ID: 1105292500

View in Genome Browser
Species Human (GRCh38)
Location 13:19061785-19061807
Sequence GCCTCTGGGTTCCCCTTCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105292500_1105292507 29 Left 1105292500 13:19061785-19061807 CCAACGAAGGGGAACCCAGAGGC 0: 1
1: 0
2: 0
3: 4
4: 124
Right 1105292507 13:19061837-19061859 ATGTCATCTGTCCTGTCTATAGG 0: 1
1: 0
2: 1
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105292500 Original CRISPR GCCTCTGGGTTCCCCTTCGT TGG (reversed) Intergenic