ID: 1105295961

View in Genome Browser
Species Human (GRCh38)
Location 13:19088131-19088153
Sequence CTGTCTACACATATGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105295961_1105295968 11 Left 1105295961 13:19088131-19088153 CCTGGCTGCATATGTGTAGACAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1105295968 13:19088165-19088187 TGGGTCTCGGCCAGTCTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 114
1105295961_1105295966 -2 Left 1105295961 13:19088131-19088153 CCTGGCTGCATATGTGTAGACAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 230
1105295961_1105295964 -9 Left 1105295961 13:19088131-19088153 CCTGGCTGCATATGTGTAGACAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1105295961_1105295965 -8 Left 1105295961 13:19088131-19088153 CCTGGCTGCATATGTGTAGACAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105295961 Original CRISPR CTGTCTACACATATGCAGCC AGG (reversed) Intergenic
904015766 1:27419403-27419425 ATTTCTACACATTTCCAGCCTGG + Intronic
904702493 1:32366193-32366215 CTGTCCATACATAAGCAGGCAGG - Intronic
904968323 1:34398405-34398427 CTTTCTGCACATATAAAGCCTGG + Intergenic
905242449 1:36589651-36589673 CTGTCCACACAGCTTCAGCCAGG - Intergenic
908483569 1:64568424-64568446 CTCTCTTCCCATATGAAGCCTGG + Intronic
912455611 1:109794829-109794851 CTGCCTCCTCATCTGCAGCCTGG - Intergenic
913060702 1:115204105-115204127 CACTCTACACATGTGCAGCTTGG - Intergenic
913717340 1:121549968-121549990 GTTTCTACACAAATGAAGCCAGG - Intergenic
917021116 1:170588506-170588528 CTGTCTTTAGTTATGCAGCCTGG + Intergenic
919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG + Intronic
919676142 1:200385494-200385516 CTGACTACACATGTGTAACCTGG + Intergenic
920851593 1:209631786-209631808 CTCTGTACACCTCTGCAGCCTGG + Intronic
1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG + Intronic
1066672201 10:37852311-37852333 CTGTTGACACATATACAACCCGG + Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1084303411 11:68265898-68265920 CTGCCTACAGCTATGCAGCTGGG - Intronic
1085797935 11:79560665-79560687 CTATTTACATATATGCAGCTAGG + Intergenic
1087841695 11:102927402-102927424 CTGGCTAGACATATACAGTCTGG - Intergenic
1089163209 11:116455412-116455434 ATGTCTACACCTCTGCAGGCAGG + Intergenic
1092797026 12:12121922-12121944 CTGTCTACCAAAATCCAGCCTGG - Intronic
1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG + Intronic
1094411586 12:30172694-30172716 CTGTCCACACACATGCCCCCAGG - Intergenic
1096797554 12:54087405-54087427 CTGGCTACACATTAGCAACCTGG - Intergenic
1098800086 12:74945647-74945669 TTTTCTACACAAAGGCAGCCAGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1112780621 13:102897173-102897195 CTGGCTACACATCTGCAGAGTGG + Intergenic
1113757289 13:112821907-112821929 CAGACAACCCATATGCAGCCTGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG + Intergenic
1122853266 14:104548030-104548052 CTGTACACACATCTGCATCCAGG + Intronic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1124911903 15:33929388-33929410 CTGTCTACAGCTATGCAGTGTGG - Intronic
1127299020 15:57634430-57634452 CTGCAAACTCATATGCAGCCAGG - Intronic
1129510173 15:76115818-76115840 CCATCTACCCATGTGCAGCCAGG + Intronic
1129909295 15:79212869-79212891 CTGTCTACAGAGACCCAGCCGGG + Intergenic
1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG + Intronic
1132132581 15:99296592-99296614 CTGACCACACATATACAGCCTGG - Intronic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1133406142 16:5526060-5526082 CTGTCTACACATGCACTGCCTGG - Intergenic
1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG + Intronic
1135928880 16:26719625-26719647 CTGCCTACACGTTTGGAGCCAGG - Intergenic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1138228671 16:55322684-55322706 CTATCCACACATTTGCAGCTTGG - Intergenic
1140018601 16:71214611-71214633 GTGCTCACACATATGCAGCCTGG + Intronic
1145835663 17:27952574-27952596 CTGCCTACTCCCATGCAGCCCGG + Intergenic
1149241230 17:54652147-54652169 CTCTCTCCACATATGCAGAAAGG - Intergenic
1149294357 17:55248344-55248366 CTGTCCAGAGATAGGCAGCCTGG - Intergenic
1150512616 17:65773084-65773106 TTGTCTACGGCTATGCAGCCAGG + Intronic
1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG + Intergenic
1156928661 18:42614730-42614752 CTGTCTACACAGCTGCATCCTGG + Intergenic
1161012510 19:1967495-1967517 CTGTCTGCACAGATCCTGCCGGG - Intronic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1164515727 19:28933836-28933858 CTGCCTACAGAAATGAAGCCTGG + Intergenic
1166786922 19:45373155-45373177 CTGTCTCCAAAAATACAGCCGGG - Intergenic
1168362956 19:55758065-55758087 GTATCTACACATATGCATGCAGG - Intergenic
1168363911 19:55768065-55768087 GTATCTACACATATGCATGCAGG - Intergenic
925895150 2:8465645-8465667 CTCTCTTCACATATGCACACGGG + Intergenic
927615180 2:24586777-24586799 TTTTCTACACATATGCAACTTGG + Intronic
931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG + Intergenic
938762855 2:134441409-134441431 CCATCAACACTTATGCAGCCAGG - Intronic
939048175 2:137274525-137274547 CTGTCCTGACTTATGCAGCCTGG + Intronic
946140668 2:217688043-217688065 CTGGCTGCATATTTGCAGCCTGG - Intronic
946291180 2:218746624-218746646 CTCTTTACACATATTCAGCTTGG - Intronic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
1172512756 20:35511985-35512007 CTGTCTCCACTTGTGCAGCTGGG + Exonic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG + Intergenic
951780552 3:26358323-26358345 CTGTTTACACACATGATGCCAGG + Intergenic
954815634 3:53278307-53278329 CAGTCTACCCATATGAGGCCGGG + Intergenic
955025156 3:55160511-55160533 ACGTCTTCACATAAGCAGCCCGG - Intergenic
964288692 3:155151143-155151165 CTGTCTAAACATACACAGCAAGG - Intronic
969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG + Intronic
972516983 4:39818236-39818258 CTCTCTACACATACACAGCTTGG - Intergenic
974041409 4:56861004-56861026 TTGTCTAAAAATCTGCAGCCTGG + Intergenic
976757809 4:88516897-88516919 CTGTGAACAGATATGAAGCCAGG + Intergenic
977802457 4:101252722-101252744 TTCTTTACACATTTGCAGCCTGG + Intronic
978562303 4:110046069-110046091 CTGTCTAGACATATTCAGGCAGG - Exonic
985144705 4:186884111-186884133 CTGTCTACACATATGCAAAATGG - Intergenic
986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG + Intergenic
986318614 5:6609364-6609386 CTGGCTAGAAAGATGCAGCCCGG - Intronic
995783485 5:115802923-115802945 CTATATACACATATTCAGCATGG - Intergenic
996442912 5:123512271-123512293 CTGTCGCCACCGATGCAGCCCGG - Intronic
997099823 5:130956956-130956978 CTGACTAGCCATATGCAGACTGG - Intergenic
1000170505 5:158698435-158698457 CTGTGTAAATAAATGCAGCCTGG - Exonic
1005089687 6:22043450-22043472 ATGTTTACAGATATCCAGCCAGG + Intergenic
1005381408 6:25238124-25238146 CAGTCTACACATAAGTAGACTGG - Intergenic
1007582438 6:42967496-42967518 CTGTCTGCACATCAGCAGGCAGG + Exonic
1010236429 6:73578791-73578813 CTAACTACACATAGGCAGCTAGG + Intergenic
1013261317 6:108446217-108446239 TTGTGTGCACATATGCACCCTGG + Intronic
1017563780 6:155662562-155662584 CTGTCTACACATAGTCATGCAGG + Intergenic
1018475074 6:164132449-164132471 CTGTATGCACATGGGCAGCCAGG - Intergenic
1027359656 7:77394805-77394827 CTGCCTACACATGTACAGCTTGG - Intronic
1030140248 7:106296883-106296905 CTGGCTACAAACATGCAGCCAGG - Intergenic
1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG + Intronic
1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG + Intergenic
1035980667 8:4367264-4367286 CTGTCTAGACTCATGCAGTCTGG - Intronic
1045769121 8:105713664-105713686 CTGGTTAAGCATATGCAGCCTGG - Intronic
1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG + Intergenic
1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG + Intronic
1049017941 8:139934658-139934680 CTGTGGCCACATGTGCAGCCTGG - Intronic
1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG + Intergenic
1049443748 8:142620662-142620684 CTGTCTCCCCATGTGCACCCAGG - Intergenic
1053787184 9:41660553-41660575 CTGGCTACACATTAGCAACCTGG - Intergenic
1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG + Intergenic
1054175462 9:61871892-61871914 CTGGCTACACATTAGCAACCTGG - Intergenic
1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG + Intergenic
1054662075 9:67708918-67708940 CTGGCTACACATTAGCAACCTGG + Intergenic
1055259771 9:74419972-74419994 CAGTTTACTCATATGCAGCATGG - Intergenic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1058151119 9:101464742-101464764 CTGTTTACACTTATTCAGGCTGG + Intergenic
1059885964 9:118745032-118745054 CTGTGCAATCATATGCAGCCTGG + Intergenic
1060116474 9:120945253-120945275 CTGCCTTCCTATATGCAGCCTGG - Intergenic
1060510165 9:124225982-124226004 ATGTATACACATATGCATGCAGG - Intergenic
1190389622 X:49919291-49919313 CTCTCTACAGAAATCCAGCCAGG - Intergenic
1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG + Intergenic