ID: 1105295964

View in Genome Browser
Species Human (GRCh38)
Location 13:19088145-19088167
Sequence TGTAGACAGCCAAAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105295949_1105295964 23 Left 1105295949 13:19088099-19088121 CCCTCAAGATGCTTCCACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 194
Right 1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1105295960_1105295964 -8 Left 1105295960 13:19088130-19088152 CCCTGGCTGCATATGTGTAGACA 0: 1
1: 0
2: 1
3: 8
4: 158
Right 1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1105295958_1105295964 6 Left 1105295958 13:19088116-19088138 CCCTGGGCTGGGGTCCCTGGCTG 0: 1
1: 1
2: 11
3: 53
4: 527
Right 1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1105295961_1105295964 -9 Left 1105295961 13:19088131-19088153 CCTGGCTGCATATGTGTAGACAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1105295959_1105295964 5 Left 1105295959 13:19088117-19088139 CCTGGGCTGGGGTCCCTGGCTGC 0: 1
1: 0
2: 9
3: 81
4: 602
Right 1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1105295951_1105295964 22 Left 1105295951 13:19088100-19088122 CCTCAAGATGCTTCCACCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1105295956_1105295964 9 Left 1105295956 13:19088113-19088135 CCACCCTGGGCTGGGGTCCCTGG 0: 1
1: 0
2: 2
3: 71
4: 534
Right 1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105295964 Original CRISPR TGTAGACAGCCAAAGCTGGG TGG Intergenic
901775642 1:11558878-11558900 TGTGGATAGCCCAGGCTGGGAGG - Intergenic
904128832 1:28260547-28260569 CGGCGGCAGCCAAAGCTGGGGGG + Intronic
904652383 1:32014790-32014812 TGAAGACAGCCAGAGCGGGGAGG + Intronic
905684319 1:39898029-39898051 CGTAGACAGCTAAAGCTGTAGGG - Intronic
905708282 1:40078997-40079019 TGGAGACTCCAAAAGCTGGGAGG - Intronic
908082347 1:60594575-60594597 TCTACTGAGCCAAAGCTGGGTGG + Intergenic
911199722 1:95032419-95032441 TATAAACAGCCAAAGCTAGAAGG + Intronic
911288769 1:96029180-96029202 AGTCCACAGCCACAGCTGGGCGG + Intergenic
912250793 1:108010662-108010684 TATAGACAGCCCAAGCTGAATGG - Intergenic
912437058 1:109669097-109669119 TGTAGACAGCCAAGAGTGAGAGG - Intronic
912443068 1:109713291-109713313 TGTAGACAGCCAAGAGTGAGAGG - Intronic
912739825 1:112183783-112183805 TTTAGACAGCCATAGATGGTAGG - Intergenic
915181833 1:154068382-154068404 TGTAGAAAGCTGAAACTGGGTGG + Intronic
915947948 1:160167694-160167716 TGTAGACAGCAGAAGCTGGTTGG + Intronic
916429582 1:164714241-164714263 TATAGAAAGCCAAAGCCGGTAGG + Intronic
916755223 1:167762861-167762883 TGTAGATAGCCAGGGATGGGAGG + Intronic
917801971 1:178579859-178579881 GGTAGACAGCCACAGCTATGCGG - Intergenic
918102118 1:181385561-181385583 TGTAAATAGCCAAAGCTAGACGG + Intergenic
923146324 1:231201182-231201204 TTTAGACAGCCTGTGCTGGGTGG + Intronic
923153579 1:231256345-231256367 TGGAGACAGGGAAAACTGGGTGG - Intronic
923955033 1:239007353-239007375 TGTAGCCACCCAGAGATGGGTGG + Intergenic
1064527322 10:16270871-16270893 GGAAGTCATCCAAAGCTGGGAGG - Intergenic
1066439925 10:35428628-35428650 GGTAGACAGACAGAGCTGGCAGG + Intronic
1067758556 10:49025693-49025715 TGGAGGCAGCCACACCTGGGTGG - Intronic
1069524876 10:69160778-69160800 TTTTGAGAGCCAAACCTGGGAGG + Intronic
1069547105 10:69336586-69336608 GGTAGAAAACTAAAGCTGGGAGG - Intronic
1070964319 10:80520395-80520417 TGCGGACAGCCGATGCTGGGCGG - Exonic
1072726146 10:97815359-97815381 TGAAGTCAGGCCAAGCTGGGGGG + Intergenic
1076500669 10:130933682-130933704 TGTGCAGAGACAAAGCTGGGTGG - Intergenic
1077046692 11:549826-549848 TGAAGACAGCCAAAGGCAGGTGG + Intronic
1078007039 11:7539924-7539946 TGTAGAGATTCAAAACTGGGTGG - Intronic
1083078401 11:60065759-60065781 TGGAGAAAGCAAAAGATGGGAGG - Intronic
1086172429 11:83851330-83851352 AGGAGACAGCCAGGGCTGGGCGG + Intronic
1088712811 11:112523830-112523852 TCTGGACAGCCCAAGGTGGGAGG + Intergenic
1088780063 11:113125616-113125638 TTGAGTCAGCCAAAGGTGGGCGG + Intronic
1091116983 11:133022525-133022547 TGGAGACAGCAAAAGACGGGAGG - Intronic
1092601874 12:10075569-10075591 TAAAGACAGCAAAAGTTGGGAGG - Exonic
1092677235 12:10934353-10934375 TGGAGATAGTCAAAGCTGTGAGG + Intronic
1094726207 12:33119205-33119227 TTTGGAAAGCCAAAGATGGGTGG - Intergenic
1096495831 12:52038686-52038708 TGTAGTCATCCAGAGCTGTGAGG + Intronic
1097309738 12:58105482-58105504 TGTAGACAGATGATGCTGGGAGG + Intergenic
1097995111 12:65880082-65880104 TGTAGACAGCTAACGATGGGAGG + Intronic
1098424138 12:70340528-70340550 TGTAGACAGAATAAGTTGGGGGG - Intronic
1102255380 12:111411890-111411912 TGGAGACCCCCATAGCTGGGAGG + Intronic
1102532703 12:113558484-113558506 TGGAGACAGCCATGCCTGGGAGG + Intergenic
1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG + Intergenic
1107748011 13:43533272-43533294 TGTAGGCACCCATAGCTGAGGGG - Intronic
1112251070 13:97780949-97780971 TGTAGACTCCCAAGGCTGTGGGG - Intergenic
1113503021 13:110793264-110793286 TGTTGGCACCCAAAGCTCGGAGG - Intergenic
1113764389 13:112871917-112871939 AGGAGCCAGCCAAGGCTGGGTGG - Intronic
1113781892 13:112981848-112981870 GGGAGACAGCCAGGGCTGGGAGG - Intronic
1118741247 14:68740983-68741005 CTTAGAAAGCCAGAGCTGGGGGG + Intergenic
1118766813 14:68915415-68915437 TGGAGAAAACCAAAGCAGGGAGG - Intronic
1121929874 14:97962810-97962832 GGCAGACACCCAAAGCTAGGAGG - Intronic
1124922014 15:34036672-34036694 TGTTTTCAGCCAAAGCTGGAGGG - Intronic
1125600870 15:40915283-40915305 TGGAGACGGCCCAAGCTGGGAGG + Intergenic
1125785784 15:42316468-42316490 TTTAGGCAGCCAAAGCAGAGAGG + Intronic
1127517628 15:59711671-59711693 TCTAGACAGATAAAGTTGGGGGG + Intergenic
1129358900 15:75012202-75012224 TGTAGAATGCCAGAGCTGGAGGG + Intronic
1130031473 15:80318220-80318242 AGAAGACAGCCAAACCTGGGAGG - Intergenic
1130563817 15:84978887-84978909 TTTAGACAGGCAAAGCTGTGAGG + Intergenic
1130826852 15:87557611-87557633 TGGAGACAGACAAAACTGGCAGG - Intergenic
1130983607 15:88829971-88829993 TGTAGAAAGTCATAGCTGGGGGG + Intronic
1131433260 15:92403247-92403269 TGGAGTCAGGCAAACCTGGGTGG - Intronic
1133426285 16:5693007-5693029 AGTTGACATCCAGAGCTGGGGGG - Intergenic
1133723311 16:8515233-8515255 GCTGGACAGCCAAAGCTGGCAGG + Intergenic
1135635641 16:24073158-24073180 TGGAGACAGCCAAAGCCCTGGGG - Intronic
1136711804 16:32243609-32243631 TTTAGGCAGCCAAAGCAGAGAGG - Intergenic
1136756112 16:32685798-32685820 TTTAGGCAGCCAAAGCAGAGAGG + Intergenic
1136812001 16:33184575-33184597 TTTAGGCAGCCAAAGCAGAGAGG - Intergenic
1136818477 16:33294655-33294677 TTTAGGCAGCCAAAGCAGAGAGG - Intronic
1136825041 16:33351188-33351210 TTTAGGCAGCCAAAGCAGAGAGG - Intergenic
1136830107 16:33449959-33449981 TTTAGGCAGCCAAAGCAGAGAGG - Intergenic
1137419305 16:48317826-48317848 TCTAGCCAGCCAAAGCTTTGTGG - Intronic
1140294758 16:73697919-73697941 TGTAGAAAACAAAATCTGGGTGG - Intergenic
1202990579 16_KI270728v1_random:7545-7567 TTTAGGCAGCCAAAGCAGAGAGG - Intergenic
1203058250 16_KI270728v1_random:946150-946172 TTTAGGCAGCCAAAGCAGAGAGG + Intergenic
1145158875 17:20560898-20560920 GGTAGAAAGCAAAAGATGGGTGG - Intergenic
1146701133 17:34961324-34961346 TATTGACAGCCAAAGCTGCCCGG + Exonic
1149755831 17:59184648-59184670 TTTAAACCGCCAGAGCTGGGTGG + Intronic
1156488621 18:37483078-37483100 TGAACACAGCCACAGCTGGCAGG + Intronic
1156785050 18:40901555-40901577 AGTGGACAGGCAAAGCTAGGTGG - Intergenic
1157963967 18:52187499-52187521 TGTAGACAGCCAATTCTAGGGGG - Intergenic
1158135832 18:54207172-54207194 TGTAGGCTACCAAAGCTGGTGGG - Intronic
1159569012 18:70090799-70090821 TGAAGACAGCCAAAGGGGTGGGG + Intronic
1160116735 18:76085437-76085459 GGTATGCAGCCACAGCTGGGTGG + Intergenic
1160487274 18:79305049-79305071 TGTACACAGCCCACCCTGGGAGG + Intronic
1163581999 19:18144709-18144731 TGCAGACAGACAAAGGTGAGAGG - Intronic
1165894512 19:39133609-39133631 TGCAGACAGCAGAAGGTGGGTGG - Intronic
1166176432 19:41074828-41074850 TGTAGACTTCGAAAGGTGGGTGG - Intergenic
1168483433 19:56740675-56740697 TGTGGACAGCTGAAGCTGTGAGG + Intergenic
926147544 2:10405766-10405788 TGCAGTCAGCCAGAGCTGGCAGG - Intronic
926301633 2:11608948-11608970 GGAAGCCAGCCAAAGCTCGGTGG - Intronic
927353451 2:22145824-22145846 TGGAGACTCCAAAAGCTGGGAGG - Intergenic
927918028 2:26949052-26949074 GGTAGATAGCCAAGGTTGGGAGG - Exonic
929031774 2:37656100-37656122 TGTAGACAGCCCTAGCAGGGTGG - Intronic
931753141 2:65348300-65348322 TATAGAAAGCCAAAGCAGAGGGG - Intronic
936291414 2:111226845-111226867 AATAGAAAACCAAAGCTGGGGGG - Intergenic
941587964 2:167383154-167383176 TGTCAACAGCCAGAGCTGGAAGG - Intergenic
943171851 2:184411712-184411734 TATAGAAAGCCCCAGCTGGGGGG + Intergenic
943544120 2:189253515-189253537 CGAAGACACACAAAGCTGGGAGG - Intergenic
1171160939 20:22922530-22922552 TCTAGACAGCAAAAACAGGGAGG + Intergenic
1172869947 20:38129731-38129753 TTGGGACAGCCAGAGCTGGGTGG - Exonic
1174124729 20:48295746-48295768 TGAAAACAGCCAAAGCTAGTTGG + Intergenic
1174459569 20:50672981-50673003 TGTGGGCTGCCCAAGCTGGGTGG + Intronic
1177461823 21:21422288-21422310 TGGAGACTCCCAAAGGTGGGAGG + Intronic
1178621234 21:34178458-34178480 TGTGAACAGCTACAGCTGGGTGG + Intergenic
1180231388 21:46428755-46428777 TGGAGACAGGCAGCGCTGGGTGG + Intronic
1180846834 22:18987749-18987771 TGTCGACAGCAAGAACTGGGGGG - Intergenic
1180846975 22:18988671-18988693 TGTTGACAGCAAGAACTGGGGGG + Intergenic
1182193247 22:28486477-28486499 TGCAGACTGCCAAAAGTGGGGGG + Intronic
1182503054 22:30762603-30762625 TGAAGACAGCAGAAGCTGGATGG - Intronic
1183209842 22:36444114-36444136 TGTGGGCAGCCTCAGCTGGGCGG + Intergenic
1184733569 22:46384672-46384694 TGTCGACAGCAAGAACTGGGGGG + Exonic
951937876 3:28042204-28042226 TTTAGACAGGCACAGCTGTGGGG - Intergenic
957114262 3:76004332-76004354 TGTAGCCACCCAAATCTGAGTGG + Intronic
958094743 3:88929496-88929518 TCAAGAGAGACAAAGCTGGGTGG + Intergenic
960865728 3:122197812-122197834 TGAAGGAAGCCAAAGCTGGCAGG - Intronic
962103882 3:132370767-132370789 TGCAGTGAGCCAAAGCTGTGCGG + Intergenic
965976325 3:174627924-174627946 GGGAGACGTCCAAAGCTGGGAGG + Intronic
967895982 3:194396785-194396807 TGTTGGGAGCCAAGGCTGGGTGG + Exonic
969027853 4:4188942-4188964 GGTCGACAGCCAAAGGCGGGAGG + Exonic
970218243 4:13781222-13781244 TAGAGACAGACAAAGCTGGTTGG + Intergenic
974013852 4:56631358-56631380 TTTAGAACACCAAAGCTGGGAGG - Intergenic
974023329 4:56711128-56711150 GGTCCACAGCCACAGCTGGGCGG - Intergenic
974587046 4:63892916-63892938 TTTAGAAAGCAGAAGCTGGGTGG - Intergenic
976921557 4:90449825-90449847 GGTCCACAGCCACAGCTGGGTGG + Intronic
977566413 4:98585273-98585295 TGGAGACTACCAAAGGTGGGAGG - Intronic
978878437 4:113670677-113670699 TCTAGATAGCCAAAGCTTGAAGG - Intronic
979840304 4:125431004-125431026 TGTAGAAAGCAAATGCTGGGGGG - Intronic
981441352 4:144786258-144786280 TGAAGACAGCCAAAGGTGCAAGG - Intergenic
988689095 5:33554312-33554334 GGTAGACAGAGAAAGATGGGTGG + Intronic
989303921 5:39929294-39929316 TGTAGAAAGCGAAAGGAGGGTGG + Intergenic
991416165 5:66395431-66395453 TGTGGTCAGCCAAATCTGGAAGG - Intergenic
995059278 5:107796125-107796147 TGCAGAAGCCCAAAGCTGGGAGG + Intergenic
996305382 5:122040478-122040500 TAAAGACAGCCAAAGCTTAGAGG + Intronic
997837635 5:137208694-137208716 TGGAGACAGCTACAGGTGGGAGG + Intronic
1002318267 5:178359733-178359755 TGTGCAAAGCCCAAGCTGGGAGG + Intronic
1002839837 6:896252-896274 TGCACACAGCAAAAGGTGGGGGG - Intergenic
1004767967 6:18752832-18752854 TGTAGACAGGCCAGGCTGTGGGG + Intergenic
1004890515 6:20096470-20096492 TGTAGACAGCAGGAGCTGGCAGG + Intergenic
1006793277 6:36717241-36717263 GGAAGACAGCCAGAGATGGGAGG - Intronic
1007627505 6:43254774-43254796 TGTGGACACCCAGAGCTGGGTGG - Intronic
1009620360 6:66067062-66067084 TGTAGACTGCTAGAGCGGGGAGG - Intergenic
1011928759 6:92682961-92682983 TCTAGTCAGCCCAAGGTGGGTGG - Intergenic
1013424287 6:109996803-109996825 TGGAGCCACCCAAAGCTGGAAGG - Intergenic
1015565549 6:134566890-134566912 TGCAGAAAGACAAAGCTTGGTGG + Intergenic
1017055315 6:150430961-150430983 AGAAGCCAGCCCAAGCTGGGAGG + Intergenic
1020431789 7:8122977-8122999 TGGAGACAGGCAATGCTGAGAGG - Intronic
1020702377 7:11499251-11499273 TGTAGTCAGCCCAAGATGGAAGG - Intronic
1022214441 7:28244193-28244215 GGGAGACAGGTAAAGCTGGGAGG + Intergenic
1023287835 7:38637456-38637478 TGTAGACAGACATAGCAGGAAGG + Intergenic
1024787646 7:52926660-52926682 TGAAAACAGCCAAAGCTGTACGG + Intergenic
1026312154 7:69195813-69195835 TGGAGACATCAAAAGGTGGGAGG + Intergenic
1029860420 7:103565359-103565381 TGCAGACAGCCAATGGTTGGAGG + Exonic
1032081471 7:128860565-128860587 TGGAGGCAGCCGAAGCTGAGGGG - Intergenic
1032684273 7:134215433-134215455 TGAAGGCAACCAGAGCTGGGGGG - Intronic
1036555447 8:9855719-9855741 TGTAGAAAGGCAAGGCTGGGAGG + Intergenic
1037030869 8:14103214-14103236 TTTAGACAGTCAGAGTTGGGAGG + Intronic
1038989763 8:32855312-32855334 TGTAAACAGGCAAAACTGAGTGG - Intergenic
1039015856 8:33147813-33147835 TGGTGGAAGCCAAAGCTGGGAGG - Intergenic
1039713882 8:40087803-40087825 TGTACAGAGCCAGAGCGGGGCGG - Intergenic
1040869564 8:52087060-52087082 TGCAGACAGAACAAGCTGGGCGG - Intergenic
1044700350 8:94959876-94959898 TGTAAACATCCGAAACTGGGGGG - Intronic
1048455290 8:134572512-134572534 CGTAGCCAGTCAAGGCTGGGGGG - Intronic
1049004951 8:139848930-139848952 TGCAGACATCCAAAGTTGGATGG + Intronic
1049322638 8:142005031-142005053 GGTTGACAGCCTACGCTGGGGGG + Intergenic
1051059672 9:13031460-13031482 TGCAGACAGCCAAAGCTGAAGGG + Intergenic
1055004607 9:71491300-71491322 TGTAGAAAGTTAGAGCTGGGAGG - Intergenic
1057192662 9:93096184-93096206 GCTACACAGCCAAAGCCGGGGGG + Intergenic
1057263833 9:93601225-93601247 TGCAGACAGCCAAACCTGGGTGG - Intronic
1060552215 9:124491031-124491053 TGGAGACAGCCAGAGGCGGGTGG - Intronic
1186842204 X:13495339-13495361 TCTAGACATCCAAACCTGGATGG - Intergenic
1187393903 X:18903859-18903881 TGAAGACAGCTAGACCTGGGAGG - Intronic
1188143923 X:26586537-26586559 TGGAGAGGGGCAAAGCTGGGTGG + Intergenic
1192184346 X:68936544-68936566 AGTAGGGAGCCAATGCTGGGAGG + Intergenic
1195698403 X:107683711-107683733 TGTGGACAGGCCAAGCTGGCAGG + Intergenic
1196767648 X:119262849-119262871 TGGAGACTCCAAAAGCTGGGAGG - Intergenic
1196813052 X:119643793-119643815 GGTTGGCAGCCAAAGCTCGGTGG - Intronic
1199800240 X:151243530-151243552 TCCAGACAGCCAAAGCTTGAGGG - Intergenic
1200877188 Y:8170022-8170044 TGTGGGCAGCCAAAGCAGTGGGG + Intergenic