG + Intronic
906775916 1:48529577-48529599 CATCAGGGCCACAAAGCAGAGGG - Intergenic
907542878 1:55232693-55232715 CCACAGAGACAGACAGCAGAGGG - Intergenic
908020350 1:59892102-59892124 TCACATGGCAGAAAAGCAGAAGG - Intergenic
908392856 1:63699214-63699236 CCAAATGCCCAGAAAGCAGTAGG + Intergenic
908454866 1:64293801-64293823 TGACAGGGGCAGAAAGCAGAGGG + Intergenic
908628395 1:66073559-66073581 CCACATGCCAAGAAAGGAAAGGG - Intronic
910044031 1:82890131-82890153 CCTAATGGCCTGAAAGCAAATGG + Intergenic
910045842 1:82914718-82914740 GCCCAAGGCCAGAGAGCAGAAGG + Intergenic
910126041 1:83843571-83843593 CCACATGTGGAGAAATCAGATGG - Intergenic
911395598 1:97304354-97304376 CCACAATGTCAGAAAGAAGAAGG - Intronic
912632640 1:111259598-111259620 TTATATGGCAAGAAAGCAGAAGG + Intergenic
914343877 1:146781803-146781825 TCACATGGCCAGAAGGCGGTGGG + Intergenic
914915233 1:151815390-151815412 CCGCATGTCCAAGAAGCAGAGGG - Exonic
914990761 1:152497810-152497832 CCACATGGCTAGAAAGTAGCAGG - Intergenic
916575898 1:166066158-166066180 CCACAAGGCCAAAAAGGGGAAGG - Intronic
916818100 1:168372701-168372723 TCAGATGGACAGAAAGCAGGAGG + Intergenic
918481378 1:184980921-184980943 ACATATGGCCAGAAAGCCCATGG - Intergenic
919030820 1:192239783-192239805 CCACATGTCTGAAAAGCAGAAGG + Intergenic
919485032 1:198135123-198135145 TCACATGGCAGAAAAGCAGAAGG - Intergenic
919571428 1:199253763-199253785 ACAAATGGCCAGCAAGCATATGG - Intergenic
919923866 1:202182122-202182144 CCACATGGGCAGAGAGGAGTGGG - Intergenic
920106855 1:203559644-203559666 GCACATGCACAGAAAGCAGGCGG + Intergenic
920991524 1:210944411-210944433 TCCCCAGGCCAGAAAGCAGACGG + Intronic
922961790 1:229653474-229653496 CCATAAGGACAAAAAGCAGATGG - Intronic
923635830 1:235695315-235695337 CCACATAGCTAGTAAGCAGCAGG + Intronic
924607879 1:245550905-245550927 GCACATGGCCAGGCTGCAGAAGG - Intronic
924789560 1:247232423-247232445 ACAAATGGCCAAAAAGCACATGG + Intergenic
1062945098 10:1454633-1454655 CCACAGAGACAGGAAGCAGAGGG + Intronic
1063584911 10:7343658-7343680 ACACATGGCCAACAAGCATATGG - Intronic
1064453200 10:15462159-15462181 CCAAAAGGACAGAAATCAGAGGG - Intergenic
1066018224 10:31269700-31269722 CCCCTAGGCCAGAAAGCAGGTGG + Intergenic
1067143180 10:43673257-43673279 ATACAGGGCCAGAAGGCAGAGGG - Intergenic
1067545108 10:47187369-47187391 CCACATGGTGACAAAGCAAAGGG - Intergenic
1069273898 10:66565836-66565858 CCACATGGGCAGAAAACATTAGG + Intronic
1069297986 10:66871138-66871160 ACTCATTGGCAGAAAGCAGAGGG + Intronic
1069887652 10:71634149-71634171 GGGCCTGGCCAGAAAGCAGAGGG + Intronic
1069952190 10:72026741-72026763 CCACATGGACATAAATCACAAGG + Intergenic
1070509754 10:77149863-77149885 CCACATGACCACTAAGCAGATGG - Intronic
1070603329 10:77880900-77880922 CCACAAAGCTAGTAAGCAGAGGG + Intronic
1070742404 10:78911656-78911678 CCACAGGGACAGAAACCAGTGGG + Intergenic
1071054319 10:81491545-81491567 ACAAATGGCCAAAAAGCATATGG - Intergenic
1071611744 10:87038318-87038340 CCACATGCACAGACACCAGAAGG - Intergenic
1071928540 10:90439154-90439176 ACACAAAGCCAGAAAGAAGAAGG - Intergenic
1073427467 10:103464451-103464473 CCCCAAGGCCAGGAAGCAGGAGG - Intergenic
1074031102 10:109689219-109689241 CCAAATGGCCACCAAGCACACGG - Intergenic
1074917666 10:117972770-117972792 CCACAGAACCAGAGAGCAGAAGG - Intergenic
1075097126 10:119479662-119479684 CAACATGCCCATTAAGCAGATGG - Intergenic
1075552945 10:123406726-123406748 ACAAATGGCCAGTAAGCACATGG + Intergenic
1075797902 10:125134437-125134459 GCAGAGGGCCAGGAAGCAGAGGG - Intronic
1076502104 10:130945437-130945459 GCAGATGGCCAGGAAGAAGAAGG - Intergenic
1076642539 10:131928576-131928598 CCCAATGTCCAGAAAGCAGCGGG - Intronic
1076984914 11:228938-228960 ACAAATGGCCAAAAAGCACATGG + Intronic
1077167333 11:1149728-1149750 CCACACACACAGAAAGCAGATGG - Intergenic
1077928160 11:6703302-6703324 CAGCATGGTCAGAAAGAAGAAGG + Intergenic
1078062929 11:8060036-8060058 GCACATTGCCAGAAAACAGGAGG + Intronic
1078537547 11:12187089-12187111 CCACACGGGGAGAGAGCAGAGGG - Intronic
1078563990 11:12398047-12398069 CCAAATGGACTGGAAGCAGAGGG - Intronic
1078570393 11:12452914-12452936 CCAGTTGGTCTGAAAGCAGAAGG + Intronic
1078649109 11:13170761-13170783 CAACATGGCCAAAGAGCAGTGGG + Intergenic
1079108643 11:17590747-17590769 CAACATGGCTAGAATGGAGAGGG - Intronic
1080599179 11:33805983-33806005 GCACATGGGCAGCAAGGAGAAGG + Intergenic
1080747963 11:35126203-35126225 TCACACAGCCAGGAAGCAGATGG - Intergenic
1081317833 11:41651632-41651654 ACAAATGGCCAGCAAGCATATGG - Intergenic
1081618707 11:44605653-44605675 CCACACAGCTAGAAAGCAGGGGG - Intronic
1081771522 11:45653040-45653062 CCACAGGACCAGACAGCAAAGGG - Intronic
1081865165 11:46355708-46355730 CAACATGGTCAGAAAGTTGAGGG + Intronic
1082188355 11:49211119-49211141 GCAACTGGCCAGACAGCAGAGGG - Intergenic
1083046214 11:59737644-59737666 ACAAATGGCCAGCAAGCATATGG - Intronic
1083097664 11:60268115-60268137 CCACAGGGCTAAAAAGCAGCAGG - Intergenic
1083576154 11:63793290-63793312 CCACTGGCCCATAAAGCAGAAGG + Intergenic
1084158348 11:67328989-67329011 TCACATGGCAGAAAAGCAGAAGG + Intronic
1084331505 11:68433147-68433169 CCAGAGGGGCAGAAAGCAGGTGG - Intronic
1084939222 11:72603420-72603442 CTACATGCCCAGACAGCTGAGGG + Intronic
1086606151 11:88698948-88698970 CCATATAGCTAGAGAGCAGATGG - Intronic
1086678166 11:89635524-89635546 GCAACTGGCCAGACAGCAGAGGG + Intergenic
1090918184 11:131185561-131185583 CCACATGGCCAGCAGGGAGGCGG - Intergenic
1091346420 11:134857208-134857230 CAACCTGGCCAGAAAGCAGGAGG + Intergenic
1092494002 12:8973442-8973464 TCATATGGGCAGAAGGCAGAAGG - Intronic
1093619067 12:21265416-21265438 GCATAAGGCCAGAAAGTAGAAGG + Exonic
1094490806 12:30959458-30959480 CCACACAGCCAGTAAACAGAAGG + Intronic
1094763983 12:33570545-33570567 ACACATGGCCAAGAAGCATATGG + Intergenic
1095788270 12:46135140-46135162 TCACATGGCAGAAAAGCAGAAGG - Intergenic
1096146730 12:49283742-49283764 CCACATAGCCTGCAAGCAGAGGG + Intergenic
1096527744 12:52222266-52222288 CCACAAGAACAGCAAGCAGATGG - Intergenic
1096880208 12:54661373-54661395 CCACAGGCCCTGAAAGAAGACGG - Intergenic
1097152944 12:56993157-56993179 CCACAGGGACAGGAAGCAGAAGG + Intergenic
1097234044 12:57527909-57527931 CCAACTGGCCAGAGAGAAGAGGG - Exonic
1097344919 12:58480362-58480384 ACACATAGCCAGTAAACAGAAGG + Intergenic
1097426328 12:59449066-59449088 GCGCCTGGCCAGAAAGCATAAGG - Intergenic
1098110604 12:67117874-67117896 CCAAATGGGGAGAAAGAAGAGGG + Intergenic
1100129168 12:91469065-91469087 ACACATGGCCAAAAAGCATGTGG - Intergenic
1100764807 12:97851941-97851963 CTACATGGCAGGATAGCAGAGGG - Intergenic
1102160553 12:110765161-110765183 CCACAAAGTCACAAAGCAGAGGG + Intergenic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1105284481 13:18993252-18993274 ACAGAACGCCAGAAAGCAGAAGG + Intergenic
1105284498 13:18993339-18993361 CCAGAAGGCCAGAAAACAGAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284561 13:18993722-18993744 CCAGAAGGCCAGAAAGCAGAAGG + Intergenic
1105284584 13:18993867-18993889 CCAGAAGGCCAGAAAAGAGAGGG + Intergenic
1105284609 13:18994024-18994046 GCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284633 13:18994145-18994167 CCAGAAGGCAAGAAGGCAGAAGG + Intergenic
1105284639 13:18994173-18994195 CCAAAAGGCCAGAAGGCAGAAGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284765 13:18994947-18994969 CAAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284806 13:18995184-18995206 CCAGAAGGCCAGAAAACAGAAGG + Intergenic
1105284915 13:18995832-18995854 CCACAAGGTCAGAAGGCAAAAGG + Intergenic
1105284969 13:18996151-18996173 GCAAATGACAAGAAAGCAGAAGG + Intergenic
1105284975 13:18996189-18996211 CTAGAAGGCCAGAAGGCAGAGGG + Intergenic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105507035 13:21019072-21019094 CCACATAGGGAGAAAGCAGCTGG - Intronic
1106548970 13:30755150-30755172 CCAAAAGGCTAGAACGCAGAGGG + Intronic
1106548976 13:30755183-30755205 CCAAAAGGCTAGAACGCAGAGGG + Intronic
1106548982 13:30755216-30755238 CCAAAAGGCTAGAATGCAGAGGG + Intronic
1107438745 13:40404843-40404865 CAACATGGCCAGTAAGGAGGCGG - Intergenic
1110458915 13:75722416-75722438 ACAAATGGCCAAAAAGCATATGG + Intronic
1110718218 13:78731797-78731819 CCAGCTTGCCAGAAAGCAGGAGG - Intergenic
1110886277 13:80640264-80640286 ACACATGGCCAACAAGCATATGG + Intergenic
1112882013 13:104119965-104119987 GCACAAGGCCAGAGAGCTGAGGG - Intergenic
1113058597 13:106296914-106296936 CCACATGCACTGAAACCAGAGGG + Intergenic
1114751703 14:25211082-25211104 ACAAATGGCCAAAAAGCATATGG - Intergenic
1114802376 14:25792124-25792146 TCACAGGGCCAGACAGGAGAAGG - Intergenic
1114864455 14:26571593-26571615 CCACGTGGCTAGAACACAGAGGG + Intronic
1115915403 14:38307085-38307107 ACACATGGACACAAAGAAGAGGG + Intergenic
1116320043 14:43449801-43449823 ACACATGGCCAACAAGCATATGG + Intergenic
1117131772 14:52694811-52694833 ACACAGGACCAGAAACCAGAGGG + Intronic
1119144575 14:72299749-72299771 ACACATGGCCATCAAGCACATGG - Intronic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1119551284 14:75515658-75515680 TCCCAAGGCCAGAAAGAAGATGG - Intergenic
1120840966 14:89084419-89084441 CAACATGGTCACCAAGCAGAGGG - Intergenic
1121020591 14:90577955-90577977 TCACATGGCCTGAAGCCAGAGGG - Intronic
1121118002 14:91357126-91357148 CCAGTTGGCCTGTAAGCAGAGGG - Intronic
1121317310 14:92969965-92969987 CCACAAGTCCAGAAAGGGGAAGG + Intronic
1121883078 14:97517754-97517776 CCACATGGCCAGTCAGCTCATGG + Intergenic
1123214643 14:106795711-106795733 TCAAATGGCCAAAAAGCATATGG + Intergenic
1123893957 15:24809594-24809616 GCACATGCCCACAAAGCAGCAGG - Intergenic
1123922687 15:25081594-25081616 CCACATGGGGAGACAGCACAAGG + Intergenic
1124567990 15:30833952-30833974 CCAGGTGGCCAGGCAGCAGAAGG - Intergenic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1125518302 15:40335073-40335095 CCACATGGCCATCACGCGGAGGG + Exonic
1126035056 15:44537565-44537587 ACACATGGCCGGCAAGCGGAGGG - Intronic
1126049276 15:44672086-44672108 CCTCATGACCAGAAAAGAGAAGG - Exonic
1127309123 15:57736833-57736855 CCATCGGGCCAGAATGCAGAAGG - Intronic
1127819914 15:62645662-62645684 CAAGATGGCCACAAGGCAGAGGG - Intronic
1127934753 15:63626151-63626173 ACACCTGTCCAGAAAGCAAATGG + Exonic
1127973365 15:63979392-63979414 CCACTTGAGCAGAAAGCAGGCGG + Intronic
1128369900 15:67033135-67033157 TCACATGTCTAGAAAGCATAGGG + Intergenic
1128477106 15:68006624-68006646 ACACAAGTCCAGAACGCAGAAGG - Intergenic
1129235399 15:74220803-74220825 CGACAGGGCCAGGAAGCACAAGG + Intergenic
1129693459 15:77726960-77726982 ACAAATGGCCAAAAAGCAGATGG + Intronic
1131337896 15:91567523-91567545 CCTCATAGCCAGAAAGCAGAAGG - Intergenic
1131512953 15:93059540-93059562 CCACATGGAGAGATGGCAGAGGG - Intronic
1131517063 15:93086566-93086588 ACTGATGGCCAGAAAGCAGAAGG - Intronic
1131808016 15:96143122-96143144 CCACAGAGCTAGAAAGCAGAGGG + Intergenic
1131958941 15:97767623-97767645 TCACATGGCAAGAAACCACAGGG + Intergenic
1132250310 15:100331051-100331073 CAACCTGTCCAGAAAGGAGAAGG + Exonic
1132567160 16:628829-628851 CGACATGGCCAGCACGCAGAAGG + Exonic
1132778789 16:1611861-1611883 CTTCATAGCAAGAAAGCAGAGGG - Intronic
1133126853 16:3652746-3652768 CCAGCTGGCCATGAAGCAGAAGG - Intronic
1133530719 16:6652719-6652741 CCACAGAGACAGAAAGCAGAAGG + Intronic
1133661117 16:7918818-7918840 CCACATGGAGAGAACGCAGCCGG - Intergenic
1134057614 16:11180402-11180424 CCACATGGGCAGAAACCCAAAGG + Exonic
1134104720 16:11477388-11477410 CCACATGGCGCCAGAGCAGAAGG - Intronic
1134673935 16:16076116-16076138 CCCCAGACCCAGAAAGCAGAAGG - Intronic
1134841823 16:17407718-17407740 GCACATAGCCAGAAGGTAGAAGG - Intronic
1136015137 16:27392927-27392949 CCACAAGGCCAGAAGACAGAAGG + Intergenic
1136358627 16:29763073-29763095 CCACAGGGACAGAAAGCAGATGG - Intergenic
1136616546 16:31401925-31401947 CCACATGGCCTGGAAAGAGAGGG - Intronic
1136928280 16:34395581-34395603 ACACACTGCCAGAAAGCAGCTGG + Intergenic
1136976294 16:35016223-35016245 ACACACTGCCAGAAAGCAGCTGG - Intergenic
1139777289 16:69324425-69324447 GCAGACGGCCAGACAGCAGAGGG - Exonic
1139873292 16:70124915-70124937 CCATATGTCAAGAAAGCAGGTGG - Intronic
1139961019 16:70717273-70717295 CCACCTGGCCACAAAGCGGGTGG + Intronic
1139962283 16:70724909-70724931 CCACCTACCCAGAATGCAGATGG - Intronic
1139990116 16:70933532-70933554 TCACATGGCCAGAAGGCGGTGGG - Intronic
1140039002 16:71393047-71393069 CCACATTGCCTGAAGCCAGAGGG + Intergenic
1140042210 16:71415664-71415686 CCACATGTCCAGAGACCAGTGGG + Intergenic
1141345126 16:83237955-83237977 TCACATAGCCAGAAGGCAGAGGG + Intronic
1141469277 16:84227876-84227898 CCACAGAGACAGAAAGCAGAGGG + Intronic
1141624781 16:85255316-85255338 CCACACAGCCAGAAGGCAGCGGG - Intergenic
1141889228 16:86915443-86915465 CCACAGGGCCAGGCAGGAGATGG - Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1143035249 17:3991462-3991484 ACAAATGGCCAATAAGCAGATGG - Intergenic
1143889425 17:10091201-10091223 CCACAGAGACAGAAAGCAGATGG + Intronic
1143904937 17:10200379-10200401 GCCCATGGCCAGAGAACAGATGG - Intergenic
1143979008 17:10851888-10851910 CCAGACGGTAAGAAAGCAGAAGG - Intergenic
1146961121 17:36980427-36980449 GCACATGGCCACAAAACAAACGG - Intronic
1146966372 17:37034610-37034632 CCACAGGGCCAGAAACTAAAAGG + Intronic
1147452357 17:40513623-40513645 CCAAATGGCCAGAGAGCATCTGG - Intergenic
1147911463 17:43858544-43858566 GCACAGGGCCAGCAGGCAGAGGG + Intronic
1148468448 17:47878606-47878628 CCAAAAGGGCAGAAAGCAGAGGG + Intergenic
1148604071 17:48915625-48915647 CCACATGGCCTCTAACCAGATGG + Intronic
1150113566 17:62523994-62524016 AAACATGGCTAGAAAGCTGAAGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151265558 17:72952496-72952518 CCCCATGCCCAGTGAGCAGATGG - Intronic
1151640831 17:75392239-75392261 CTAAATTGTCAGAAAGCAGACGG - Intronic
1151902874 17:77028662-77028684 CCACAGAGACAGAAAGCAGATGG + Intergenic
1151976590 17:77487111-77487133 CCTCCTGTCCAGAAAGCACAAGG + Intronic
1153389481 18:4538238-4538260 CCACATGACCAAAAAACAAAGGG + Intergenic
1153398134 18:4648815-4648837 ACACATGGCCAATAAGCACATGG - Intergenic
1153924848 18:9826821-9826843 CCACATGGCCCTAAAGCAAATGG - Intronic
1154929881 18:20982139-20982161 GCATATGGCAAGAAAGCATATGG + Intronic
1155277033 18:24198487-24198509 GAACATAACCAGAAAGCAGAGGG + Intronic
1155955544 18:31953878-31953900 CCTGCAGGCCAGAAAGCAGATGG - Intergenic
1156332715 18:36139595-36139617 TCACTTGGCCTGAATGCAGATGG - Exonic
1156385304 18:36599155-36599177 CCCCATACCCAGACAGCAGAGGG - Intronic
1156662709 18:39365930-39365952 TCACATGGCCAGGGAGGAGAAGG - Intergenic
1156721808 18:40079175-40079197 TCACATGGCTAGAAATCAGTAGG + Intergenic
1157682137 18:49615458-49615480 CCACAGACACAGAAAGCAGAGGG - Intergenic
1158117773 18:54015720-54015742 CCACATGTTCAAAAAGCAAAAGG - Intergenic
1158203568 18:54966229-54966251 CCACATGGCAATAAGGAAGATGG + Intergenic
1158401597 18:57126488-57126510 TCAGATGGCCTGAAGGCAGAAGG - Intergenic
1160589620 18:79936032-79936054 CCACATGGCCAGCAGGAAGGAGG + Intronic
1161581607 19:5083717-5083739 CCACATGACCCCAAACCAGAGGG - Intronic
1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG + Intergenic
1161731687 19:5964683-5964705 CCACATGACCGGGAAGCACACGG + Intronic
1162791232 19:13064094-13064116 CCACATGTCAAGAAAAGAGAGGG - Intronic
1162813506 19:13179253-13179275 CCACAGAGACAGAAAGTAGATGG - Intergenic
1163279741 19:16308427-16308449 CCATACAGCCAGGAAGCAGATGG + Intergenic
1163279948 19:16309746-16309768 CCATACAGCCAGGAAGCAGATGG - Intergenic
1164909120 19:31991470-31991492 CCTCAAGGCCAGAGAGCAGGTGG - Intergenic
1167159608 19:47758522-47758544 CCACACAGCCACAAAACAGAAGG - Intergenic
1167300571 19:48675199-48675221 CAACAGGGCCAGGAAGCAGAAGG - Intergenic
1168387096 19:55973219-55973241 ACAAATGGCCAAAAAGCAAATGG - Intronic
925077379 2:1028598-1028620 CCACATGAAGGGAAAGCAGAGGG - Intronic
925651786 2:6098304-6098326 ACAAATGGCCAGAAAGCATATGG - Intergenic
926196655 2:10768223-10768245 CCAGTCGGCCAGAAAGCAGGAGG + Intronic
926371029 2:12178854-12178876 CCACATGATCAGTAAGCAGAAGG + Intergenic
927036289 2:19180232-19180254 GCAAATGGCCAAAAAGCATATGG - Intergenic
927399578 2:22695364-22695386 CCACATGGGCTGTAATCAGAGGG + Intergenic
927521983 2:23704383-23704405 CCACAGGGCCAGAAAGCCTGGGG - Intronic
928388204 2:30887490-30887512 ACAAATGGCCAAAAAGCACATGG - Intergenic
930546451 2:52773317-52773339 ACACATGGCCAAGAAGCATAGGG + Intergenic
931884123 2:66597529-66597551 TCACATGGCAGAAAAGCAGAAGG + Intergenic
932026751 2:68141496-68141518 CCACATGGCCAATAAGTAGCAGG + Intronic
935091557 2:99899748-99899770 CCACATGGCCAAGAAACAGAGGG + Intronic
935195368 2:100811186-100811208 ACACTTGGCCAAAAAGCACATGG - Intergenic
936915331 2:117634096-117634118 CCTCATGTCAAGAAAGCAGTGGG - Intergenic
937075753 2:119105175-119105197 CCACATGGGCAGAAAAGAGTAGG - Intergenic
938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG + Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
940259324 2:151764091-151764113 CCATTTGGCCAGCAAACAGAGGG - Intergenic
940259619 2:151766334-151766356 CCACATGACCAGGGAGCAGTGGG + Intergenic
941832834 2:169980902-169980924 TCATAGGGCCAGAAAGTAGAGGG + Intronic
942291699 2:174478865-174478887 GAACAAGGCCAGAAGGCAGATGG + Intronic
942540444 2:177009775-177009797 CAACATGGCCAGAGCTCAGAGGG - Intergenic
942790823 2:179758401-179758423 CAACTTGGTCAAAAAGCAGAAGG + Intronic
943401793 2:187421673-187421695 CCAGATGGCAACACAGCAGAGGG - Intronic
944357790 2:198812330-198812352 TCACACAGCCAGGAAGCAGAAGG - Intergenic
944483443 2:200180113-200180135 CAACATGGCCACAAAGCATGGGG - Intergenic
945843112 2:214911932-214911954 CCACCTGGCTAAAAAGCAAAAGG + Intergenic
946425359 2:219592276-219592298 ACACATGGCCAGAGAGAGGAGGG - Intergenic
946880359 2:224171163-224171185 CCACATTGGCAGAAAACACATGG + Intergenic
947249706 2:228088751-228088773 TCACATGGCAAGAGAGAAGAGGG - Intronic
947531621 2:230912224-230912246 CCACTTCGGCAGAAAGCAGCTGG + Intronic
948118224 2:235509699-235509721 CCACAGTGACAGACAGCAGATGG - Intronic
948797827 2:240413651-240413673 CAACACGGCCACAAAGCCGATGG - Intergenic
948919191 2:241053369-241053391 CCACATGGCCAGGATGAGGAGGG - Intronic
1169292821 20:4367268-4367290 TCACATGTTCAGAGAGCAGAGGG - Intergenic
1170031435 20:11948185-11948207 CCAATTGGACAGTAAGCAGATGG + Intergenic
1170187723 20:13610067-13610089 ATCCATGGACAGAAAGCAGATGG + Intronic
1170960893 20:21024862-21024884 ACAAATGGCCAAAAAGCACATGG + Intergenic
1171360626 20:24584150-24584172 CCACCAGGCCACAGAGCAGAAGG + Intronic
1172840236 20:37898432-37898454 AGACATGCCCAGAAAGCAGCAGG - Intergenic
1173415007 20:42847380-42847402 CTGTATGGCCAGAAATCAGAGGG - Intronic
1174553678 20:51379067-51379089 CAGCATCGCCACAAAGCAGATGG - Intergenic
1177753844 21:25320840-25320862 CCACATTGCTCTAAAGCAGAAGG - Intergenic
1178268977 21:31172122-31172144 CCAGAAAGCCAGAAAGCAGGAGG + Intronic
1178730737 21:35100563-35100585 CCAGATGGACTGAAAGCAAATGG - Intronic
1179785547 21:43727911-43727933 CCAGATGGCCAGACAGCTGGGGG - Intronic
1180013283 21:45065394-45065416 CCCCATGGCCAGGACGCAGTTGG + Intergenic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1181491313 22:23262489-23262511 CCCCATGGCCAGAGAGCAGGAGG + Intronic
1181767835 22:25104469-25104491 CCACATGTCCAGAACTCCGAGGG + Intronic
1182241867 22:28922672-28922694 ACCCAAGGCCAGAACGCAGAGGG - Intronic
1182567489 22:31211146-31211168 CCAAATGACCAGAAAGAGGATGG - Intergenic
1183309259 22:37100631-37100653 CCTCATGGTCTGAAAGCATAGGG + Intronic
1184467414 22:44677013-44677035 TCACATGGCCAAAGGGCAGAGGG - Intronic
1184486385 22:44782528-44782550 CCACAGAGACAGAAAGCAGATGG - Intronic
1184959835 22:47921036-47921058 CCAAATGCCCATAAATCAGAAGG + Intergenic
1185124512 22:49000118-49000140 CCACTCTGGCAGAAAGCAGAAGG - Intergenic
1185418623 22:50722857-50722879 CCACATGGCCACAGAGAGGATGG - Intergenic
949954530 3:9256761-9256783 CCACAGGGGCAGAATGCAGGCGG - Intronic
950092062 3:10302989-10303011 TCACATAGACAGAAAGGAGAAGG + Intronic
952996836 3:38891686-38891708 CCACATGGCAAGAAAGAGAAAGG + Intronic
953454294 3:43029683-43029705 CCTCATGTCCAGGAGGCAGAAGG + Intronic
953564114 3:44016501-44016523 GAACATGGAGAGAAAGCAGACGG - Intergenic
954848042 3:53577121-53577143 CCACATGGCCAGTAAACAATGGG - Intronic
956126529 3:66016337-66016359 CCACATAGCAAGGAAGCAGCAGG + Intronic
956622766 3:71237661-71237683 CCACATGTAGAGAAAGCAGTAGG - Intronic
956656320 3:71556196-71556218 GCAAATGGCCAGAAACCAAAGGG + Intronic
956764599 3:72473800-72473822 TCACATGGCAGAAAAGCAGAAGG - Intergenic
958441852 3:94164916-94164938 CCACATGATCAGTAAGAAGAGGG + Intergenic
959666024 3:108922609-108922631 ACACATGGCCAACAAGCATATGG - Intronic
959965878 3:112354276-112354298 CCCCATGGCCAAAAAGCCAAGGG - Intronic
961201086 3:125046088-125046110 CCACAGAGGCAGAAAGCAGAAGG + Intronic
961378404 3:126481991-126482013 GCAGGTGGCCAGGAAGCAGAGGG + Exonic
961648204 3:128403877-128403899 CCAGATCTCCAGACAGCAGAAGG - Intronic
962468094 3:135679074-135679096 CAACAAGTCGAGAAAGCAGAAGG - Intergenic
962660210 3:137594575-137594597 CCTCATGGCCAGAATGAAGAAGG - Intergenic
962964966 3:140345026-140345048 CGACATGCCCTGAAAGCAGATGG - Intronic
963366073 3:144336299-144336321 ACACATGGCCAGTAAACAAAAGG - Intergenic
964730325 3:159857948-159857970 ACTCATGGCCAGAAAGAAGGTGG - Intronic
964979492 3:162661706-162661728 TCACATGGGCAGAATTCAGAAGG - Intergenic
969185989 4:5474709-5474731 CCCCATGGCCAGCACACAGAAGG - Intronic
971102743 4:23485895-23485917 CCACTTGGCCAGAAGGAAGCAGG - Intergenic
971306715 4:25489219-25489241 CAACATGGACATAAAGCAGATGG - Intergenic
971371664 4:26024234-26024256 CAACAGGGCTAGAAAGCAAAAGG + Intergenic
972804755 4:42517576-42517598 TCACATGGTTAGAATGCAGATGG - Intronic
972907343 4:43767497-43767519 TCACATGGCAGGAAGGCAGAGGG + Intergenic
973289843 4:48460078-48460100 GAACATGGCCTGAAACCAGAGGG + Intergenic
979154819 4:117371311-117371333 CCAAATGGCCAGAATGTTGAAGG + Intergenic
979440989 4:120749498-120749520 GCACAGGGACAGAAAGCAGATGG - Intronic
981321100 4:143392579-143392601 CCAGATGACCAGAAAGAATATGG + Intronic
981562311 4:146061580-146061602 CCACATACCCAGAAAGCTGAGGG - Intergenic
982454360 4:155590999-155591021 TCACATGGCAAGACAGCAAATGG + Intergenic
984048388 4:174831865-174831887 CCTCATATCCAGTAAGCAGAAGG + Intronic
984706001 4:182847698-182847720 CCAGAAGGGCAGAGAGCAGAGGG + Intergenic
985558525 5:569900-569922 CCACATGGCCACAAAGAAGGGGG + Intergenic
985749577 5:1666713-1666735 ACACATGGCCAAAAAGCATATGG - Intergenic
985913856 5:2903135-2903157 CCAGCAGGGCAGAAAGCAGATGG - Intergenic
987049685 5:14139032-14139054 CCACATGCTCAGATAGCAGAAGG + Intergenic
988165242 5:27580587-27580609 TCACAGGGCCAGAAATCAAAGGG - Intergenic
988929291 5:36020200-36020222 ACAAATGGCCAGCAAGCATATGG - Intergenic
989355020 5:40534096-40534118 ACAAATGGCCAAAAAGCATATGG - Intergenic
990286907 5:54309907-54309929 GCACATTACCATAAAGCAGACGG - Intronic
991309198 5:65216388-65216410 CCACAGAGACAGAAAGCAGATGG + Intronic
991919947 5:71646763-71646785 CCACACACCCAGAAAGCAGCAGG + Intronic
993214559 5:85002933-85002955 ACACATGGCCAATAAGCATATGG - Intergenic
993598360 5:89888300-89888322 TCACACGGCCAAAAAGCAGGTGG - Intergenic
995317048 5:110787138-110787160 CCACATGTCCTGAAAGAAGTTGG + Intergenic
997728485 5:136143622-136143644 CCACTTGGCAAGAAAGTACAAGG - Intronic
1001260802 5:170226945-170226967 CCACAGAATCAGAAAGCAGATGG + Intergenic
1001865291 5:175098755-175098777 CCACAAAGCAAGAAATCAGAGGG - Intergenic
1002810443 6:623072-623094 GCCCCTGGCCAGAAAGCAGTGGG + Intronic
1002971457 6:2026192-2026214 CCACATGGCCAGAAAGCCCAGGG - Intronic
1003529333 6:6924914-6924936 GCACCTGGCCACAAATCAGATGG - Intergenic
1003567754 6:7234953-7234975 CCACATGTCCACATTGCAGAAGG + Intronic
1004662355 6:17721626-17721648 CCACATGGACAGGAATGAGAGGG - Intergenic
1004856264 6:19753633-19753655 TCATATAGCAAGAAAGCAGAAGG + Intergenic
1005172975 6:23009417-23009439 CAATATGGCTTGAAAGCAGATGG + Intergenic
1005391679 6:25340243-25340265 CCACGTGGTAAGGAAGCAGAGGG + Intronic
1005441440 6:25873490-25873512 CCTCAAGGCCAGAATGGAGAAGG - Intronic
1006406501 6:33848757-33848779 ACAAATGGCCAGATGGCAGAGGG - Intergenic
1006572545 6:35017660-35017682 CCACAAGGCCAGCATGCAGCTGG + Exonic
1006941930 6:37757799-37757821 CCAAATGGCCAGTAAGCACGTGG + Intergenic
1007243838 6:40445789-40445811 CCACAGGGCCAGAAAGAGGCAGG - Intronic
1007496015 6:42260791-42260813 TCACATGGCCTGGAGGCAGATGG - Intronic
1007691749 6:43706952-43706974 GCAGATTGCCATAAAGCAGAGGG + Intergenic
1008627113 6:53327488-53327510 CTACAGAGACAGAAAGCAGATGG + Intronic
1008683748 6:53901822-53901844 CCACAGGGCAAGATAGGAGAAGG - Intronic
1009395252 6:63192583-63192605 CCAAATGGTCAGAAACCTGAAGG - Intergenic
1009620253 6:66065672-66065694 CCACTGGGCCAGGAAGCTGAAGG + Intergenic
1014748058 6:125223142-125223164 CAGCATAGCCAGAAAGCAGTAGG - Intronic
1015186615 6:130424241-130424263 TCACACAGCCAGGAAGCAGAAGG - Intronic
1017061145 6:150486188-150486210 CCTCCTTGACAGAAAGCAGAAGG + Intergenic
1018208402 6:161456808-161456830 CCACATGCCCAGAGAGCTCAGGG + Intronic
1018786193 6:167109837-167109859 CTACCCAGCCAGAAAGCAGAAGG - Intergenic
1019525152 7:1477418-1477440 ACACATGGCCTGAGAGCAGGGGG + Intronic
1019584261 7:1788458-1788480 ACACATGTCAAGAAAGCAGGAGG - Intergenic
1021241128 7:18202393-18202415 CCACAAGGCAAGAAATCTGAAGG - Intronic
1021630742 7:22644312-22644334 ACACATAGGCTGAAAGCAGAGGG - Intergenic
1022203950 7:28145194-28145216 CCACATTTCCAGCAAGTAGAAGG + Intronic
1023274036 7:38498933-38498955 CAACTGGGCCAGGAAGCAGAAGG - Intronic
1023341102 7:39220669-39220691 CTACATAGCCAGCAAGCAGAAGG - Intronic
1023959088 7:44912069-44912091 TCACAAGGCCAGGAGGCAGATGG + Intergenic
1028325244 7:89516146-89516168 CCGCATGGCCAGAATGTTGAAGG - Intergenic
1029677579 7:102081011-102081033 CGAAGTGGCCAGAAACCAGAAGG - Intronic
1029735371 7:102462815-102462837 TCACAGGGACAGAAAGTAGAAGG - Intronic
1030693234 7:112556480-112556502 TCACATGGCAAGAAAGGAGGAGG - Intergenic
1032043264 7:128579757-128579779 AAACATGGCTAGAAAGCTGAAGG - Intergenic
1032200875 7:129821945-129821967 CTGCATGGCCAGAAGGCCGAGGG - Intergenic
1033187856 7:139245804-139245826 CCAGATGGGGAGAAAGCACAAGG + Intronic
1033729463 7:144160926-144160948 ACAGATGGCAAGAAAGCACATGG - Intergenic
1034116476 7:148588429-148588451 CCACATGCACAGAATACAGAAGG - Intergenic
1034354510 7:150442226-150442248 ACACATGGCCAGGAAGATGAAGG - Intergenic
1034967759 7:155401991-155402013 CCACCTGTGTAGAAAGCAGAAGG + Intergenic
1035354728 7:158270270-158270292 AGTCATGGCCAGAAGGCAGAAGG + Intronic
1036673522 8:10810016-10810038 TCACATGGCCAGATGGCAGGAGG + Intronic
1037161070 8:15772873-15772895 CCACATGAACAGAATGAAGAGGG + Intergenic
1038315000 8:26476859-26476881 CCACACAGCCAGGAAGCAGTGGG + Intronic
1038745345 8:30249829-30249851 CACCATGGCCTTAAAGCAGATGG - Intergenic
1038949646 8:32400517-32400539 ACACATGGCCAATAAGCATATGG + Intronic
1039135276 8:34315631-34315653 CCCCATGGGTAGAAAACAGAAGG + Intergenic
1039351651 8:36770133-36770155 CCATGTGGCCAGAAAGAGGAAGG + Intergenic
1039419116 8:37420796-37420818 CCACTTGGGCAGAAAGAGGAGGG + Intergenic
1041276033 8:56158105-56158127 GGACATCTCCAGAAAGCAGAAGG - Intergenic
1041441598 8:57902821-57902843 GCACATGGTTATAAAGCAGAAGG + Intergenic
1041821428 8:62038722-62038744 CCACATGGCAAAAAGGCACATGG - Intergenic
1042699989 8:71601684-71601706 TCACATGACCACCAAGCAGAAGG + Intergenic
1043508036 8:80922083-80922105 ACAAATAGCCAGAAAGCACATGG + Intergenic
1043556261 8:81433754-81433776 ACAAATGGCCAAAAAGCATATGG - Intergenic
1043848043 8:85183703-85183725 TCACAGGGGCAGAAAGTAGAAGG + Intronic
1043875948 8:85486304-85486326 ACAAATGGCCAGTAAGCATATGG - Intergenic
1044383980 8:91565771-91565793 CTAGATGGGCACAAAGCAGAGGG + Intergenic
1045039060 8:98203572-98203594 CCACGTGCCAAGAAAGAAGATGG + Intronic
1047135289 8:122071137-122071159 CCCCAGGGCCTGAAAGCTGAAGG + Intergenic
1047446758 8:124927054-124927076 GCACGTGGCCAGAACCCAGAGGG + Intergenic
1048688101 8:136926993-136927015 CTCCATGGCCACAAAGTAGAGGG + Intergenic
1048717820 8:137287433-137287455 CCACAGGGCCTGAAAGCTTAAGG + Intergenic
1049295477 8:141832037-141832059 ACAAATGGCCAGTAAGCACATGG - Intergenic
1049457622 8:142701430-142701452 CCGCATGGGGAGAAAGCAGGAGG - Intronic
1049541919 8:143212521-143212543 ACACAAGGCCAGAAGGCAGGTGG + Intergenic
1049746658 8:144265932-144265954 GGACATGGCCAGCTAGCAGAAGG + Intronic
1050400710 9:5250629-5250651 CCAAATGGCCAACAAGCATATGG + Intergenic
1050518282 9:6469012-6469034 CCACATAATCAGAAAACAGAAGG + Intronic
1050920061 9:11188936-11188958 CCACCTGTCCAGAAAGATGATGG + Intergenic
1051851894 9:21519007-21519029 TCACATGGCCAGAAGGTGGAAGG - Intergenic
1053020240 9:34689439-34689461 CCACCTGGCTAGACAGCAAACGG + Intergenic
1053204067 9:36171688-36171710 TCTCATGGCCAGGAAGGAGAAGG + Intergenic
1057575941 9:96242800-96242822 TCACATGGCTAGGAAGCAGGTGG + Intronic
1057989733 9:99756190-99756212 CCACTTGACCTGAAAGTAGAGGG - Intergenic
1058410343 9:104724702-104724724 CCTCCTGGTCAGAACGCAGAGGG + Intergenic
1058541669 9:106018402-106018424 CCACCTGTCCAGAAATTAGATGG - Intergenic
1059583151 9:115574230-115574252 TCACATGGACAGAAAGAAAAGGG - Intergenic
1060055321 9:120408233-120408255 CCACAAGGCCAGAGTGGAGAGGG + Intronic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1061448351 9:130654858-130654880 CCTCATGGCCAGAACCCAGCTGG + Intergenic
1061512024 9:131067362-131067384 CTCCATGTCCAGAAAGCACAAGG + Intronic
1061550422 9:131331362-131331384 CCACTTGGCCGGAAAGCGGCAGG + Intergenic
1062288143 9:135782603-135782625 CCTCCTGTCCAGAAAGCAGGAGG + Intronic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1187096196 X:16151020-16151042 CCACATGGAGACAAAGCAGGAGG + Intronic
1188372742 X:29388733-29388755 CCATAGAGACAGAAAGCAGATGG + Intronic
1189076509 X:37921046-37921068 CCTCATGCACAGAAAGCACAAGG - Intronic
1190411013 X:50137169-50137191 ACACATGGCCACATAGCATAGGG + Intergenic
1190826282 X:54021097-54021119 CTACATAGCCATAAAACAGAAGG + Intronic
1190990656 X:55546818-55546840 CCACATGTACAGAAATCACATGG - Intergenic
1191150686 X:57218939-57218961 CCCCATGGCCTGAAAGCTTAAGG + Intergenic
1191804113 X:65115823-65115845 ACAAATGGCCAAAAAGCATATGG - Intergenic
1192852871 X:74976257-74976279 ACAAATGGCCAGCAAGCATATGG - Intergenic
1194894480 X:99423293-99423315 CCACATGACCAGAAACCAATAGG - Intergenic
1195237472 X:102915848-102915870 ACAAATGGCCAGCAAGCATATGG + Intergenic
1196559986 X:117134691-117134713 CCTTATGGGAAGAAAGCAGAGGG - Intergenic
1196731016 X:118941670-118941692 ACAAATGGCCAAAAAGCACAAGG + Intergenic
1197130452 X:122999717-122999739 ACAAATGGCCAAAAAGCACATGG + Intergenic
1197137272 X:123076410-123076432 ACACAGGGCTATAAAGCAGATGG + Intergenic
1197150078 X:123210530-123210552 ACTCATGCCCAGAAAGGAGAAGG - Intronic
1197848016 X:130824751-130824773 CCACATGGCCAATAAACACATGG + Intronic
1198037258 X:132813479-132813501 CCACGTGTTCAGTAAGCAGATGG - Intronic
1198511560 X:137356911-137356933 ACACATGACCAGTAAGCACACGG + Intergenic
1199622810 X:149714606-149714628 CCTCCTGGCCAGAACACAGAGGG + Intronic
1199628504 X:149760904-149760926 CCTCCTGGCCAGAACACAGATGG + Intergenic
1200292005 X:154884414-154884436 CTCTATGGACAGAAAGCAGATGG + Intronic
1200338843 X:155380151-155380173 CTCTATGGACAGAAAGCAGATGG + Intergenic
1200347626 X:155460541-155460563 CTCTATGGACAGAAAGCAGATGG - Intergenic
1200987068 Y:9312864-9312886 GCAAATGGCCAAAAAGCACATGG + Intergenic
1200987107 Y:9313407-9313429 GCAAATGGCCAAAAAGCACATGG + Intergenic
1202112059 Y:21431826-21431848 GCAAATGCCCAGAAAGCACATGG + Intergenic