ID: 1105291345

View in Genome Browser
Species Human (GRCh38)
Location 13:19055661-19055683
Sequence AACAGGGAAATGCCCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105291345_1105291349 1 Left 1105291345 13:19055661-19055683 CCTGTCCTGGGCATTTCCCTGTT 0: 1
1: 0
2: 1
3: 49
4: 333
Right 1105291349 13:19055685-19055707 AGTGTTTTCCCTCCCCGTGCCGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105291345 Original CRISPR AACAGGGAAATGCCCAGGAC AGG (reversed) Intergenic
900373183 1:2341328-2341350 AGCAGGGTGATGCCCAGGAAGGG - Intronic
901353453 1:8620367-8620389 AACTGGGAAAAGCAGAGGACAGG - Intronic
901422970 1:9163228-9163250 AGCAGGGCAAGGCCCAGGAGAGG + Intergenic
901796172 1:11680903-11680925 AACAGCGGGATGCCCAGGGCCGG + Intronic
902222790 1:14977465-14977487 CACAGGTCAGTGCCCAGGACAGG - Intronic
902986020 1:20154594-20154616 AGTGGGGAAATTCCCAGGACCGG - Intergenic
903546061 1:24124122-24124144 AGGAGGGGAATGGCCAGGACAGG + Intronic
905486392 1:38299896-38299918 GGCAGGGCATTGCCCAGGACAGG + Intergenic
905999773 1:42414397-42414419 GACAGGGATCTGCCCAGGAGGGG - Intronic
907076735 1:51585880-51585902 AAAAGGGTAATGGCCAGGAGCGG + Intronic
907309207 1:53529760-53529782 AACAGGCAGAGGCCCAGGGCGGG - Intronic
908537999 1:65096286-65096308 AACAAAGAAAAGCCCAGGACCGG - Intergenic
908780942 1:67689043-67689065 AACAGGGAAGTGGCCAGGCAAGG + Intergenic
910683047 1:89887470-89887492 ACCAGGACAATGGCCAGGACAGG - Intronic
911852331 1:102835481-102835503 AACAGGGTAGTGGCCTGGACTGG - Intergenic
914443766 1:147731453-147731475 AAAAAGAAAAAGCCCAGGACTGG - Intergenic
915001192 1:152593846-152593868 ATCAAAGAAACGCCCAGGACTGG - Intronic
915267788 1:154731391-154731413 AATAGGGACCTGCCCTGGACTGG + Intronic
915698118 1:157765312-157765334 AACAAAGAAAAGCCGAGGACTGG + Intronic
916986257 1:170194640-170194662 AGTAGAGAAAAGCCCAGGACTGG - Intergenic
917014769 1:170517807-170517829 AACAGGGATATTCCAAGGAAAGG - Intergenic
917085578 1:171302308-171302330 AACAAAGAAAAGCCCAGGGCTGG + Intergenic
917131878 1:171751455-171751477 AACAGGGAAATTCTCAGAATAGG + Intergenic
917991347 1:180382572-180382594 AACAAAGAAAAGTCCAGGACTGG + Intronic
920454271 1:206086327-206086349 AACAGGAAAATGCTCAGTAGAGG - Intronic
920602502 1:207342820-207342842 GACAAAGAAAAGCCCAGGACTGG - Intronic
922011966 1:221597799-221597821 AACAGAGAATTGCCCAGCACTGG - Intergenic
922242213 1:223763111-223763133 AACAGGGAAGTGGCCAGGTATGG - Intronic
924382583 1:243478068-243478090 AAGAGGGAAATCCCTAGGCCAGG - Intronic
924442728 1:244099873-244099895 AACCGTGAAATACCCAGCACAGG + Intergenic
924772068 1:247087645-247087667 GACAAGGCAATGGCCAGGACAGG + Intergenic
1062979612 10:1710970-1710992 AACATGGAAATGCAGAGCACAGG - Intronic
1063015816 10:2076174-2076196 ACTAGGGAGATGCACAGGACTGG - Intergenic
1063584319 10:7337692-7337714 TACAAAGAAATACCCAGGACTGG - Intronic
1064181040 10:13115948-13115970 AAGAGGGAACTGCCAAGGAAAGG + Intronic
1064831494 10:19472525-19472547 AACAAAGAAAAGCCCAGGACTGG - Intronic
1065389522 10:25168483-25168505 GAAAGGAAAATGCCCAGGATTGG + Intergenic
1065766881 10:29038501-29038523 AAAAGGAAAATGCTCAGTACAGG - Intergenic
1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG + Intergenic
1067840511 10:49673647-49673669 AACAAAGAAAAGCCCAGGACTGG + Intergenic
1068023415 10:51613142-51613164 AACAAAGAAGAGCCCAGGACTGG - Intronic
1068888343 10:62121255-62121277 AACAAAGAAAAGCCCAGGATTGG - Intergenic
1069262679 10:66418387-66418409 AACAAAGAAAAGCCCAGGTCTGG + Intronic
1070714771 10:78711404-78711426 AATAAAGACATGCCCAGGACTGG - Intergenic
1071400076 10:85260342-85260364 AAGAGGGAAATGCCAAAGAGTGG + Intergenic
1071518623 10:86315386-86315408 AGCAGAGAAAAGCCCAGGGCAGG + Intronic
1072746283 10:97941350-97941372 AAGAAGAGAATGCCCAGGACTGG - Intronic
1072797413 10:98366510-98366532 GAGATGGAAATGACCAGGACGGG + Intergenic
1073074415 10:100814846-100814868 AAGAGGGAAGTGCCCAAGGCAGG + Intronic
1073075323 10:100821925-100821947 AAAAGAGAAAGGCCCAGGACAGG - Intronic
1073245687 10:102088486-102088508 AAGAGGGAAATTCCCAGGGGTGG - Intergenic
1073583652 10:104688869-104688891 GACAAGGAGATGCCCAGGGCAGG + Intronic
1074058219 10:109941930-109941952 CAATGGGAAATGCCCAAGACTGG - Intronic
1074417185 10:113277081-113277103 AACAAAGACATGCCCAAGACTGG - Intergenic
1074417408 10:113279379-113279401 AACAGGGAATTGACCAGCCCGGG + Intergenic
1075281776 10:121144903-121144925 AATAAAGATATGCCCAGGACTGG + Intergenic
1075615942 10:123891235-123891257 AACAGGGAGATTCCCGGGACTGG + Intronic
1077399127 11:2344631-2344653 AAAAGGGCAATGCCCAGGGCTGG + Intergenic
1082264080 11:50100876-50100898 AACAGAAACATGCCAAGGACTGG + Intergenic
1083446832 11:62713709-62713731 AACAGAGAACTGCCCAGGTGAGG + Exonic
1084057567 11:66646196-66646218 AACAGGAAAATGGGCAGGAGAGG - Exonic
1084409940 11:69001109-69001131 TACAGGGAGATGACCAGGCCTGG - Intergenic
1084631690 11:70355997-70356019 AAGACGGAAATGCTCAAGACAGG - Intronic
1085021731 11:73214342-73214364 AACAGAGGCATGCCCAGGCCTGG + Intergenic
1085025855 11:73236171-73236193 AACTGGGAAATCTCAAGGACTGG - Exonic
1086875029 11:92085415-92085437 ACCAGGGAAATGCCTAGAAGTGG + Intergenic
1087730152 11:101769176-101769198 CATAGGGAACTGCCCAAGACTGG + Intronic
1088596886 11:111447833-111447855 CAGAGAGAAATGCCCAGGAAGGG - Intronic
1089383493 11:118052685-118052707 GACAGAGAAATGCCCAGGTGGGG - Intergenic
1089570031 11:119400771-119400793 AACAAAGAAAAGTCCAGGACAGG + Intergenic
1089825553 11:121272764-121272786 AACAAAGAAAAGCCCAGGATAGG + Intergenic
1090111921 11:123921134-123921156 AGGAGGGAAATGCCAAGGTCTGG - Intergenic
1090893843 11:130951612-130951634 AAGAGAGAACTGCCCAGGTCTGG + Intergenic
1092034508 12:5320163-5320185 ACCAAAGAAAAGCCCAGGACTGG + Intergenic
1095653906 12:44647130-44647152 TAGAGGGAAATGCCAAGGAGTGG + Intronic
1095712750 12:45307897-45307919 AATAGGGAAAAGACCATGACAGG + Intronic
1095953789 12:47795467-47795489 AGCAGGGCAATGCGCAGGACAGG + Intronic
1097080526 12:56427421-56427443 ATCAGTGAAAAGCCTAGGACAGG - Intronic
1097415306 12:59308257-59308279 AACAGTTATATGCCAAGGACTGG + Intergenic
1098931590 12:76422596-76422618 AACAGGCAAAACCCCAGTACAGG + Intronic
1099390822 12:82076879-82076901 AACAAAGAAAAGTCCAGGACTGG - Intergenic
1099711095 12:86225312-86225334 AACAAAGAAAAGCCCAGGACTGG + Intronic
1101182415 12:102233627-102233649 AACAGAGAAATCCCTAGGAGTGG + Intergenic
1101187805 12:102298340-102298362 AACAAATAAAAGCCCAGGACCGG - Intergenic
1101745133 12:107534809-107534831 AACAAAGAAAAGCCCAGGACTGG + Intronic
1101822532 12:108195184-108195206 TACAGGGAAATGCAGAGGCCCGG - Intronic
1102613271 12:114131166-114131188 AAAATGGAAATGGCCAGGAGGGG + Intergenic
1104741722 12:131181248-131181270 AACAAGGAAAAGCCCAGGGTCGG + Intergenic
1105280734 13:18961138-18961160 CAGAGGGAAGTGCCCAGGATGGG - Intergenic
1105291345 13:19055661-19055683 AACAGGGAAATGCCCAGGACAGG - Intergenic
1105782968 13:23720568-23720590 TACAAAAAAATGCCCAGGACTGG + Intergenic
1106723432 13:32459646-32459668 AACAAATAAAAGCCCAGGACTGG + Intronic
1107876296 13:44793672-44793694 AAAAGAGAAATACCCAAGACTGG + Intergenic
1111152069 13:84265704-84265726 AAGAGAGCAATGCCAAGGACAGG - Intergenic
1111543835 13:89703707-89703729 AACAAAGACATGCCCAAGACTGG + Intergenic
1112060274 13:95732299-95732321 AACAAAGAAAAGCCCAGGACTGG - Intronic
1112299455 13:98217025-98217047 ATCAGGGAAATGGCCTGGGCGGG - Intronic
1114553612 14:23548765-23548787 AAGAGAGAAATGCCCAAGAGAGG - Intronic
1115288828 14:31747435-31747457 ATCAAAGAAAAGCCCAGGACAGG - Intronic
1116016229 14:39410646-39410668 AAAAAAGAAAAGCCCAGGACTGG - Intronic
1116503694 14:45651900-45651922 AACAGCGAAATGCTGAGAACAGG + Intergenic
1117512536 14:56468167-56468189 AACAAAGAAAAGCCCAGGATTGG + Intergenic
1120836475 14:89042308-89042330 AACAGGGACAGGCCCAGAGCTGG + Intergenic
1122719092 14:103712261-103712283 GACAGGGAGGTGCCCAGGCCTGG + Intronic
1126440630 15:48684063-48684085 TAAAGGGAAATGCACAAGACTGG + Intergenic
1126489667 15:49223005-49223027 AACAAAGAAAAGCCCAAGACTGG - Intronic
1127659251 15:61084681-61084703 AACAGAGCAATGCACAGAACCGG + Intronic
1129389375 15:75213022-75213044 AACAGGAAAATCCCCAGGCGAGG + Intergenic
1130085583 15:80776570-80776592 AAAAGGGAAATTCCCAGGCCTGG - Intergenic
1130166341 15:81463205-81463227 AACAAAGAAAAGCCCAGGATCGG - Intergenic
1130648269 15:85747272-85747294 CCCAGGTAAATCCCCAGGACAGG - Intronic
1131801743 15:96076344-96076366 AAAAGGGAAATGTCGAGGAGCGG + Intergenic
1134138495 16:11696549-11696571 AAAAGGGAAATGTGCTGGACAGG + Intronic
1134252655 16:12585414-12585436 CACTGAGAAATGCCTAGGACTGG + Intergenic
1137589197 16:49683066-49683088 TACAGGGAGATGGCCAGGGCGGG - Intronic
1138213205 16:55180341-55180363 AACAGGGAACAGCCCATGAGAGG + Intergenic
1139160669 16:64504270-64504292 AACAAAGAAAAGTCCAGGACTGG - Intergenic
1139231479 16:65287152-65287174 AACATGGAAATGACTAGGAAAGG - Intergenic
1139391329 16:66607778-66607800 CTCAGGGCCATGCCCAGGACTGG + Intronic
1139446216 16:67000338-67000360 GACAGGGAGGTGCCCAGGGCAGG + Intronic
1140174173 16:72639503-72639525 ATCAGGAAAATGGCCAGGAATGG + Intergenic
1141469594 16:84229431-84229453 AACAGGGAAATGACTAGCACAGG + Intronic
1144389715 17:14782031-14782053 CTCAGAGAAATGCCCAGGAATGG + Intergenic
1144765859 17:17732072-17732094 AACAGCAAAGTGCCCAGGGCTGG - Intronic
1144829311 17:18122587-18122609 AACAAGGGGATGCCCAGCACAGG + Intronic
1147182237 17:38693679-38693701 TTCCGGCAAATGCCCAGGACAGG + Intergenic
1147912265 17:43862724-43862746 TGCAGGGATAAGCCCAGGACCGG + Exonic
1148731263 17:49838094-49838116 AACAGGAAAGAGCCCACGACGGG - Intergenic
1148763883 17:50026387-50026409 TACAGGGAAATACCCTGGCCTGG - Intergenic
1149025808 17:52026516-52026538 AACAAAGACATACCCAGGACTGG + Intronic
1149659140 17:58325330-58325352 AGCACAGAAATGCCCAGGTCTGG + Intronic
1149811090 17:59672955-59672977 ATCAGGTAAATGCCCAGTACAGG + Intronic
1150642399 17:66958509-66958531 AAATGGAAAATGCCCAGGAGAGG + Intergenic
1151049083 17:70956298-70956320 AATATGGACATACCCAGGACTGG - Intergenic
1152434871 17:80270259-80270281 ACAAGGGAAGTGCCCAGGATAGG - Intronic
1153405506 18:4734303-4734325 GACAGGGAGATGCCCAGCACTGG + Intergenic
1153708320 18:7770296-7770318 AACATGGAAGTGCCAAGAACAGG - Intronic
1156425048 18:37001390-37001412 AACAAAGAAATGTCCAAGACTGG + Intronic
1156607323 18:38681217-38681239 TATAAGGAAATGCCCAAGACTGG + Intergenic
1156918250 18:42487015-42487037 TTCAGGGAAATTCCCAGGTCAGG + Intergenic
1157239699 18:45997672-45997694 AACAGGAAGCTGCTCAGGACGGG - Intronic
1157420875 18:47546656-47546678 CACAGGTGAATGCCCAGGACAGG + Intergenic
1157446796 18:47752405-47752427 AACAGGCAATTGCCTAGAACAGG + Intergenic
1158543239 18:58375185-58375207 GACAGGGACGTGCCAAGGACGGG - Intronic
1158751984 18:60272563-60272585 TACAGGGAAATAAGCAGGACTGG + Intergenic
1160553624 18:79712182-79712204 AATGGGGACATGCCCAGGATAGG + Intronic
1160785204 19:897169-897191 AACAGGAACATGCCCAGGTCAGG + Exonic
1161070752 19:2259330-2259352 AAAAAAGAAATGTCCAGGACAGG + Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161407390 19:4098233-4098255 TTCTGTGAAATGCCCAGGACAGG + Intronic
1161542364 19:4859774-4859796 CCCAGGGAAATGACCAGGAGGGG + Intronic
1162002402 19:7754362-7754384 AACAAAGAAATGCCCAGGGCTGG - Intergenic
1162238731 19:9329889-9329911 AACAGGGAGATGCCAAGGTTAGG - Intronic
1163327008 19:16611097-16611119 AAGAGGGAAATGGCCAGGGTTGG + Intronic
1163674506 19:18648710-18648732 AGGAGGGACATTCCCAGGACTGG - Intronic
1164998901 19:32744658-32744680 GAGAGGGAACTGCCCAGGGCAGG - Intronic
1165500527 19:36185654-36185676 AGCAGCAAAAAGCCCAGGACAGG - Intronic
1166397430 19:42452053-42452075 AACAGGGAAGTGGCCAGGCGCGG - Intergenic
1166452863 19:42916720-42916742 AACAGAAAAATGCCAAGGTCAGG - Intronic
1166892072 19:45999975-45999997 AACTGGGAGAGGCTCAGGACTGG + Intronic
1167341936 19:48921541-48921563 AGGAGGGAAAGGCCCAGGAGGGG + Intronic
1168303142 19:55418500-55418522 AACAGAAAAATGCCCAGTGCTGG + Intergenic
1168330052 19:55562907-55562929 AATAGGGAAATGCTCAGGCCAGG - Intergenic
925171287 2:1751726-1751748 ACCCGGGACATGCCCAGGAGTGG + Intergenic
925465983 2:4107774-4107796 AACTGGGGAATGCCCGGGAGGGG + Intergenic
925716544 2:6789121-6789143 TACAGAGAACTGCCCAAGACTGG - Intergenic
926171171 2:10553432-10553454 AACAGGAAAAAGCCCAGGCTGGG + Intergenic
928030800 2:27777315-27777337 AACAGGGACTTGGCCAGGAATGG - Intronic
928375945 2:30773524-30773546 AACAGGGAAATGTGCATAACAGG + Intronic
929625521 2:43402913-43402935 CACAGGGAAAGGCACAGGCCTGG - Intronic
929812623 2:45204259-45204281 AACAAAGAAAAGTCCAGGACTGG + Intergenic
929828504 2:45329075-45329097 AACGGGGCCATGCCCAGCACTGG + Intergenic
930409399 2:51004755-51004777 AGGAGGGGAATGCCCAGTACTGG + Intronic
930906763 2:56578562-56578584 AATAAAGAAAAGCCCAGGACTGG + Intergenic
931810238 2:65847745-65847767 AACAGAAAAATGCCTAGGAAAGG - Intergenic
931839676 2:66135320-66135342 AAAAGGGAAATGCCTTGGAAAGG + Intergenic
932053245 2:68419396-68419418 AGCAGGGACAGGCACAGGACAGG + Intergenic
932401248 2:71482475-71482497 CACAGGGAAGCGCCCAGGCCGGG - Intronic
933677631 2:85071012-85071034 TTCAGGTAAATGCCCAGGAACGG + Intergenic
933857707 2:86432668-86432690 AACAAAGAAAATCCCAGGACTGG + Intergenic
933936075 2:87204877-87204899 AGCGGGCAAATTCCCAGGACTGG + Intergenic
935101423 2:99999339-99999361 AACACGGGAAGGCCCAGGATTGG + Intronic
935703280 2:105832971-105832993 AACAAAGAAAAGACCAGGACTGG - Intronic
936347692 2:111687781-111687803 CACAGCGAATTGGCCAGGACTGG + Intergenic
936357073 2:111760952-111760974 AGCGGGCAAATTCCCAGGACTGG - Intergenic
938237318 2:129716942-129716964 AGCAGGGAACTGAGCAGGACTGG + Intergenic
938575621 2:132600726-132600748 AACAAAGAAAAGACCAGGACTGG + Intronic
938822318 2:134971546-134971568 AACAAAGAAAAGCCCAGGACTGG - Intronic
939317518 2:140570543-140570565 ATCAGAGAAAGGCCCAGGACTGG + Intronic
941914769 2:170804065-170804087 ACCAGAGAAATGCCAGGGACTGG - Intergenic
942935592 2:181552578-181552600 AATAAGGAAATACCCAAGACTGG - Intronic
943876032 2:193068764-193068786 AACAAAGAAAAGCCCAAGACTGG - Intergenic
944081791 2:195796369-195796391 AAGAGGGATTTGCCCAGGCCTGG + Intronic
945031601 2:205669524-205669546 AACCAAGAAAAGCCCAGGACTGG - Intergenic
945206189 2:207334801-207334823 AAGAGGGGAATGCCGAGGCCAGG + Intergenic
945988673 2:216374874-216374896 AACAGAGAACTGCTAAGGACAGG + Intergenic
946490284 2:220142691-220142713 ATCAAAGAAAAGCCCAGGACTGG - Intergenic
947467002 2:230360156-230360178 AACAGGGACATGCCCTGAAGAGG + Intronic
947908323 2:233783342-233783364 ATCAAAGAAAAGCCCAGGACCGG - Intronic
947989412 2:234474856-234474878 CACAGGGATCAGCCCAGGACTGG + Intergenic
948598041 2:239092990-239093012 AAAAGGGACATGCCGAGGGCTGG + Intronic
1169607658 20:7340453-7340475 AATAGAGAAAAGTCCAGGACTGG + Intergenic
1170305402 20:14932360-14932382 AGCTGGGTAATGCTCAGGACTGG - Intronic
1173979642 20:47213577-47213599 AACGGGGAAAGTCACAGGACAGG + Intronic
1178677359 21:34642579-34642601 AACAGAGAAAGTCCCAGGGCTGG - Intergenic
1179398206 21:41060416-41060438 AATAAAGACATGCCCAGGACTGG + Intergenic
1179709332 21:43203932-43203954 CAGAAGGAAAAGCCCAGGACTGG - Intergenic
1181797618 22:25321356-25321378 CACAGAGAAATGCCCAACACAGG - Intergenic
1182215703 22:28715713-28715735 AACTGGGAAATAGCCAGGCCGGG - Intronic
1182844887 22:33422291-33422313 TACAGGGAAATACCCAAGACTGG + Intronic
1183370455 22:37428840-37428862 AACAGGGAACGGCCCAGGATGGG + Intergenic
1183418645 22:37697417-37697439 AGGAGAGAAACGCCCAGGACGGG + Intronic
1184054784 22:42038581-42038603 AACAAAGAAATGCCCAAGACCGG - Intronic
1184419570 22:44371823-44371845 ACTAGGGAAGTGCCCAGGCCAGG + Intergenic
949118211 3:355174-355196 AAAAGGGCAGAGCCCAGGACAGG - Intronic
949462015 3:4303676-4303698 AACAGAAAAAGGCCCAGGCCGGG - Intronic
950103107 3:10370296-10370318 AACAGGGCGATTCCCAGAACGGG - Intronic
952239202 3:31512338-31512360 AAGAGGGAAATGGCCAGGCATGG - Intergenic
953220402 3:40965644-40965666 AACAAAGAAAAGTCCAGGACAGG - Intergenic
953318193 3:41948072-41948094 GAGAGGGAAATACCCAGAACTGG - Intronic
955422353 3:58751370-58751392 AACATGCAAATACCCAGGCCCGG + Intronic
955932269 3:64068905-64068927 AACAAAGAAAAGCCCGGGACTGG - Intergenic
955988833 3:64603212-64603234 AACAAGTAAATGCCAAGGTCTGG + Intronic
956020267 3:64926402-64926424 AACAGGGAAGTGAACAGGACAGG + Intergenic
959038368 3:101391606-101391628 AACAAAGAAAAGCCCAGGACTGG + Intronic
959780702 3:110229761-110229783 AACAGAGAATTGCAAAGGACAGG + Intergenic
959879429 3:111426332-111426354 AACTAGAAAAAGCCCAGGACTGG + Intronic
959892912 3:111576817-111576839 AACAACGAAATGCCTAGGACTGG - Intronic
961499357 3:127320861-127320883 GACAGGGCAAAGGCCAGGACTGG - Intergenic
962868968 3:139471756-139471778 AACAGGGAGATGTCCAGAGCAGG - Intronic
962958875 3:140291664-140291686 GACAGGGGAATACGCAGGACTGG - Intronic
963057845 3:141201911-141201933 AACAGGGAAGTCCCCAGGAAGGG + Intergenic
963758749 3:149263384-149263406 AAGAAAGAAAAGCCCAGGACTGG + Intergenic
963824267 3:149934003-149934025 ATCAAAGAAAAGCCCAGGACTGG - Intronic
964524065 3:157598423-157598445 AAAAAGGAAATACCAAGGACAGG + Intronic
964611157 3:158616916-158616938 AACAAAGAAAAGTCCAGGACTGG - Intergenic
964738267 3:159939049-159939071 AGCAGTGAAAGGACCAGGACTGG - Intergenic
964899682 3:161643210-161643232 AACAGACAATAGCCCAGGACAGG + Intergenic
965601002 3:170454612-170454634 AACAGGGAAATCCCGTGGCCAGG + Intronic
966358002 3:179102817-179102839 CACAGGGAAATGCAAAGCACAGG - Intergenic
966749326 3:183306879-183306901 AGCAGGGAACAGACCAGGACAGG - Intronic
966824554 3:183952795-183952817 TACAGAGAAATACCCAAGACGGG - Intronic
967632800 3:191766161-191766183 AATAAAGAAATGCCCAGGACAGG - Intergenic
969365555 4:6692306-6692328 AAGAGGGAACTGCCCAGCTCAGG + Intergenic
970173986 4:13318965-13318987 AAAAAAGAAAAGCCCAGGACAGG - Intergenic
970593581 4:17579585-17579607 CCCAGGGCAATGTCCAGGACGGG + Intronic
970829859 4:20324374-20324396 AGCAGGGAAATGGCCTGGTCGGG - Intronic
972927348 4:44027052-44027074 AATAATGAAAAGCCCAGGACTGG + Intergenic
972967346 4:44527064-44527086 ACCAAAGAAAAGCCCAGGACTGG - Intergenic
975209280 4:71680120-71680142 AAAAGGCAAATCCCCAGGAAAGG + Intergenic
977811004 4:101356186-101356208 AGCAGGGATATGGGCAGGACGGG - Intergenic
979735618 4:124079209-124079231 AACAAAGAAAAGCCCAGGACTGG + Intergenic
980079601 4:128330047-128330069 CTCAGGGAAGAGCCCAGGACTGG - Intergenic
980562215 4:134492370-134492392 TACAAAGAAAAGCCCAGGACTGG + Intergenic
981399653 4:144298815-144298837 TACAGCTAAATGCCCAAGACGGG - Intergenic
983164254 4:164455518-164455540 AACAAAGAAAAGCCCAGGAATGG + Intergenic
983543159 4:168934695-168934717 AACAAGGAAAAAACCAGGACTGG + Intronic
983948515 4:173613022-173613044 AACCGAAAAAAGCCCAGGACCGG - Intergenic
986162328 5:5241055-5241077 GACAGGTATAAGCCCAGGACAGG - Intronic
986192953 5:5513684-5513706 AAAAGGGAAATGCAAAGGAATGG - Intergenic
986710251 5:10483485-10483507 AACAGGGAAATGCCTGGGGCTGG - Intergenic
988354139 5:30151258-30151280 ACCAGGGCAATGCCCAGGGTGGG - Intergenic
989417140 5:41192500-41192522 AAAAAAGAAAAGCCCAGGACTGG - Intronic
989825643 5:45851283-45851305 AACCAAGAAAAGCCCAGGACTGG + Intergenic
990023048 5:51152128-51152150 AACAAAGAAAAGCCCAGGATTGG + Intergenic
990383130 5:55234515-55234537 AGCAGGGAAAAACCAAGGACTGG - Intergenic
990894435 5:60682808-60682830 AACAAAGAAAAGTCCAGGACTGG + Intronic
993341826 5:86733725-86733747 AACAAAGAAAAACCCAGGACTGG - Intergenic
993933156 5:93967802-93967824 GAAAGGGAAATGCCCAGCTCCGG + Intronic
995455849 5:112351485-112351507 AACAAAGAAAAGCCCAGGCCTGG + Intronic
995532401 5:113104624-113104646 AACAAAGAAATGCCCAGAAGAGG + Intronic
996468276 5:123828753-123828775 AACAGAGAAAAGCCCAGGGCAGG + Intergenic
996890854 5:128417949-128417971 AACAAAGAAAAGCCCAGGATTGG - Intronic
996970586 5:129362170-129362192 AGAAGGGAGATGGCCAGGACTGG - Intergenic
997593391 5:135089824-135089846 AACAGAGACATACCCAAGACTGG - Intronic
998752945 5:145344025-145344047 AAAAAGGAAAATCCCAGGACCGG + Intergenic
999124517 5:149237419-149237441 AAGAGGGAAATGGACAGGAAAGG - Intronic
1000928678 5:167225787-167225809 AACAAAGAAAAGCCAAGGACTGG - Intergenic
1001311494 5:170614141-170614163 ATTAGGGCAATTCCCAGGACAGG - Intronic
1003434529 6:6073493-6073515 AACAAGTAAATGCACAGCACAGG - Intergenic
1004245919 6:13975110-13975132 ACCAGTGAACTGCCCAGGGCTGG + Intronic
1004532581 6:16467123-16467145 CAAAGGGAAATGCCCTGGGCGGG + Intronic
1004897220 6:20160411-20160433 AACAGGCAACTGTCCAGGCCTGG + Intronic
1005878083 6:30030495-30030517 AACAAAGAAAAGCCCAGTACTGG - Intergenic
1006415128 6:33899169-33899191 AACATAGAAATGCCAAGGCCCGG - Intergenic
1006886650 6:37387636-37387658 AAAAAGGAAAGACCCAGGACTGG - Intronic
1007190835 6:40016730-40016752 AACAAAGAGATGCCCAGGACTGG - Intergenic
1008785812 6:55166450-55166472 AACAAAGAAAAGCCCAGAACTGG - Intronic
1011218990 6:85034408-85034430 TACAAGGAACTGCCCAAGACGGG + Intergenic
1011281671 6:85684381-85684403 AAGAGGAAGAAGCCCAGGACAGG + Intergenic
1012076160 6:94690027-94690049 AACAAAGAAATACCCAAGACTGG + Intergenic
1013592710 6:111632660-111632682 AACAGAGAAATGCTAAGGCCAGG + Intergenic
1014648898 6:124010845-124010867 AAAAGGAAAATGGCAAGGACTGG + Intronic
1017053557 6:150417605-150417627 AGCAGGGAACTGCACAGAACTGG + Intergenic
1017090021 6:150750891-150750913 AACAGGGAAATGGCTGGGCCAGG - Intronic
1017344265 6:153361669-153361691 GGCAGGAAAATGCCCCGGACAGG - Intergenic
1017975847 6:159356667-159356689 AAAGGGAAAATGCCCAGCACAGG - Intergenic
1020256465 7:6505142-6505164 GACAGGGAGATACCCAGGAAGGG + Intronic
1020839969 7:13204147-13204169 AAAAAAGAAAAGCCCAGGACAGG - Intergenic
1022788962 7:33667660-33667682 AACATGGAAATTACCTGGACTGG - Intergenic
1023247223 7:38217814-38217836 AACAGTTAAATGCCTAGGGCTGG + Intronic
1023479965 7:40623373-40623395 AACAGGGAATTGTGCAGAACTGG + Intronic
1023680351 7:42679615-42679637 AACAAAGAAAAGTCCAGGACTGG + Intergenic
1024370399 7:48576548-48576570 AAAAGGGAAATGCCCAGCTCAGG + Intronic
1024678673 7:51661137-51661159 AACAGGGCAATGCCCATGGTGGG + Intergenic
1024722102 7:52148850-52148872 ATCAGGGAAAGGCCCTGGAAGGG - Intergenic
1024843801 7:53618973-53618995 AATAGGGACATGTCCAAGACTGG - Intergenic
1025625499 7:63217743-63217765 GAGAGGGAAATGGCCAGGACTGG - Intergenic
1025908016 7:65803898-65803920 AACAGAAACATGCCAAGGACTGG - Intergenic
1026042850 7:66882975-66882997 AACAGAAACATGCCAAGGACTGG - Intergenic
1027205964 7:76099410-76099432 AACAGAAACATGCCAAGGACTGG + Intergenic
1028787256 7:94809569-94809591 AATAAAGAAATGCCCAGGGCTGG + Intergenic
1028816602 7:95153761-95153783 AACAAAGAAATGTCCAGGACTGG - Intronic
1028817724 7:95166531-95166553 AACAAAGAAAAGTCCAGGACTGG + Intronic
1030671018 7:112337159-112337181 AAAAGGGAAATGCCAAGGAGCGG + Intronic
1031565346 7:123289568-123289590 AACAATGAAAAGCCCAGGACTGG - Intergenic
1032891168 7:136197018-136197040 AAAAAAGAAAAGCCCAGGACTGG - Intergenic
1033635016 7:143204290-143204312 CAAAGAGAAATGCCCAGGATGGG + Intergenic
1034321733 7:150190736-150190758 AACAAAGACATACCCAGGACTGG + Intergenic
1034771014 7:153776541-153776563 AACAAAGACATACCCAGGACTGG - Intergenic
1035168467 7:157005331-157005353 AAAAGGGAAGCGCCCAGGACCGG + Exonic
1036118838 8:5992080-5992102 AACAGAAAAATGCCCAGGCGTGG - Intergenic
1037888830 8:22610738-22610760 AACAGGGAAATGACCCAGGCAGG + Intronic
1039041462 8:33412470-33412492 CACAGGGAAATGCTGAGGCCTGG + Intronic
1039044327 8:33436098-33436120 AACAGGAAAATGGGCAGGAGAGG + Intronic
1039351622 8:36769963-36769985 AAAAGGGAAAAGCACAGGAAAGG - Intergenic
1039402564 8:37282744-37282766 AACCAAGAAAAGCCCAGGACCGG + Intergenic
1039911631 8:41831326-41831348 ATCAGGTAAATACCCAGGAGTGG - Intronic
1040854198 8:51932116-51932138 AACAAGAAAATACCCAGCACTGG - Intergenic
1040945610 8:52881725-52881747 AACAGGGAAATGCCCACAAGGGG + Intergenic
1041161342 8:55047818-55047840 AACAAAGAAAAGTCCAGGACTGG + Intergenic
1041501793 8:58546988-58547010 AACAGGTACATACCCATGACTGG - Intergenic
1041759235 8:61346127-61346149 TTCAGGGAAATGCCCAATACAGG - Intronic
1043008018 8:74844926-74844948 AGCATGGAAATGGCCAGGGCTGG - Intronic
1043865427 8:85369551-85369573 AACAATGAAATGCCGTGGACTGG + Intronic
1044569536 8:93701013-93701035 CACAGGAAAAGGCCCAGGCCGGG - Intronic
1045390908 8:101713799-101713821 AACAAAAAAAAGCCCAGGACCGG + Intronic
1046973134 8:120244971-120244993 AATGGGGAAATGGCCAGGAGGGG - Intronic
1047268858 8:123335339-123335361 TACAGGGAAATGCCTAGGGAAGG + Intronic
1047546634 8:125824226-125824248 AACTGTGAAATGCCTAGGTCTGG - Intergenic
1047633110 8:126729681-126729703 CACAGCAAAATGCCCAAGACTGG + Intergenic
1047729917 8:127719183-127719205 AACAAGGAAATAGCCAGGAAAGG + Intergenic
1048665132 8:136652756-136652778 AATAAGGAAATACCCAGGACTGG + Intergenic
1050016056 9:1235792-1235814 AACATGGAAGTTCCCAGGGCCGG + Intergenic
1050076133 9:1866566-1866588 AAAAAAGAAAAGCCCAGGACCGG + Intergenic
1050336815 9:4597528-4597550 AACAGGGTCATGTCTAGGACAGG - Intronic
1050395922 9:5195622-5195644 AAGACTGAAATGCCCAGAACAGG - Intergenic
1052595025 9:30546324-30546346 AACAAAGAAAAGCCCAGAACTGG - Intergenic
1052723221 9:32198017-32198039 AACAGAGGAAAGCTCAGGACTGG - Intergenic
1053380217 9:37643092-37643114 TTCAGTGAAATGCCCAGGACTGG + Intronic
1054746178 9:68856183-68856205 AACAGGGAAAGTGCCAGAACTGG - Intronic
1055171540 9:73265267-73265289 GAAGGGGAAATGCCCAGGAAAGG - Intergenic
1055171788 9:73267222-73267244 GAAGGGGAAATGCCCAGGAAAGG - Intergenic
1055764268 9:79644706-79644728 CACAGGGAAGGGCCCAGGACTGG - Intronic
1057198865 9:93129932-93129954 TAGAGGCAAGTGCCCAGGACTGG - Intronic
1058098891 9:100895654-100895676 AACAGGGAAGAGCCCAGGTAGGG - Intergenic
1058798495 9:108521385-108521407 AAAAGGGAAATGTCCCAGACTGG - Intergenic
1059160066 9:112025574-112025596 TATAGAGAAATACCCAGGACTGG - Intergenic
1059226896 9:112680846-112680868 AAGAGGGAAATCACCAGGAAAGG + Intergenic
1060409263 9:123389351-123389373 AGCAGAGAAAAGCCCAGCACTGG - Intronic
1060662531 9:125412899-125412921 AACAGGGGAAGGCCCAGAGCAGG - Intergenic
1061074028 9:128329918-128329940 ATCAGAAAAGTGCCCAGGACTGG + Intronic
1061588732 9:131584554-131584576 TACAGGAAAAGGCCCAGGACAGG - Exonic
1062095080 9:134698926-134698948 AACAGGGACATGCCAAGGAAGGG - Intronic
1186394367 X:9193359-9193381 AGAAGGGATATGACCAGGACGGG + Intergenic
1186609477 X:11124911-11124933 AATAAGGACATGCCCAAGACTGG - Intergenic
1187165972 X:16804201-16804223 AAAAGGCAAATGGCCAGTACAGG - Intronic
1187214121 X:17258854-17258876 AACAAAGGAAAGCCCAGGACTGG + Intergenic
1187756093 X:22528444-22528466 AACCGAAAAATGCCCAGGACCGG + Intergenic
1190778763 X:53577378-53577400 AACTGAGAAATGCCCAGCACAGG + Intronic
1192241288 X:69331655-69331677 AACAAAGAAAAGCCCAGGACTGG - Intergenic
1192717054 X:73654653-73654675 AACAACAAAATGCCCAGGAGTGG - Intronic
1193793550 X:85845844-85845866 AATAAAGAAAAGCCCAGGACTGG + Intergenic
1193991357 X:88311876-88311898 AACTGAGAAAAGCACAGGACCGG + Intergenic
1195236826 X:102908354-102908376 AACAGAGAAAAGCCCAGACCTGG + Intergenic
1196243052 X:113366108-113366130 AAAAGGGAAATACCCAGTCCTGG - Intergenic
1196577661 X:117338924-117338946 AACAAAGAAAAGCCCAAGACTGG - Intergenic
1197898763 X:131345514-131345536 TACAGGGAAATGGCCAAGCCTGG - Intronic
1199619248 X:149684909-149684931 AACAAAGAACTGCCCAAGACTGG - Intergenic
1199755394 X:150859847-150859869 AACAGAGAAAAGCCCAGGACAGG + Intronic
1200345725 X:155445799-155445821 AACAAAGAAAAGTCCAGGACTGG + Intergenic
1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG + Intergenic
1202305558 Y:23466484-23466506 AACTGGGAAAAGCAGAGGACAGG + Intergenic
1202565251 Y:26204105-26204127 AACTGGGAAAAGCAGAGGACAGG - Intergenic