ID: 1105291266

View in Genome Browser
Species Human (GRCh38)
Location 13:19055251-19055273
Sequence CTGTGGGATTCTCACTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105291266_1105291272 19 Left 1105291266 13:19055251-19055273 CCTCCTCAGTGAGAATCCCACAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 1105291272 13:19055293-19055315 ACCCCCAACACCTCCACCCCAGG 0: 1
1: 0
2: 7
3: 52
4: 541
1105291266_1105291277 25 Left 1105291266 13:19055251-19055273 CCTCCTCAGTGAGAATCCCACAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 1105291277 13:19055299-19055321 AACACCTCCACCCCAGGTACCGG 0: 1
1: 0
2: 0
3: 20
4: 145
1105291266_1105291270 -4 Left 1105291266 13:19055251-19055273 CCTCCTCAGTGAGAATCCCACAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 1105291270 13:19055270-19055292 ACAGAATCAGCTCCTTTGCATGG 0: 1
1: 0
2: 6
3: 84
4: 755
1105291266_1105291278 26 Left 1105291266 13:19055251-19055273 CCTCCTCAGTGAGAATCCCACAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 1105291278 13:19055300-19055322 ACACCTCCACCCCAGGTACCGGG 0: 1
1: 0
2: 2
3: 32
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105291266 Original CRISPR CTGTGGGATTCTCACTGAGG AGG (reversed) Intergenic
900640666 1:3686701-3686723 CTGTGGCCATCTGACTGAGGTGG + Intronic
902719208 1:18292837-18292859 CAGTGAGATTCCCTCTGAGGAGG - Intronic
902782263 1:18712284-18712306 CTGAGCGTTTCCCACTGAGGTGG - Intronic
904130595 1:28272682-28272704 CTGTGGCATCCTCCCTGAGGGGG + Exonic
905544990 1:38790551-38790573 CTGTGGGATCCTCAGTAAGCTGG - Intergenic
908119080 1:60968675-60968697 CTGTGAGGTTCTCAATGAGCTGG + Intronic
913001502 1:114585038-114585060 CTAGGGGAATCTCACTTAGGAGG - Exonic
914880820 1:151545335-151545357 CTCTGGGAATCTGACTAAGGTGG + Intronic
914996328 1:152546252-152546274 CTGTGGGCCTTTCACTGGGGAGG - Intronic
916287794 1:163129957-163129979 CTGTGGAATCCTCAAGGAGGGGG - Intronic
920493229 1:206435264-206435286 TTGAGGGTTTCTCAGTGAGGAGG - Intronic
1063853781 10:10223421-10223443 CTGTGTGTTTCTGACTGTGGAGG + Intergenic
1066037577 10:31508748-31508770 CTGTGGCCTTCTTACTGGGGAGG + Intronic
1070036705 10:72732580-72732602 CTGTGGGAATCTGATTGAGCAGG + Intronic
1070734593 10:78854817-78854839 CTATGGGATCCTCTTTGAGGAGG - Intergenic
1071318432 10:84427138-84427160 ATGAGTGATTCTTACTGAGGAGG + Intronic
1071517445 10:86308101-86308123 CTGCAGAATTCACACTGAGGTGG - Intronic
1072620440 10:97075757-97075779 CTGAGGGATCCTGACTCAGGAGG - Intronic
1077137965 11:1010941-1010963 TTGTGGGAGTGTCACTGAGATGG + Exonic
1078357044 11:10640208-10640230 CTGTAGGCATCTCACTGGGGAGG + Intronic
1079262940 11:18901030-18901052 CTGTGGGAGTTTCTCTCAGGTGG - Intergenic
1080474949 11:32581741-32581763 CTGTGGGCTGGGCACTGAGGTGG + Intergenic
1080687118 11:34524871-34524893 CAGTGTCCTTCTCACTGAGGAGG - Intergenic
1081007411 11:37762807-37762829 CTTTGGGATTCTGAGTCAGGTGG - Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086450196 11:86907952-86907974 CTGCGTGATTCCCACTGACGAGG - Intronic
1088581739 11:111323243-111323265 CTCCGGGATTCTCACTCGGGAGG + Intergenic
1089061458 11:115629462-115629484 ATGTGGCATTGTCACTGATGTGG + Intergenic
1090534316 11:127624181-127624203 CTGTGGGATTCCCAGTGTAGAGG + Intergenic
1094183544 12:27616790-27616812 CTTTGAGATTCTCAGTGTGGGGG + Intronic
1096137487 12:49214684-49214706 CTTTGGGAGACTGACTGAGGTGG - Intronic
1096370883 12:51068018-51068040 CTCTGGGATGGTCACTGAGGAGG - Intronic
1098012029 12:66063256-66063278 GTGTGGTATTCACAATGAGGGGG - Intergenic
1099230093 12:80013838-80013860 CTGTGGGATGCTCAATGATCTGG + Intergenic
1101431745 12:104632799-104632821 CTGTGGGCTCCTCCCGGAGGAGG - Intronic
1102882350 12:116495346-116495368 CTGTGGGAATGTCCCTGTGGAGG - Intergenic
1103440708 12:120960740-120960762 CTATGGGATTCTCATGTAGGTGG + Intergenic
1104871379 12:132000337-132000359 GTATGGGATTCTCACTGACCTGG + Intronic
1105291266 13:19055251-19055273 CTGTGGGATTCTCACTGAGGAGG - Intergenic
1105693314 13:22863715-22863737 CTGATGGATTTTCACTGAGATGG + Intergenic
1106101106 13:26695684-26695706 CTGTGGCTTTCACACTTAGGTGG + Intergenic
1107254396 13:38406183-38406205 TTTTAGGAATCTCACTGAGGTGG + Intergenic
1110417928 13:75272338-75272360 CTGTGGGCACCTCACTGAAGTGG - Intergenic
1111480861 13:88824423-88824445 CTGGGGAATCCTCACTGAGAAGG + Intergenic
1113407506 13:110055273-110055295 CTGTGGTTTCCTCACTGAGCAGG - Intergenic
1115138469 14:30140546-30140568 CTGTGTAGTTCTCATTGAGGGGG - Intronic
1116807580 14:49508853-49508875 CTTTGGGAGGCTGACTGAGGCGG + Intergenic
1117304810 14:54462938-54462960 TTGTGGGATTCTGACTGATATGG - Intergenic
1121319240 14:92981466-92981488 CTGTGGGGCTCTCGCGGAGGTGG - Intronic
1122543908 14:102511826-102511848 CTCTGGGATCCCCAGTGAGGAGG - Intergenic
1123128831 14:105969413-105969435 CTGTGGGCTTTTCAGTGAGAGGG - Intergenic
1124393440 15:29280276-29280298 CTGGGGGCTCCTCACTCAGGGGG - Intronic
1125475725 15:40046949-40046971 CTGTGGGTCTGTCACAGAGGTGG - Intergenic
1125520296 15:40344634-40344656 CTGTGGGCTTCTCCCCGGGGTGG - Intergenic
1125727107 15:41873760-41873782 CTGTGGGACTCTCAGGGAGGCGG - Intronic
1126518202 15:49558467-49558489 CAGTGGGCCTTTCACTGAGGAGG - Intronic
1127141313 15:55980450-55980472 CTGTGGGATTCTCACATATCAGG - Intronic
1127619182 15:60716709-60716731 GGGTGGGACTCTCTCTGAGGAGG - Intronic
1127963719 15:63908573-63908595 CTGTGAGAGTGACACTGAGGAGG - Exonic
1130447580 15:84017816-84017838 CTGTGAGCTTCTCAAGGAGGAGG - Intronic
1130826577 15:87553298-87553320 CTTTGGGAGGCTGACTGAGGCGG - Intergenic
1132914489 16:2335633-2335655 CCGTGGCATCCTGACTGAGGAGG + Intronic
1132994936 16:2817890-2817912 CTGTGGGATTCCCACGTATGCGG + Exonic
1133030570 16:3008880-3008902 CAGTGGGTTGGTCACTGAGGTGG + Intergenic
1134636393 16:15795058-15795080 CTTTGGGAGGCTGACTGAGGTGG + Intronic
1134677754 16:16102529-16102551 CTGTGGTCTCCTCACTGAAGTGG + Intronic
1134692426 16:16199662-16199684 CTGTGTGACTCACACTGAGCTGG + Intronic
1134979418 16:18595014-18595036 CTGTGTGACTCACACTGAGCTGG - Intergenic
1135717107 16:24781164-24781186 CTCAGGGAGACTCACTGAGGTGG - Intronic
1136112021 16:28069508-28069530 CTGGGGGACCCTCACTGATGAGG + Intergenic
1137656805 16:50166722-50166744 CTGTGGGATGCTGACTGAGGTGG - Intronic
1140213893 16:72992301-72992323 CTGTAGGATCCTCGCTGTGGGGG - Intronic
1141358804 16:83375347-83375369 CTGTGTGATTCTCTTTAAGGAGG + Intronic
1144753232 17:17664462-17664484 CTCTGGGAGTCACTCTGAGGAGG + Intergenic
1145264931 17:21375349-21375371 CTGCAGGATTCTAACCGAGGAGG - Intergenic
1148651865 17:49255898-49255920 GTGGGCGATTCTGACTGAGGGGG + Intergenic
1148799279 17:50213125-50213147 CTGGGGCATTGTCAATGAGGAGG - Intergenic
1148984594 17:51610706-51610728 CTGTGGGCCTCTGACTGCGGTGG - Intergenic
1150287327 17:63961681-63961703 CTGGAGGGTGCTCACTGAGGCGG - Intronic
1155847210 18:30723096-30723118 CTCTTGGCTTCTCTCTGAGGAGG - Intergenic
1158865911 18:61637390-61637412 CTGAGGGCTTTTCACTGAGATGG + Intergenic
1159621394 18:70643120-70643142 CTATGTGATTCTTTCTGAGGTGG + Intronic
1160248906 18:77184219-77184241 CTGTGGGACTCACTCTGAAGTGG + Intergenic
1168126722 19:54288065-54288087 CTGTGGGTTTGTCACGCAGGGGG - Intergenic
1168347871 19:55659700-55659722 CTGTGGGACTCTCTTCGAGGGGG + Intronic
929589661 2:43136573-43136595 GTGTGTGATTCTGACAGAGGGGG + Intergenic
930208271 2:48609703-48609725 CTTTGGGATTTTGACTGGGGTGG + Intronic
932413926 2:71562638-71562660 CTGTGGGACTCCCAGGGAGGAGG + Intronic
935296692 2:101656153-101656175 GTGGGGGACTCACACTGAGGGGG - Intergenic
937112413 2:119376853-119376875 CTGTGGGCTCCTCACAGACGAGG - Intergenic
937904833 2:127047947-127047969 CTGTGGCTTTCTTACTGAGATGG - Intergenic
938824515 2:134991712-134991734 CTGTGGAATTCACACAGAGGTGG + Intronic
939950860 2:148470319-148470341 CTGTGGGATGCTCAGTCAGTCGG + Exonic
940215665 2:151300935-151300957 CTGTGGGATGCTCAGAGAGCTGG + Intergenic
941824797 2:169883196-169883218 CTGAGGGCTTCACACTGAGACGG + Intronic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
945310781 2:208309907-208309929 CTGTAATATTCTCACTGAGTAGG - Intronic
946091980 2:217235006-217235028 GTGTGAGATTCTCACTGGTGTGG + Intergenic
949059261 2:241947349-241947371 GCGTGGGTTTTTCACTGAGGTGG - Intergenic
1168818880 20:760361-760383 CTTTCGGATTCTCAGTGTGGAGG - Exonic
1169053271 20:2598348-2598370 GTGTAGGATTCTGACTGAGAGGG + Intronic
1169413984 20:5400044-5400066 CTGTGTAATTCTCACTGGGCAGG - Intergenic
1171462139 20:25304145-25304167 CTGTGCGGCCCTCACTGAGGTGG + Intronic
1176045780 20:63091961-63091983 CTGTGGGGTGCTCTGTGAGGAGG - Intergenic
1176197341 20:63843603-63843625 CTGTGGGATCCTCAGGCAGGAGG - Intergenic
1177184834 21:17781763-17781785 CTAGGGGATTGTCACTGAGAGGG + Intergenic
1180076400 21:45465549-45465571 CTGTGTGAGTCTTACTGAGGTGG + Intronic
1180142881 21:45902925-45902947 CTGTGTGATTCCCACTGTGGGGG + Intronic
1182600016 22:31454954-31454976 CTGTGAGATTCTCAAAGAGGTGG + Intronic
1182670657 22:31992909-31992931 CTTTGGGAGGCTGACTGAGGGGG + Intergenic
1184406988 22:44305874-44305896 CTGGGGGATTCTGCATGAGGAGG + Intronic
1184885913 22:47344418-47344440 CTGAGGGCTTATCACTGAAGGGG - Intergenic
949361353 3:3235463-3235485 CAGTGGGATTCCAAATGAGGAGG - Intergenic
949746428 3:7298699-7298721 CTGGGGGATTCTCACGGACTGGG - Exonic
950146721 3:10655388-10655410 CTGGGGGATTCTGATTGAGCAGG - Intronic
950463840 3:13141663-13141685 CTGAGGGATACCCAGTGAGGAGG - Intergenic
951277098 3:20701026-20701048 CTTTGGGATTATCACTGGGTTGG + Intergenic
951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG + Intronic
952331883 3:32371117-32371139 CTTTGGGAGCCTGACTGAGGTGG + Intergenic
953559236 3:43971887-43971909 CTGTGGGTGTCTCACTCTGGGGG - Intergenic
955928957 3:64036650-64036672 CTGGAGGATTGTCACTCAGGGGG - Intergenic
959459220 3:106604255-106604277 CTGTGGTAGTCTCCCTGGGGAGG + Intergenic
961516365 3:127439880-127439902 CTATGGGAATCGCACTGAGTAGG + Intergenic
961866706 3:129958694-129958716 CTGTAGGATTGGAACTGAGGTGG + Intergenic
962283139 3:134066933-134066955 CTGAGAGTTTCTGACTGAGGCGG + Intronic
962810018 3:138951603-138951625 CCGTGGGATGCTCTCAGAGGCGG + Exonic
964531267 3:157670605-157670627 CTGTGTGATTCTAGCTGTGGAGG + Intronic
965386329 3:168050464-168050486 CTTTGAGAATTTCACTGAGGTGG + Intronic
966892283 3:184416194-184416216 CTGTGGGCGTATCAGTGAGGGGG + Intronic
968700252 4:2053113-2053135 CTTTGGGGTTCTCACTTATGTGG + Intergenic
971480536 4:27110708-27110730 CTCTGGGAATCCCACTCAGGAGG - Intergenic
977890938 4:102310382-102310404 CTGTGTGATTCTCAATGAGAAGG + Intronic
979433702 4:120663437-120663459 CTGTGGCATCCTCACTCAGTTGG - Intergenic
980108842 4:128615212-128615234 CTGTGGGCCTGTCTCTGAGGAGG - Intergenic
986414168 5:7511642-7511664 CAGGGGGATTCTCTCTGGGGAGG + Intronic
986934387 5:12865416-12865438 CTGTGTGATTCTCAAAGAGTTGG + Intergenic
987158930 5:15119902-15119924 TTGTGTGATTCTCAATGATGTGG + Intergenic
988840836 5:35082088-35082110 AGGGGAGATTCTCACTGAGGTGG - Intronic
989350844 5:40484812-40484834 CTGTGTGAATCTCTCTGAAGAGG + Intergenic
993272116 5:85809757-85809779 CAGTGGGATTCCAAATGAGGGGG + Intergenic
999734024 5:154499169-154499191 CTGTGGGTTTCTCACAGCTGGGG - Intergenic
1001794800 5:174493027-174493049 CTGGGGAAGCCTCACTGAGGTGG - Intergenic
1005189855 6:23208742-23208764 CTGTGGCGTTCTAAATGAGGGGG - Intergenic
1006526152 6:34606875-34606897 CTGGGTGATTCTCAGTGTGGAGG - Exonic
1006650716 6:35549041-35549063 CTTTGGGAGTCTGAGTGAGGAGG - Intergenic
1007136160 6:39524025-39524047 CTGTGCTATTCTAAATGAGGTGG - Intronic
1011238334 6:85242575-85242597 CTGGGGGAGTCTCACTAAGTGGG - Intergenic
1013156992 6:107501794-107501816 CTTTAGGAATATCACTGAGGAGG - Intronic
1018062991 6:160104903-160104925 CTGTGCGTTTCTCACTGGGTGGG - Exonic
1018339146 6:162831036-162831058 CTATGGGATTCTCACAGAAGAGG - Intronic
1018344478 6:162886527-162886549 CAGTGGGACTCTCATTGATGTGG + Intronic
1019176553 6:170162231-170162253 CTGTGGGGTTCTGAGTGGGGGGG - Intergenic
1022252197 7:28619514-28619536 GTGTGGTTTTCTCACTGAAGAGG - Intronic
1023103264 7:36739981-36740003 CTGTGGAAATCTCACTGGGGAGG + Intergenic
1028041347 7:86058459-86058481 CTGTGGGCTTTTCACTGAGGAGG + Intergenic
1028440813 7:90858417-90858439 GTATGAGATTCTCACTGAAGTGG + Intronic
1032784215 7:135187753-135187775 ATGTGGGATGCTCAGTGAAGAGG - Intronic
1035228272 7:157445449-157445471 CTGTGGGGCTCTGACTGGGGCGG + Intergenic
1035330906 7:158096880-158096902 CTGGGAGTTTCTCACTGCGGGGG + Intronic
1035344673 7:158190435-158190457 CTGTGGGAGTCTCTCTGTGTGGG - Intronic
1036709134 8:11067176-11067198 CTGAGTCATTCTGACTGAGGAGG + Intronic
1038068880 8:23991833-23991855 CTGTGGTATAGTTACTGAGGGGG + Intergenic
1038454541 8:27664076-27664098 CTCTGGAAATTTCACTGAGGTGG + Intronic
1042902715 8:73745874-73745896 CTCTGGGATTCTTAGGGAGGCGG - Intronic
1043044567 8:75305450-75305472 CTGAAGGATGTTCACTGAGGAGG + Intergenic
1043715058 8:83472589-83472611 CAATGGAATTCTCACTGAGAGGG + Intergenic
1045034241 8:98165100-98165122 CCGTGAGATGCTCACTGAGCAGG - Intergenic
1046761415 8:118025268-118025290 CTGTGGGCTTCACCATGAGGAGG + Intronic
1048363826 8:133721000-133721022 TTCAGGGATTCTCACTGAGGAGG + Intergenic
1048888212 8:138925415-138925437 CTGTGAAGTTCTCCCTGAGGAGG - Intergenic
1049431824 8:142568940-142568962 CTGTCGGATACAGACTGAGGAGG - Intergenic
1051157638 9:14168402-14168424 CTGAAGAAGTCTCACTGAGGAGG + Intronic
1051553336 9:18355113-18355135 CTGGGAGACCCTCACTGAGGAGG + Intergenic
1051870283 9:21728948-21728970 CTGTGGCAGTCTCACCGTGGGGG + Intergenic
1054788611 9:69234086-69234108 CTGTGAGTCTCTCACAGAGGTGG - Intronic
1055822262 9:80280350-80280372 CTGTTGGATTATCAATAAGGTGG + Intergenic
1056482040 9:87015803-87015825 CTGTGTCAGTCTCACTGAGAAGG + Intergenic
1057270359 9:93646910-93646932 CTGTGGGGTTCTTACTGAGGAGG + Intronic
1057308896 9:93929077-93929099 CTGTGGCATACTGACTTAGGTGG - Intergenic
1059046602 9:110875510-110875532 CGGTGGGGTTCTCACTGCGCTGG + Exonic
1060228706 9:121811802-121811824 CTGTGTGAACCTCACTGAGTTGG + Intergenic
1062287371 9:135779124-135779146 CTGTGGGACTCTCAGGGTGGAGG - Intronic
1185505091 X:627440-627462 CTGTGGGATGAGCACGGAGGCGG - Intronic
1185706212 X:2267982-2268004 TTGTGGGATACTCAGTGAAGAGG - Intronic
1188444210 X:30239779-30239801 CTGTGGGATCCCCACTGATAGGG - Intergenic
1188445447 X:30249377-30249399 CTGAGGGATCCCCACTGATGAGG - Intronic
1191227096 X:58054910-58054932 CTCTAGGCTTTTCACTGAGGAGG - Intergenic
1192430432 X:71107834-71107856 TTGGGGGAATCTCACTGACGAGG + Exonic
1192946504 X:75969323-75969345 CTGTGGCCTGCTCACTGGGGTGG + Intergenic
1196986824 X:121282548-121282570 CTGTGTGAGTATCACTGGGGAGG + Intergenic
1197089839 X:122523507-122523529 CTGTGGGCCTTTCACTGGGGAGG - Intergenic
1197325066 X:125082642-125082664 CAGTGGCCTTCTCTCTGAGGAGG - Intergenic
1199533881 X:148880153-148880175 CTGTAGGATTCCCAGTGAGGTGG + Intronic
1200079386 X:153568340-153568362 CTGTGGTATTGTCACTGATGTGG + Intronic
1200934763 Y:8728673-8728695 CTGTGGGGCTCTCTCTCAGGTGG - Intergenic
1201345766 Y:12982946-12982968 CTTTGGGATCCTCACTGCAGAGG - Intergenic