ID: 1105286694

View in Genome Browser
Species Human (GRCh38)
Location 13:19009936-19009958
Sequence ATGTCTTTTTAGGAGAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 577}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105286694 Original CRISPR ATGTCTTTTTAGGAGAGTGT TGG (reversed) Intergenic
900821899 1:4896207-4896229 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
901590616 1:10338634-10338656 TGCTCTTTTTAGGAGATTGTAGG - Intronic
902646266 1:17800765-17800787 TTGTATTTTTAGTAGAGTCTGGG + Intronic
902763679 1:18600636-18600658 TTGTATTTTTAGTAGAGTTTGGG - Intergenic
902776951 1:18680993-18681015 TTGTATTTTTAGTAGAGAGTGGG - Intronic
903149008 1:21391980-21392002 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
903753382 1:25644190-25644212 ATGGCATTTCAGGAGAATGTGGG + Intronic
903767756 1:25745816-25745838 TTGTATTTTTAGTAGAGAGTGGG - Intronic
903954779 1:27017793-27017815 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
904190730 1:28741469-28741491 TTGTCTTTTTAGTAGAGACTGGG + Intronic
904266737 1:29322640-29322662 GTGTCTTTTTGGGAGAGGATGGG + Intronic
904726746 1:32554649-32554671 ATGTATTTTTAGTAGAGACTGGG + Intronic
905420004 1:37835301-37835323 AAGTATTTTTAAGAGAGTTTGGG + Intronic
906176800 1:43781435-43781457 TTGTGTTTTTAGTAGAGTGGGGG - Intronic
906595072 1:47068740-47068762 TTGTCTTTTCAGGAGAATCTTGG - Exonic
906671764 1:47661067-47661089 AGGGCTTTTTAGGAAAGTGTAGG + Intergenic
908020185 1:59890835-59890857 ATCTCTTTGTAGGAGAGTAGTGG + Intergenic
908179886 1:61593210-61593232 TTGTATTTTTAGGAGAGTTGGGG - Intergenic
908973872 1:69872982-69873004 TTGTCATTTTCAGAGAGTGTAGG + Intronic
909762627 1:79311411-79311433 TTGGCTTTTTTGGAGAGTTTAGG + Intergenic
910595403 1:88975323-88975345 TTGTATTTTTAGGAGAGACTGGG + Intronic
910677643 1:89831076-89831098 TTGTATTTTTAGGAGAGAGGGGG + Intronic
910888015 1:91987090-91987112 TTGTATTTTTAGTAGAGAGTGGG + Intronic
911006038 1:93225602-93225624 TTGTATTTTTAGTAGAGAGTGGG - Intronic
911499788 1:98671168-98671190 ATATCTTCTTTGGAAAGTGTGGG - Intronic
911582597 1:99651583-99651605 ATTTCTTTTTAAGAGAGGGTAGG - Intronic
911904756 1:103552585-103552607 TTGTATTTTTAGTAGAGAGTCGG - Intronic
915445930 1:155974985-155975007 ATGTCTCTTTGGGAGAGGGTGGG - Intronic
915735764 1:158083955-158083977 TTGTATTTTTAGTAGAGAGTAGG - Intronic
916433895 1:164759166-164759188 ATGCCTTTAAAGGATAGTGTCGG + Intronic
916539278 1:165736547-165736569 TTGTATTTTTAGGAGAGAGCGGG - Intronic
916568506 1:166004497-166004519 ATTTCTTTTTAGTTCAGTGTTGG + Intergenic
917593187 1:176498575-176498597 TTGTATTTTTAGGAGAGACTGGG - Intronic
918198040 1:182241052-182241074 ATTTCATTTTAAGAGAGTGTAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919022683 1:192127582-192127604 TTGTACTTTTAGGAGAGTTTGGG - Intergenic
919371588 1:196734305-196734327 ATGTTTTTTTAGGACATTCTTGG + Intronic
919637052 1:200013203-200013225 TTGTATTTTTAGGAGAGTTGGGG - Intergenic
920172262 1:204079516-204079538 TTGTATTTTTAGGAGAGTTGGGG + Intronic
921439839 1:215172827-215172849 ATGTATTTTTAGGAGAGATGGGG + Intronic
922118968 1:222643854-222643876 AAGACTTTTTAATAGAGTGTCGG + Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923572182 1:235126303-235126325 TTGTATTTTTAGCAGAGTGGGGG + Intronic
924072807 1:240299118-240299140 TTGTATTTTTAGGAGAGACTGGG + Intronic
924536483 1:244940030-244940052 TTGTATTTTTAGCAGAGTGGGGG - Intergenic
1063495923 10:6508019-6508041 TTGTATTTTTAGGAAAGTCTTGG + Intronic
1063625745 10:7688393-7688415 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
1064181676 10:13121818-13121840 AGGTCCTTTTAGTAGAGTTTGGG + Intronic
1064996893 10:21303923-21303945 ATGTCTTTTTTTGTGTGTGTGGG - Intergenic
1066424058 10:35289699-35289721 TTGTATTTTTAGTAGAGTCTGGG - Intronic
1066538744 10:36421060-36421082 TTGTATTTTTAGGAGAGAGAGGG + Intergenic
1066559464 10:36653448-36653470 TTGTATTTTTAGGAGAGAGGGGG + Intergenic
1066686298 10:37984707-37984729 TTGTCTTTTTAGTAGAGAGAGGG - Intergenic
1066758375 10:38732328-38732350 ATGTATTTTTAGTAGAGAGGAGG + Intergenic
1066963281 10:42240366-42240388 ATGTATTTTTAGTAGAGAGGAGG - Intergenic
1068369860 10:56098327-56098349 ATGTATTTTTTGGAGAGAGAGGG - Intergenic
1068421043 10:56793688-56793710 ATGTATTTTTAAAAGAGTTTTGG - Intergenic
1068786669 10:60983267-60983289 ATATCTTCTTAGGAGACTATTGG + Intronic
1070336182 10:75456846-75456868 TTGTATTTTTAGGAGAGTCAGGG + Intronic
1070492274 10:76988662-76988684 ATGTGTTTTTGGGAGAGGGAGGG - Intronic
1070863213 10:79689503-79689525 ATGTGTTTTTAGGGGAATATGGG - Intergenic
1070910438 10:80113177-80113199 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
1071250521 10:83814369-83814391 ATGTCTTTTATGGTCAGTGTGGG - Intergenic
1071843503 10:89498127-89498149 TTGTATTTTTAGTAGAGTTTGGG - Intronic
1072585634 10:96779269-96779291 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1073269844 10:102253065-102253087 TTGTATTTTTAGTAGAGTGGGGG + Intronic
1073286606 10:102393643-102393665 ATGTATTTTTAGTAGAGTTGGGG - Intergenic
1073508975 10:104030733-104030755 AAGTCTTTTTAGAAGAGTAGTGG + Intergenic
1073546068 10:104350083-104350105 AAATCTTTTAAGGGGAGTGTTGG + Intergenic
1074247330 10:111708081-111708103 ATGTCTCTGTATGAGATTGTTGG + Intergenic
1074722916 10:116278827-116278849 AGGGCTTATTAGGAGAGTGGTGG - Intergenic
1075354999 10:121763839-121763861 TTGTATTTTTAGTAGAGTGGAGG - Intronic
1075377231 10:121988422-121988444 TTGTCTTTTTAGTAGAGAGGGGG + Intergenic
1075415895 10:122264015-122264037 GTTTCTTTTTAGGAGCTTGTAGG + Intergenic
1076213281 10:128670083-128670105 TTGTATTTTTAGGAGAGAGAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079497557 11:21063018-21063040 ATGTATTTTTAGGAGAGATGAGG + Intronic
1079606537 11:22375650-22375672 TTGTATTTTTAGTAGAGTCTGGG + Intronic
1081133557 11:39409730-39409752 TTGTATTTTTAGGAGAGAATGGG - Intergenic
1082198476 11:49332640-49332662 TTGTGTTTTTAGTAGAGTTTGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083039515 11:59672011-59672033 ATGTATTTTTAGGCGGGTGCTGG + Intergenic
1083067108 11:59936177-59936199 ATGTCTTTTCAGAAGAGTCTTGG - Intergenic
1083444627 11:62699538-62699560 ATGTCTTTATAGAAGATTCTAGG + Intronic
1083481095 11:62947569-62947591 ATGAATTTTTAGGACAGTGGAGG + Intronic
1084234211 11:67775965-67775987 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1085982229 11:81738177-81738199 AAGTCTCTTTAGGATATTGTAGG + Intergenic
1086176316 11:83895330-83895352 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1086420309 11:86631903-86631925 TTGTATTTTTAGGAGAGAGAGGG + Intronic
1086657332 11:89375478-89375500 TTGTGTTTTTAGTAGAGTTTGGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087304220 11:96470160-96470182 ATTTCTTTATTGGGGAGTGTAGG + Intronic
1087838010 11:102894152-102894174 ATTTTTTTTTAGTAGAGTGGGGG + Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090637566 11:128700465-128700487 AGGGCTTTCTAGGAGAGTGGAGG + Intronic
1090785964 11:130047697-130047719 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
1091110908 11:132965703-132965725 TTGTCTTTTTAGTAGAGAGGGGG + Intronic
1091393598 12:140513-140535 ATGTATTTTCAGAAGGGTGTGGG - Intronic
1091447629 12:553133-553155 ATGTCTTGTTTGGAAAGGGTTGG + Intronic
1091574765 12:1723079-1723101 ATGACTTTTTAGGATATAGTAGG + Intronic
1091881068 12:3978613-3978635 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
1092461479 12:8690748-8690770 TTGTATTTTTAGGAGAGAGGGGG - Intronic
1092932334 12:13327862-13327884 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
1092991482 12:13906156-13906178 ATTTGTTTTTAGCAGAGGGTTGG + Intronic
1093041209 12:14381401-14381423 ATGTATTTTTAGTAGAGACTGGG + Intronic
1093047647 12:14468092-14468114 TTGTCTTTTTAGTAGAGTTGCGG - Intronic
1093816003 12:23547890-23547912 ATGTCTTTTGCTGAGAGAGTCGG + Intronic
1093950144 12:25156181-25156203 ATGTCTTTTTAATAGCCTGTTGG + Intronic
1094026552 12:25965532-25965554 ATGTATTTTTAGTAGAGACTGGG + Intronic
1094532733 12:31292324-31292346 TTGTATTTTTAGTAGAGTTTGGG - Intronic
1094547815 12:31421215-31421237 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1095670737 12:44857263-44857285 CTGTCTTTTAATGAGAATGTAGG - Intronic
1096280784 12:50251446-50251468 TTGTATTTTTAGTAGAGTCTGGG - Intronic
1096339474 12:50785396-50785418 ATTTCTTTTTGGGGGAATGTTGG + Intronic
1096917996 12:55054168-55054190 ATTTAATTTTAGGAGACTGTGGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097836616 12:64279642-64279664 TTGTATTTTTACTAGAGTGTAGG - Intronic
1099300775 12:80891838-80891860 AAGGCTTGTTAAGAGAGTGTGGG + Intronic
1099322779 12:81172092-81172114 TTGTCTTTTTAGTAGAGACTGGG - Intronic
1099588522 12:84554231-84554253 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1099939433 12:89167938-89167960 GTGTCATTTTAGTGGAGTGTGGG - Intergenic
1100134114 12:91534074-91534096 TTGTATTTTTAGTAGAGTCTTGG + Intergenic
1100274424 12:93058854-93058876 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1100345325 12:93724205-93724227 TTGTATTTTTAGGAGAGACTGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101206883 12:102497252-102497274 ATGTCTTTTTCCGATAGTGCAGG - Intergenic
1101275213 12:103192328-103192350 ATGTATTTTTAGTAGAGAGGGGG - Intergenic
1101695279 12:107119711-107119733 GAGTCTTTTGGGGAGAGTGTTGG + Intergenic
1102070718 12:110016943-110016965 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1102554059 12:113714266-113714288 ATGTGTGTTTTGGAGAGTGAAGG + Intergenic
1102645043 12:114398263-114398285 ATGTCTGTGTAGGAGAGTAGTGG + Intronic
1103366248 12:120385620-120385642 TTGTATTTTTAGGAGAGACTGGG + Intergenic
1104217847 12:126751910-126751932 TTGTCTTTTTAGTAGAGTTGGGG + Intergenic
1105286694 13:19009936-19009958 ATGTCTTTTTAGGAGAGTGTTGG - Intergenic
1106448133 13:29854823-29854845 ATCTCTGTTTAGGAAAGTGTGGG - Intergenic
1106542950 13:30706176-30706198 ATGCCTTTCTAGGAGATTGGTGG + Intergenic
1107356600 13:39574160-39574182 ATATCTTTCTAAGATAGTGTGGG - Intronic
1107549919 13:41464726-41464748 ATGTATTTTTGGGGAAGTGTAGG + Intronic
1107625795 13:42282139-42282161 TTGTATTTTTAGTAGAGTCTGGG + Intronic
1107843680 13:44487883-44487905 TTGTATTTTTAGTAGAGTGGGGG - Intronic
1108362573 13:49680647-49680669 TTGTATTTTTAGTAGAGTGGGGG - Intronic
1109296548 13:60539543-60539565 ATTTGTTTTTAGGAGGGTTTGGG + Intronic
1110633248 13:77734845-77734867 ATGTATTTTTAGTAGAGAGGGGG - Intronic
1112096494 13:96137604-96137626 TTGTATTTTTAGGAGAGAGGGGG + Intronic
1112967213 13:105211624-105211646 CTTTCTGTTTAGGAAAGTGTTGG - Intergenic
1113256199 13:108508850-108508872 GTGTCTTTTTGGGAGAGTGAGGG + Intergenic
1113497080 13:110739421-110739443 AAGACTTTTTAGGAGACTGTTGG + Intergenic
1113514300 13:110880395-110880417 ATGGCTTTTCAGGACTGTGTTGG - Intronic
1115247149 14:31307439-31307461 AGGTCTTTTTAAGAGATTGCTGG - Intronic
1115593122 14:34883188-34883210 ATGTATTTTTAGTAGAGAGGGGG - Intergenic
1115696106 14:35900410-35900432 TTGTATTTTTAGTAGAGTCTGGG + Intronic
1116576178 14:46578535-46578557 ATGTCTTTTTATTAGATTGCAGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117090293 14:52243587-52243609 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
1118942714 14:70353086-70353108 ATGTATTTTTAGGAGAGATGGGG - Intronic
1118954586 14:70468469-70468491 TTGTATTTTTAGGAGAGAGAGGG - Intergenic
1122527861 14:102401264-102401286 TTGTATTTTTAGTAGAGTTTGGG - Intronic
1123441781 15:20297044-20297066 ATGTATTTTTAGTAGAGAGGAGG + Intergenic
1123568391 15:21576071-21576093 ATATATTTTTAGAAGAATGTAGG - Intergenic
1123582468 15:21729222-21729244 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1123604499 15:22011393-22011415 ATATATTTTTAGAAGAATGTAGG - Intergenic
1123619118 15:22171818-22171840 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1123824767 15:24069906-24069928 AAGTCTTTTTAGGAAAGTGTGGG + Intergenic
1124322388 15:28724940-28724962 ATCTCTTTTTAAGAAAATGTGGG - Intronic
1124574992 15:30900124-30900146 ATTTCTTTTTATAAGAGTTTTGG + Intergenic
1125087757 15:35751200-35751222 AACTCTGTTTAGGAGAATGTAGG + Intergenic
1125128247 15:36250559-36250581 TTGTATTTTTAGGAGAGACTGGG - Intergenic
1125334750 15:38616235-38616257 ATGTTTTATTTGGAGAGGGTGGG + Intergenic
1125654631 15:41346111-41346133 TTGTGTTTTTAGTAGAGTGGAGG + Intronic
1126729343 15:51666248-51666270 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
1127028282 15:54832866-54832888 AGGTTTTCTTGGGAGAGTGTGGG - Intergenic
1128020985 15:64390287-64390309 TTGTATTTTTAGTAGAGTGGGGG - Intronic
1129534184 15:76298213-76298235 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1129582148 15:76823002-76823024 TTGTCATTTTATGAGAGTATTGG - Intronic
1130712205 15:86294224-86294246 TTGTATTTTTAGTAGAGAGTGGG - Intronic
1132753349 16:1469511-1469533 TTGTATTTTTAGGAGAGTTGGGG - Intronic
1132979307 16:2727669-2727691 ATGTGTTTTTAGTAGAGACTGGG - Intergenic
1133574796 16:7078518-7078540 TTGTATTTTTAGGAGAGTCAGGG + Intronic
1133955369 16:10438878-10438900 TTGTATTTTTAGGAGAGATTGGG - Intronic
1134136516 16:11680082-11680104 TTGTCTTTCTTGGAGGGTGTGGG - Intronic
1134437594 16:14275861-14275883 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
1134504456 16:14793647-14793669 ATGTGTCTTGAGGAGAGAGTTGG - Intronic
1134576115 16:15335262-15335284 ATGTGTCTTGAGGAGAGAGTTGG + Intergenic
1134687138 16:16166716-16166738 TTGTATTTTTAGTAGAGAGTAGG - Intronic
1134726326 16:16421239-16421261 ATGTGTCTTGAGGAGAGAGTTGG - Intergenic
1134941105 16:18290620-18290642 ATGTGTCTTGAGGAGAGAGTTGG + Intergenic
1135146447 16:19966888-19966910 TTGTCATTTTTGGAGAGTGGAGG - Intergenic
1135231097 16:20708126-20708148 TTGTATGTTTAGTAGAGTGTAGG - Intronic
1135426516 16:22341475-22341497 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
1136161344 16:28421148-28421170 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
1136201620 16:28693843-28693865 TTGTATTTTTAGTAGAGTCTGGG + Intronic
1136217965 16:28808035-28808057 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1136353331 16:29726813-29726835 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1136724451 16:32346867-32346889 ATGTATTTTTAGTAGAGAGGAGG - Intergenic
1136842777 16:33552908-33552930 ATGTATTTTTAGTAGAGAGGAGG - Intergenic
1137505458 16:49050409-49050431 CTGTATTTTTAGTAGAGTCTGGG + Intergenic
1137779547 16:51086422-51086444 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1137863393 16:51869186-51869208 ATGTGATTTTAGCAGAGTGGTGG - Intergenic
1137894231 16:52193944-52193966 TTGTATTTTTAGGAGAGAGGGGG + Intergenic
1138009999 16:53369636-53369658 ATTTCTTTTTATAAGAGTTTTGG - Intergenic
1138937792 16:61750903-61750925 ATTTCTTCTTAGGAAATTGTTGG + Intronic
1139313516 16:66047094-66047116 ATGTATTTTTAGGAAACTTTTGG - Intergenic
1139601199 16:67988370-67988392 TTGTCTTTTTAGTAGAGATTGGG - Intronic
1139620394 16:68135888-68135910 TTGTATTTTTAGTAGAGTGGGGG - Intronic
1139765088 16:69221601-69221623 TTGTATTTTTAGGAGAGAGGGGG - Intronic
1139789700 16:69423892-69423914 TTGTATTTTTAGTAGAGAGTAGG - Intergenic
1139966562 16:70748772-70748794 TTGTATTTTTAGGAGAGAGGGGG - Intronic
1140042634 16:71418936-71418958 TGATCTTTTCAGGAGAGTGTTGG - Intergenic
1140083115 16:71769108-71769130 TTGTATTTTTAGGAGAGTCGGGG - Intronic
1140316199 16:73900233-73900255 ATGACTTTTTAGGACATTGCAGG + Intergenic
1140453601 16:75091184-75091206 TTGTATTTTTAGGAGAGACTAGG - Intronic
1140819073 16:78646598-78646620 TTGTCTTTTTAGTAGAGACTAGG + Intronic
1140936970 16:79681152-79681174 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1141035967 16:80626115-80626137 TTGTATTTTTAGGAGAGTTGGGG - Intronic
1141212608 16:81995192-81995214 ATGGCTTCTGAGGAGTGTGTGGG - Exonic
1141329760 16:83099937-83099959 TTGGCTTTGTAGGACAGTGTGGG - Intronic
1141331173 16:83112489-83112511 ATGTGTTTTTAGGTGTTTGTGGG + Intronic
1142014482 16:87737413-87737435 TTGTATTTTTAGGAGAGTCGGGG - Intronic
1203001979 16_KI270728v1_random:170888-170910 ATGTATTTTTAGTAGAGAGGAGG + Intergenic
1203133583 16_KI270728v1_random:1707294-1707316 ATGTATTTTTAGTAGAGAGGAGG + Intergenic
1203147977 16_KI270728v1_random:1815033-1815055 ATGTATTTTTAGTAGAGAGGAGG - Intergenic
1203152942 16_KI270728v1_random:1853206-1853228 ATGTATTTTTAGTAGAGAGGAGG - Intergenic
1142726149 17:1815870-1815892 TTGTCTTTTTAGGAGAGACGGGG + Intronic
1142907055 17:3050596-3050618 TTGTATTTTTAGCAGAGTCTGGG + Intergenic
1143143862 17:4760416-4760438 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1143477793 17:7212645-7212667 ATTTCTTTTTATAAGAGTTTTGG - Intronic
1143600397 17:7941787-7941809 TTGTATTTTTAGCAGAGTTTAGG - Intronic
1143836203 17:9694928-9694950 ATTTCTTTTTATAAAAGTGTTGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1144855645 17:18266031-18266053 TTGTCTTTTTAGTAGAGTTGGGG - Intronic
1146222102 17:31033120-31033142 ATGTCTTTTTCAGAGAGACTAGG + Intergenic
1146235347 17:31154910-31154932 TTGTATTTTTAGTAGAGTCTGGG + Intronic
1146621481 17:34401896-34401918 CTTTCTTGTCAGGAGAGTGTAGG + Intergenic
1147553782 17:41463530-41463552 TTGTATTTTTAGTAGAGTGGGGG - Intronic
1147798761 17:43066581-43066603 ATGTATTTTTAGTAGAGACTGGG + Intronic
1147805500 17:43127848-43127870 TTGTCTTTTTAGTAGAGTCGGGG - Intergenic
1148370587 17:47096887-47096909 TTGTCTTTTTAGTAGAGTCAAGG - Intergenic
1148546249 17:48521371-48521393 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1149267734 17:54945960-54945982 ATGTTTTATTAGGAGACTCTTGG + Intronic
1149318808 17:55463941-55463963 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
1150705645 17:67484763-67484785 TTGTATTTTTAGTAGAGTCTAGG - Intronic
1151045205 17:70911773-70911795 TTGTATTTTTAGTAGAGTTTGGG - Intergenic
1151212840 17:72557773-72557795 ATGTCTGTGTATGAGTGTGTGGG - Intergenic
1151353670 17:73546064-73546086 AAGGCTTTTCAGGAAAGTGTTGG + Intronic
1151788049 17:76285675-76285697 TTGTATTTTTAGGAGAGAATGGG - Intronic
1151824866 17:76518660-76518682 TTGTATTTTTAGTAGAGAGTAGG + Intergenic
1153543431 18:6181500-6181522 TTGTATTTTTAGTAGAGTGGGGG + Intronic
1154353008 18:13602618-13602640 TTGTATTTTTAGTAGAGTCTGGG + Intronic
1155848889 18:30745156-30745178 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1155966267 18:32038220-32038242 TTGTCTTTTTAGTAGAGAGAGGG + Intronic
1156315332 18:35963961-35963983 TTGTATTTTTAGGAGAGACTGGG - Intergenic
1156383726 18:36587135-36587157 ATGTCTTTTCTGGAGATGGTGGG + Intronic
1157109714 18:44809207-44809229 TTGCCTTTATAGGAGAGTGAAGG - Intronic
1157837329 18:50917797-50917819 TTGTATTTTTAGTAGAGTCTGGG - Intronic
1157840239 18:50950659-50950681 TTGTATTTTTAGAAGAGTGGGGG + Exonic
1158415326 18:57245426-57245448 TTGTCTGTTTGAGAGAGTGTAGG - Intergenic
1158712037 18:59846425-59846447 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
1159208264 18:65281730-65281752 TTGTATTTTTAGTAGAGTTTGGG - Intergenic
1159609075 18:70506845-70506867 ATGTCTTTCTGGGAGAGAGGAGG + Intergenic
1160125170 18:76165152-76165174 ATGTATTTTTAGTAGAGTTGGGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160433923 18:78831844-78831866 ATGTGTGTGTAGGTGAGTGTAGG - Intergenic
1160812465 19:1018811-1018833 TTGTCTTTTTAGTAGAGACTGGG - Intronic
1161034367 19:2076256-2076278 TTGTGTTTTTAGGAGAGAGGGGG - Intronic
1161804494 19:6434734-6434756 TTGTATTTTTAGGAGAGACTGGG - Intergenic
1162720937 19:12662453-12662475 ATGTCTTTTTAGTAGAAAGGGGG - Intronic
1162752248 19:12835933-12835955 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1163484699 19:17578836-17578858 TTGTATTTTTAGTAGAGTCTAGG - Intronic
1164211754 19:23104131-23104153 TTGTATTTTTAGTAGAGTCTGGG - Intronic
1164391982 19:27831993-27832015 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1165010916 19:32845833-32845855 TTGTGTTTTTAGGAGAGAGGGGG - Intronic
1165066700 19:33233626-33233648 ATGAGTGTTTAGGAGTGTGTGGG - Intergenic
1165129966 19:33625687-33625709 TTGTCTTTTTAGTAGAGACTGGG - Intronic
1165204152 19:34169761-34169783 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
1165373644 19:35426204-35426226 TTGTATTTTTAGGAGAGAGGGGG - Intergenic
1165904745 19:39187069-39187091 TTGTATTTTTAGGAGAGACTGGG + Intergenic
1166146277 19:40838250-40838272 AAGTCTTTTAACGAAAGTGTTGG + Intronic
1166150322 19:40868869-40868891 AAGTCTTTTAATGAAAGTGTTGG + Intronic
1166593717 19:44025937-44025959 ACCTCTTTTTAGGAAAGTGAGGG + Intronic
1166601086 19:44094983-44095005 ACCTCTTTTTAGGAGAGCGAGGG + Intronic
1166759192 19:45213770-45213792 ATGTATTTTTAGTAGAGAGAGGG - Intronic
1167849930 19:52193740-52193762 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1167979488 19:53261214-53261236 TTGTATTTTTAGTAGAGAGTGGG - Intronic
1168348949 19:55664888-55664910 TTGTATTTTTAGTAGAGGGTGGG + Intronic
1168634458 19:57984918-57984940 ATGTATTTTTAGTAGAGTTGGGG - Intronic
925372177 2:3354180-3354202 AACTCTTTCTAGGTGAGTGTGGG - Intronic
925435330 2:3832452-3832474 TTGTGTTTGTAGGAGAGTGTTGG + Intronic
925947761 2:8881355-8881377 ATATCATCTTAGAAGAGTGTGGG + Intronic
926439598 2:12874300-12874322 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
926673092 2:15593280-15593302 AAATCGTTTTAGGAGAATGTTGG - Intronic
927506467 2:23618247-23618269 ATGTCTTTGTAGTAGATGGTGGG + Intronic
927594380 2:24383973-24383995 ATGTGTTTTTAGGAGAGACAGGG + Intergenic
928902327 2:36333209-36333231 TTGTCTTTTTAGTAGAGACTGGG + Intergenic
929542579 2:42833808-42833830 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
930658807 2:54033534-54033556 ATTTACTTTTAGGAGAGTGGGGG + Intronic
930925007 2:56806834-56806856 ATGTTTTTATAGGCAAGTGTAGG + Intergenic
931690032 2:64827823-64827845 ATGGCTGTTTAGGAGACTCTGGG - Intergenic
932363930 2:71134595-71134617 ATTTCTTTTTATAAGAGTTTTGG + Intronic
932596707 2:73098188-73098210 TTGTCTTGTGAGGAGAGGGTAGG - Intronic
932617494 2:73243195-73243217 ATTTCTTTTCAGGAGTGTGGAGG + Intronic
932815539 2:74858344-74858366 ATGTAGTTTCAGGACAGTGTGGG + Intronic
933099784 2:78239116-78239138 TTGTCTTTTTAGGAGAGATGGGG + Intergenic
934057261 2:88261798-88261820 ATGTTGTTTTCGGAGAGTGCAGG + Intergenic
934321691 2:91976769-91976791 ATGTATTTTTAGTAGAGAGGAGG + Intergenic
936777254 2:115988674-115988696 ATGGCCTTTTAGGAGAGTTTAGG - Intergenic
937999972 2:127725559-127725581 TTGTATTTTTAGTAGAGTCTGGG - Intronic
938882333 2:135603777-135603799 TTGTATTTTTAGTAGAGTCTGGG + Intronic
939125600 2:138173924-138173946 TTGTATTTTTAGGAGAGAGGGGG - Intergenic
939209475 2:139155132-139155154 ATGTCTTTTTCGGAAACTTTTGG + Intergenic
939572468 2:143856742-143856764 ATCACTTTTTTGGAGAGAGTTGG - Intergenic
939605426 2:144249056-144249078 ATTTCTCTTTATGTGAGTGTAGG + Intronic
939993944 2:148902487-148902509 TTGTATTTTTAGGAGAGTCGGGG + Intronic
941822066 2:169853620-169853642 TTGTATTTTTAGGAGAGATTGGG + Intronic
941940184 2:171027988-171028010 TTGTATTTTTAGTAGAGTGAGGG - Intronic
942446412 2:176081422-176081444 ATGTCTTTATTAGATAGTGTTGG - Intronic
942835321 2:180288889-180288911 ATGCCTTTGTTGGAGAATGTAGG + Intergenic
944326544 2:198412299-198412321 ATTTCCTTTTTGGAAAGTGTAGG + Intronic
944704581 2:202276164-202276186 TTGTGTTTTTAGGAGAGAGGGGG - Intronic
945625859 2:212204988-212205010 TTGTATTTTTAGGAGAGACTGGG + Intronic
945638480 2:212390692-212390714 ATGTCTTTTGAGGAGTGTCCTGG - Intronic
945979980 2:216301759-216301781 ATGTGGTTTTTGGAGAATGTTGG + Intronic
946964421 2:225022505-225022527 ATGTGTGGTTAGGAGAGTGATGG - Intronic
947220010 2:227782787-227782809 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
947342546 2:229155390-229155412 TTGTCTTTTTAGGAGAGACGGGG - Intronic
947383642 2:229569347-229569369 TTGTATTTTTAGTAGAGTCTAGG - Intronic
947419536 2:229929682-229929704 TTGTATTTTTAGTAGAATGTTGG - Intronic
1169198482 20:3695982-3696004 TTGTATTTTTAGTAGAGTGTTGG + Intronic
1169304105 20:4473505-4473527 TTGTCTTTTTAGTAGAGTTGGGG - Intergenic
1169485546 20:6028035-6028057 CTGTCATTTTAGGAGAATTTTGG + Intronic
1169876918 20:10308451-10308473 TTGTATTTTTAGTAGAGAGTAGG + Intergenic
1170600827 20:17840241-17840263 AGGTCTTTCTAGGAAAGTTTAGG + Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171209407 20:23305124-23305146 GTGTCTTGAGAGGAGAGTGTCGG - Intergenic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1172075123 20:32290208-32290230 TTGTATTTTTAGTAGAGCGTGGG - Intronic
1172105393 20:32514317-32514339 TTGAATTTTTAGGAGAGTGGGGG - Intronic
1172432901 20:34907288-34907310 TTGTCTTTTTAGTAGAGTTGGGG + Intronic
1173916348 20:46711043-46711065 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1174123872 20:48288378-48288400 TTGTATTTTTAGGAGAGAGGGGG - Intergenic
1174903338 20:54523773-54523795 ATGTATTTTTAGTAGAGTTGGGG + Intronic
1174948296 20:55013116-55013138 ATTTTTTTTTAGTAGAGTTTGGG - Intergenic
1175805216 20:61824180-61824202 ATGGCTTCTGAGGACAGTGTAGG - Intronic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177672108 21:24245879-24245901 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1178121464 21:29474165-29474187 AGGGCTTGGTAGGAGAGTGTGGG + Intronic
1178837669 21:36112148-36112170 TTGTATTTTTAGGAGAGTTGGGG - Intergenic
1179041185 21:37803523-37803545 GTCTCTTCTTAGGACAGTGTTGG + Intronic
1179048033 21:37864282-37864304 TTGTATTTTTAGGAGAGAGGAGG + Intronic
1179169709 21:38963403-38963425 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
1179676426 21:42985824-42985846 TTGTATTTTTAGGAGAGACTGGG - Intronic
1180309956 22:11160726-11160748 ATGTATTTTTAGTAGAGAGGAGG + Intergenic
1180548435 22:16522536-16522558 ATGTATTTTTAGTAGAGAGGAGG + Intergenic
1180746067 22:18089874-18089896 TTGTATTTTTAGTAGAGTCTGGG + Exonic
1182211018 22:28677763-28677785 ATGTATTTTTAGTAGAGAGGAGG - Intronic
1184297140 22:43532078-43532100 AAGGCTTTTCAGGAGAGAGTAGG - Intronic
1184555577 22:45231076-45231098 ATGTATTTTTAGTAGAGAGATGG - Intronic
1184616892 22:45644592-45644614 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
949813192 3:8030467-8030489 ATGTATTTTTAGGAGAGGTGGGG - Intergenic
950540984 3:13612735-13612757 ATGTCTTTTTGGGTGGTTGTGGG + Intronic
950627058 3:14254984-14255006 ATGTGTTTTAAGGCGTGTGTTGG + Intergenic
950989573 3:17418433-17418455 TTGTATTTTTAGTAGAGTGGGGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951532928 3:23714551-23714573 CTGTCATTTTAGTAGGGTGTGGG - Intergenic
951853655 3:27170557-27170579 TTGTATTTTTAGGAGAGGTTGGG - Intronic
952146095 3:30533629-30533651 TTGTATTTTTAGGAGAGACTGGG - Intergenic
952148822 3:30563679-30563701 GTGTCTTTTTAGGGCAGTATGGG - Intergenic
952817799 3:37460761-37460783 TTGTATTTTTAGTAGAGAGTGGG + Intronic
953170412 3:40501876-40501898 TTGTATTTTTAGGAGAGAGGGGG - Intergenic
953976900 3:47388835-47388857 TTGTCTTTTTAGTAGAGTCTGGG + Intronic
954208490 3:49078862-49078884 ATGTATTTTTAGTAGAGACTGGG + Intronic
954420000 3:50413672-50413694 ATGTATTTTTAGTAGAGTTGGGG - Intronic
955729924 3:61974111-61974133 CTGTCTTTTTTAGAGTGTGTTGG + Intronic
956030445 3:65031318-65031340 ATGTCTGTTTAGGAATGTGGAGG + Intergenic
956415969 3:69029611-69029633 TTTTATTTTTAGGAGAGAGTAGG + Intronic
956939609 3:74142615-74142637 ATGACTCTTTATGAGAGTGAGGG - Intergenic
957216669 3:77328820-77328842 TTGTCATTTTTGGAGAATGTGGG - Intronic
958501500 3:94915551-94915573 TTCTCTTTTTAGGGCAGTGTGGG + Intergenic
958800960 3:98755218-98755240 TTGTCTTTTTAGTAGAGACTGGG + Intronic
960102740 3:113761978-113762000 ATGTATTTTTAGTAGAGTTGGGG - Intronic
960150134 3:114240898-114240920 TTGTATTTTTAGGAGAGATTGGG - Intergenic
960664952 3:120099720-120099742 TTGTGTTTTTAGTAGAGTGAGGG + Intergenic
961883840 3:130082508-130082530 TTGTATTTTTAGTAGAGAGTGGG + Intronic
962545998 3:136436126-136436148 TTGTATTTTTAGGAGAGTCGGGG + Intronic
962796415 3:138853313-138853335 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
963146194 3:141997675-141997697 TTGTATTTTTAGGAGAGTTAGGG - Intronic
963355152 3:144201933-144201955 GTGTAGTTTTAGCAGAGTGTTGG + Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964529609 3:157652935-157652957 ATGTCTCTCTATGAGTGTGTGGG - Intronic
964761672 3:160140429-160140451 TTGTATTTTTAGGAGAGGCTGGG - Intergenic
965542900 3:169888320-169888342 TTGTATTTTTAGTAGAGTATGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
969820934 4:9719791-9719813 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
970134945 4:12912269-12912291 ATATCTTTTTATGAATGTGTCGG - Intergenic
970509024 4:16761969-16761991 TTCTATTTTTAGCAGAGTGTGGG - Intronic
970743133 4:19261720-19261742 ATGTCTTTTTTTCGGAGTGTGGG - Intergenic
970902792 4:21178987-21179009 TTGTGTTTTTAGCAGAGTTTGGG + Intronic
971073712 4:23124690-23124712 ATGTATTTTTAGTAGAGACTGGG - Intergenic
971966384 4:33562527-33562549 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
974066892 4:57086904-57086926 TTGTATTTTTAGGAGAGACTGGG + Intronic
974081499 4:57218379-57218401 CTCTCTTTCTAGGAGAGTATAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974553016 4:63405326-63405348 TTGTATTTTTAGGAGAGACTAGG - Intergenic
975750061 4:77513624-77513646 TTGTCTTTTTAGTAGAGTCGGGG + Intronic
975932360 4:79540228-79540250 TTGTCTTTTGAGAAGAGTGGAGG + Intergenic
976138942 4:81970299-81970321 ATGTATGTAGAGGAGAGTGTTGG - Intronic
977383253 4:96304652-96304674 ATGTCTTTTTTGGAGGGTTTGGG - Intergenic
977720924 4:100239458-100239480 ATCTTTTTTTAGGAGATTGCTGG - Intergenic
977945277 4:102906106-102906128 TTGTATTTTTAGGAGAGAGGGGG + Intronic
978665807 4:111180554-111180576 ATTTCTTTTTATGTGAGTTTTGG + Intergenic
978841197 4:113214925-113214947 ATGTCTTTTGATGACATTGTTGG - Intronic
979126140 4:116974450-116974472 ATGTCTTTTTAGGTGATTACTGG + Intergenic
979874916 4:125876411-125876433 TTGTATTTTTAGCAGAGTGGAGG - Intergenic
980314533 4:131180356-131180378 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
980771284 4:137376974-137376996 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981824411 4:148923872-148923894 ATGTCTTATTAGAAGACTGCTGG - Intergenic
982813372 4:159854850-159854872 ATGTCATGTGAGGAGAGTGCAGG + Intergenic
983730340 4:170985694-170985716 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
985112700 4:186562544-186562566 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
985199733 4:187472707-187472729 ATGTATTTTTAGGAGAGACGGGG + Intergenic
986392145 5:7297169-7297191 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
987419286 5:17699659-17699681 ATGTCTTTCTAGGTGATTATAGG - Intergenic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
989073324 5:37534668-37534690 TTGTATTTTTAGTAGAGTCTAGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989605363 5:43239410-43239432 TTGTATTTTTAGTAGAGTCTGGG + Intronic
989793924 5:45443562-45443584 AAGCATTTTTAGGAAAGTGTAGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991585377 5:68196497-68196519 TTGTATTTTTAGGAGAGAGGGGG + Intronic
991989949 5:72327643-72327665 TTGTATTTTTAGTAGAGAGTGGG + Intronic
992586927 5:78250412-78250434 ATGTCTATTTAGAATAGAGTGGG - Intronic
992929816 5:81631704-81631726 ATGAATTTTTAAGAGAGTGAAGG - Intronic
993986834 5:94607434-94607456 TTGTATTTTTAGTAGAGGGTTGG - Intronic
994825475 5:104708639-104708661 TTGTATTTTTAGGAGAGGTTGGG - Intergenic
995190884 5:109318278-109318300 ATGTCATTTTAGGGGATTATGGG - Intergenic
996251974 5:121346703-121346725 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
996748883 5:126869349-126869371 ATGTCTTCTGAGGAGAGCGCTGG - Exonic
997731466 5:136182463-136182485 ATATCTTTTTAAGAAAATGTGGG - Exonic
997894859 5:137707258-137707280 TTGTATTTTTAGTAGAGAGTGGG - Intronic
997915165 5:137917334-137917356 TTGTATTTTTAGTAGAGTCTGGG + Intronic
998085618 5:139320132-139320154 TTGTATTTTTAGGAGAGAGGGGG - Intronic
998250134 5:140547078-140547100 TTGTATTTTTAGTAGAGTCTAGG + Intronic
998300227 5:141010901-141010923 TTCTCTTTTGAGGAGAGTTTAGG - Exonic
998414744 5:141937996-141938018 TTGTATTTTTAGTAGAGTCTGGG + Intronic
998861793 5:146451493-146451515 CTGTATTTTTAGTAGAGTGGGGG + Intronic
999561078 5:152803555-152803577 GTGTCAGTTTAGGGGAGTGTTGG + Intergenic
1000021866 5:157325186-157325208 ATGGCTTTGTAGGAGAGGGATGG + Intronic
1000248615 5:159471279-159471301 ATGTCATTTTAGCTGAGTTTGGG - Intergenic
1002970669 6:2015190-2015212 AAGTCTTTTTAGCAGATTGATGG - Intronic
1003091653 6:3109000-3109022 ATATCTTTGTAGGAGAGAGAAGG - Intronic
1004233129 6:13850746-13850768 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
1004514499 6:16310659-16310681 TTGTATTTTTAGTAGAGTGGGGG + Intronic
1004584627 6:16987674-16987696 ATGTCATTTTAATAGAGTTTTGG + Intergenic
1004613490 6:17267989-17268011 ATATCTTTTGGGGAGAGAGTTGG + Intergenic
1004851521 6:19704458-19704480 TTGTCTTTTTAGTAGAGATTGGG - Intergenic
1005278488 6:24245020-24245042 TTGTATTTTTAGGAGAGTCAGGG - Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1006891118 6:37429763-37429785 ATGTATTTTTAGTAGAGACTGGG - Intergenic
1007157283 6:39757670-39757692 TTGTATTTTTAGTAGAGTGGAGG + Intergenic
1007853797 6:44833220-44833242 AAGTATTTGTAGGAGAGTTTGGG - Intronic
1008914678 6:56774312-56774334 ATGACTTTTTTAGAGAGTGTTGG - Intronic
1009290595 6:61876491-61876513 ATATTTTTTTAGAAGAATGTAGG - Intronic
1009609794 6:65926942-65926964 TTGTCTTTTTAGTAGAGATTGGG + Intergenic
1009964668 6:70566049-70566071 TTGTATTTTTAGTAGAGTGTTGG + Intergenic
1010789203 6:80045379-80045401 ATATACTTTTAGGAGAGTATCGG + Intergenic
1011576503 6:88806487-88806509 TTGTCTTTTTAGTAGAGAGGGGG + Intronic
1012221105 6:96650539-96650561 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
1012257371 6:97049413-97049435 ATGTCTTGGTAGGACAGAGTGGG + Intronic
1012789267 6:103672994-103673016 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1012883448 6:104817636-104817658 CTGTCTTTGTAGAAGAGAGTAGG + Intronic
1013123721 6:107162775-107162797 ATGTATTTTTAGTAGAGTTGGGG + Intronic
1013204153 6:107931573-107931595 TTGTCTTTTTAGTAGAGAGAGGG - Intronic
1013207643 6:107958759-107958781 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
1013518922 6:110914952-110914974 TTGTCTTTTTAGTAGAGACTGGG - Intergenic
1014407964 6:121074962-121074984 ATTTCTTCTTAAGAGAGTTTTGG - Intergenic
1014470274 6:121804778-121804800 TTGTATTTTTAGGAGAGATTGGG + Intergenic
1014646482 6:123980261-123980283 ATGTCTTTTTTGAAGACTGGAGG + Intronic
1015535817 6:134266440-134266462 TTGTATTTTTAGGAGAGTCAGGG - Intronic
1015596039 6:134868257-134868279 ATGTGTTTTTAAAAGATTGTAGG + Intergenic
1016392805 6:143591913-143591935 ATCTATTTTTAGGAGATTGAAGG + Intronic
1016948208 6:149553820-149553842 TTGTATTTTTAGTAGAGTGGGGG - Intergenic
1017093066 6:150778998-150779020 ATGTGTTTCTAAGAGAGTGCAGG + Intronic
1017095221 6:150798911-150798933 TTGTATTTTTAGGAGAGAGGGGG + Intronic
1019001616 6:168758123-168758145 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
1019202932 6:170333656-170333678 TTGTATTTTTAGTAGAGTCTGGG + Intronic
1020029393 7:4922051-4922073 ATGTATTTTTAGTAGAGAGGGGG - Intronic
1020317817 7:6919048-6919070 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1020898707 7:13975370-13975392 TTGTCTTTTTAGTAGAGTTGGGG - Intronic
1021033024 7:15762398-15762420 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
1021908362 7:25359071-25359093 ATGTGGTTTTAGGAATGTGTAGG + Intergenic
1022020346 7:26394326-26394348 ATGTCTTACTAAGGGAGTGTGGG + Intergenic
1022293974 7:29032368-29032390 GTTTCTTCTTAGGAGAGTGGGGG - Intronic
1022676814 7:32508903-32508925 ATTTCTTCTTAGGAGAGTCTTGG + Intronic
1023278670 7:38547341-38547363 ATGCTTTTTTAGGAGTGTGTTGG - Intronic
1023490346 7:40732915-40732937 ATGTATTTTTAGTAGAGTTGGGG - Intronic
1024299949 7:47879457-47879479 TTGTATTTTTAGTAGAGTGGGGG - Intronic
1024786865 7:52917978-52918000 ATATCTTATTATGAGACTGTGGG + Intergenic
1024790945 7:52964298-52964320 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1025162478 7:56674249-56674271 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1025784947 7:64635709-64635731 GTGTCTTCTTAGTAGAGTGATGG - Intergenic
1025817075 7:64923512-64923534 TTGTATTTTTAGTAGAGTGAGGG + Intronic
1026663154 7:72319979-72320001 TTGTATTTTTAGTAGAGTCTGGG - Intronic
1026803824 7:73417210-73417232 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030381418 7:108815726-108815748 CTGTCTTTTCAGGAGACTCTCGG + Intergenic
1030955353 7:115845062-115845084 ATGTCAGTTTAGGAGAATGTGGG + Intergenic
1032303894 7:130714541-130714563 TTATTTGTTTAGGAGAGTGTGGG + Intergenic
1032344931 7:131108425-131108447 ATGTCATTTTAACAGAGCGTGGG - Intergenic
1033218394 7:139510922-139510944 TTGTATTTTTAGCAGAGAGTGGG - Intergenic
1033351531 7:140566202-140566224 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1033372102 7:140718420-140718442 TTGTATTTTTAGGAGAGAGGGGG + Intronic
1034911237 7:155000637-155000659 AAGTGTTTTTGGTAGAGTGTTGG - Intronic
1035363900 7:158333229-158333251 AGCTCTTTTGGGGAGAGTGTGGG - Intronic
1035949416 8:4003217-4003239 ATGTGTTTTTAGTAGAGAGGGGG - Intronic
1036024781 8:4893910-4893932 ATGTCTTTTTCGCAAAATGTTGG + Intronic
1036094782 8:5711717-5711739 TTGTATTTTTAGTAGAGTCTCGG + Intergenic
1036147461 8:6267746-6267768 TTGTATTTTTAGTAGAGTGGAGG - Intergenic
1036449789 8:8855681-8855703 TTGTATTTTTAGTAGAGAGTAGG - Intronic
1037347459 8:17915249-17915271 ATTTCTTTTGAGGAGCATGTGGG - Intergenic
1037429074 8:18790600-18790622 ATGTTTTTATAGAAGAATGTTGG - Intronic
1038864508 8:31424923-31424945 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
1038940296 8:32296940-32296962 TTGTATTTTTAGTAGAGTGGGGG - Intronic
1039318549 8:36401311-36401333 ATGTATTTTTAGGAGAGACGCGG + Intergenic
1039495952 8:37980300-37980322 TTGTATTTTTAGTAGAGTTTGGG + Intergenic
1039561711 8:38517594-38517616 TTGTATTTTTAGTAGAGTCTAGG + Intronic
1039857073 8:41424712-41424734 TTGTCTTTTTAGTAGAGACTGGG - Intergenic
1040775696 8:51040669-51040691 ATGTCTTTTCAGAAGATTGGAGG - Intergenic
1040940901 8:52832224-52832246 ATTTCTTTTCATGAGTGTGTTGG + Intergenic
1041340285 8:56838513-56838535 TTGTATTTTTAGGAGAGACTGGG + Intergenic
1041494218 8:58468368-58468390 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1042313022 8:67397232-67397254 TTGTATTTTTAGGAGAGAGGGGG + Intergenic
1042529743 8:69802776-69802798 GTCTCTTTGTAGGAGAGTGGTGG - Intronic
1043387051 8:79758851-79758873 ATGTCTTCAGAGGAGAGTGGGGG + Intergenic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1044040967 8:87367987-87368009 TTGTCTTTTTAGGAAAGATTGGG - Intronic
1044130413 8:88516701-88516723 ATGTATTTCTAGCAGAATGTTGG + Intergenic
1044643547 8:94413325-94413347 ATGTCTTTTTTGGAGAGGAAGGG - Intronic
1045047958 8:98296734-98296756 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1045390035 8:101706024-101706046 ATGTCTGTTTAGGAGAGTAAAGG + Intronic
1045698207 8:104835235-104835257 TTGTATTTTTAGTAGAGTCTGGG - Intronic
1045751013 8:105483906-105483928 TTGTATTTTTAGTAGAGAGTGGG + Intronic
1046523749 8:115358457-115358479 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
1046922538 8:119747949-119747971 TTGTATTTTTAGTAGAGAGTGGG - Intronic
1047041445 8:121001315-121001337 ATGTGTTTTAGGGAGAATGTAGG + Intergenic
1047131011 8:122019264-122019286 TTGTATTTTTAGGAGAGACTGGG + Intergenic
1047841388 8:128757119-128757141 TTGTATTTTTAGGAGAGACTGGG - Intergenic
1047864214 8:129003988-129004010 ATGTATTTTTAGTAGAGACTGGG + Intergenic
1049854029 8:144850433-144850455 ATGTTTCTATAGGTGAGTGTTGG - Exonic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050328935 9:4525457-4525479 TTGTCTTTTGAGGAGGGGGTTGG - Intronic
1050423190 9:5488113-5488135 ATGTCTTTATTGTAGAGTGTTGG + Intergenic
1050432026 9:5571859-5571881 GTGTCTTTTTCAGAGAGTTTGGG - Intergenic
1050503531 9:6323653-6323675 ATGTAATTCAAGGAGAGTGTTGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051053552 9:12957528-12957550 TTGTATTTTTAGTAGAGTGGGGG + Intergenic
1051241427 9:15061162-15061184 TTGTATTTTTAGGAGAGTTGGGG - Intergenic
1051812365 9:21064367-21064389 ATTGCTTTTTAGAAAAGTGTAGG - Intergenic
1052124861 9:24762877-24762899 ATGTCTTTTTATTAGAGACTAGG + Intergenic
1052280600 9:26729174-26729196 ATGTCCTTTTAAGAGGGAGTTGG - Intergenic
1052531383 9:29688856-29688878 TTGTCTTTTTAGTAGAGACTGGG - Intergenic
1052579151 9:30331561-30331583 ACATCTTTTTAGGAGTGGGTTGG - Intergenic
1052621935 9:30923492-30923514 ATTTATTTTTAAGTGAGTGTGGG + Intergenic
1052622964 9:30937697-30937719 ATGTGTTTTTAGCAGAGGGAAGG + Intergenic
1053335974 9:37271740-37271762 TTGTATTTTTAGGAGAGTCGAGG + Intronic
1053427620 9:38021163-38021185 TTGTGTTTTTAGGAGAGACTGGG - Intronic
1054843294 9:69765689-69765711 TTGTATTTTTAGCAGAATGTTGG - Intergenic
1055154328 9:73041880-73041902 TTGTATTTTTAGGAGAGACTAGG + Intronic
1055513420 9:77016230-77016252 GTGTCTGTTTTGGAGAGTGGCGG - Intergenic
1055633990 9:78256335-78256357 ATCTCATTTCAGGAGAGTGAAGG - Intronic
1055685828 9:78773693-78773715 ATCTCTTTTTAGAGGAGTGAGGG - Intergenic
1055710206 9:79052287-79052309 AGCTCTTTTGAGGTGAGTGTGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058398492 9:104585088-104585110 ATTTCTTTTTAGGAAAGAGGAGG + Intergenic
1059297013 9:113280197-113280219 ATTTGTTATTAGGAGAGTGAAGG - Intronic
1059886177 9:118747147-118747169 TTGTATTTTTAGTAGAGTTTGGG + Intergenic
1061794213 9:133075146-133075168 TTGTATTTTTAGTAGAGTTTGGG - Intronic
1185983460 X:4805119-4805141 AGGTCTTTTGAGGTGGGTGTTGG + Intergenic
1186193153 X:7085830-7085852 AAGTCTTTATAGGCCAGTGTGGG - Intronic
1189441455 X:41039809-41039831 TTGTATTTTTAGGAGAGTTGGGG + Intergenic
1189592742 X:42532412-42532434 ATGTCTTTTTGGTAGATTGATGG + Intergenic
1191592954 X:62909044-62909066 ATGTCTTTATAGGTGAATTTTGG + Intergenic
1192235569 X:69293520-69293542 TTGTATTTTTAGTAGAGTCTGGG - Intergenic
1192925778 X:75753622-75753644 ATCTCTTTTGAGGTGAGTGGTGG - Intergenic
1193388430 X:80897819-80897841 TTGTATTTTTAGTAGAGAGTGGG - Intergenic
1193575293 X:83187739-83187761 ATGTATTTTTAGTAGAGAGAGGG + Intergenic
1194083101 X:89492167-89492189 TTGTATTTTTTGGAGGGTGTGGG - Intergenic
1194157999 X:90416574-90416596 GTGTCTTTGCAGGAGGGTGTCGG + Intergenic
1195012699 X:100748856-100748878 TTGTATTTTTAGTAGAGTTTGGG - Intergenic
1195121276 X:101755466-101755488 TTGTATTTTTAGGAGAGAGGGGG + Intergenic
1195955427 X:110324167-110324189 ATGTATTTTTAGTAGAGTCGAGG + Intronic
1196055360 X:111349493-111349515 CTAACTTTTCAGGAGAGTGTAGG + Intronic
1196200760 X:112883213-112883235 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1196309687 X:114149187-114149209 TTGTATTTTTAGTAGAGTCTGGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196735587 X:118978452-118978474 ATGGGTTTTAAGGTGAGTGTGGG + Exonic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200435753 Y:3148030-3148052 TTGTATTTTTTGGAGGGTGTGGG - Intergenic
1200504324 Y:3993543-3993565 GTGTCTTTGCAGGAGGGTGTCGG + Intergenic
1201295719 Y:12461656-12461678 TTGTATTTTTAGGAGAGTCAGGG + Intergenic
1201315047 Y:12636202-12636224 TTGTATTTTTAGTAGAGAGTGGG + Intergenic
1201433955 Y:13936609-13936631 ATATCTTTTTAGTAGAGTGGGGG - Intergenic
1201565079 Y:15357275-15357297 AAGTCTTTATAGGCCAGTGTAGG - Intergenic