ID: 1105295965

View in Genome Browser
Species Human (GRCh38)
Location 13:19088146-19088168
Sequence GTAGACAGCCAAAGCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105295959_1105295965 6 Left 1105295959 13:19088117-19088139 CCTGGGCTGGGGTCCCTGGCTGC 0: 1
1: 0
2: 9
3: 81
4: 602
Right 1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 140
1105295956_1105295965 10 Left 1105295956 13:19088113-19088135 CCACCCTGGGCTGGGGTCCCTGG 0: 1
1: 0
2: 2
3: 71
4: 534
Right 1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 140
1105295960_1105295965 -7 Left 1105295960 13:19088130-19088152 CCCTGGCTGCATATGTGTAGACA 0: 1
1: 0
2: 1
3: 8
4: 158
Right 1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 140
1105295949_1105295965 24 Left 1105295949 13:19088099-19088121 CCCTCAAGATGCTTCCACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 194
Right 1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 140
1105295958_1105295965 7 Left 1105295958 13:19088116-19088138 CCCTGGGCTGGGGTCCCTGGCTG 0: 1
1: 1
2: 11
3: 53
4: 527
Right 1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 140
1105295951_1105295965 23 Left 1105295951 13:19088100-19088122 CCTCAAGATGCTTCCACCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 140
1105295961_1105295965 -8 Left 1105295961 13:19088131-19088153 CCTGGCTGCATATGTGTAGACAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105295965 Original CRISPR GTAGACAGCCAAAGCTGGGT GGG Intergenic
901713856 1:11137377-11137399 ATAAACTGCCAAAGCTGGGGAGG + Intronic
904652384 1:32014791-32014813 GAAGACAGCCAGAGCGGGGAGGG + Intronic
906562666 1:46770547-46770569 GTACTCAGCTAAAGCTGGTTGGG + Intronic
912250792 1:108010661-108010683 ATAGACAGCCCAAGCTGAATGGG - Intergenic
912472745 1:109916797-109916819 GTAGAGAGCTAAAGCAGAGTGGG + Intronic
912693580 1:111823086-111823108 GTAGACAGCCAAGGAAGAGTAGG - Intronic
915181834 1:154068383-154068405 GTAGAAAGCTGAAACTGGGTGGG + Intronic
916265961 1:162890090-162890112 GCAGAGAGCCAAAGCTGTGATGG - Intergenic
916364402 1:164008215-164008237 CTATACAGCCAAAGCACGGTGGG + Intergenic
916562010 1:165941381-165941403 GTAGACAGCCAGTGCTGAGAAGG + Intergenic
917029031 1:170669484-170669506 AGAGACATTCAAAGCTGGGTCGG - Intronic
917801970 1:178579858-178579880 GTAGACAGCCACAGCTATGCGGG - Intergenic
919855731 1:201704838-201704860 CCAGACTGTCAAAGCTGGGTAGG + Intronic
920257281 1:204664175-204664197 GGAGACAAACAGAGCTGGGTGGG - Intronic
921266385 1:213424227-213424249 GTAGAAAGCCGAAGTTGAGTTGG - Intergenic
921796307 1:219348348-219348370 GTAGCAAGCCAAGGCTTGGTTGG + Intergenic
923153578 1:231256344-231256366 GGAGACAGGGAAAACTGGGTGGG - Intronic
1063952995 10:11241751-11241773 GGAGACAGGCAAACCTGTGTGGG + Intronic
1064174135 10:13059537-13059559 GTAGACAGCGAGAGATGGGGCGG + Intronic
1065115540 10:22479306-22479328 GAAGAGAGACAAAGTTGGGTGGG - Intergenic
1065450326 10:25849691-25849713 GTAGACATCAAAGGCTGGGATGG + Intergenic
1065765670 10:29027193-29027215 AGAGACAGAGAAAGCTGGGTGGG - Intergenic
1065993586 10:31035665-31035687 GCAGAGAGCCAAAGCTGCTTAGG - Intergenic
1070465373 10:76717722-76717744 GTAGTAAGCCAAGACTGGGTTGG - Intergenic
1072605312 10:96976480-96976502 TTAGACAGCCACAGGTAGGTAGG - Intronic
1075964577 10:126600276-126600298 GCAGACTGCCAAAGCTGTGCAGG + Intronic
1076500668 10:130933681-130933703 GTGCAGAGACAAAGCTGGGTGGG - Intergenic
1078007038 11:7539923-7539945 GTAGAGATTCAAAACTGGGTGGG - Intronic
1078686272 11:13534964-13534986 AGGGACAGCCAAAGCAGGGTGGG - Intergenic
1079819330 11:25105528-25105550 GTGGACAGCCAATGTGGGGTTGG - Intergenic
1080289086 11:30650959-30650981 GTATACAGCCAAAACTGAGTCGG - Intergenic
1080948231 11:36998852-36998874 GTACACAGCCAAAGGTTGGCAGG - Intergenic
1081078434 11:38707045-38707067 TTAGTCAGCCAAGGCTGGGGAGG + Intergenic
1081545530 11:44068982-44069004 GAAGACAGAGAAAGATGGGTGGG + Intronic
1083467422 11:62857762-62857784 GTAGACAGACAAGGCTGGGGAGG + Intronic
1083555903 11:63627292-63627314 GTTAACAGTCAAAGCTTGGTTGG + Exonic
1084942164 11:72618605-72618627 AAAGACAACCAAAGCTGGGGAGG - Intronic
1086172430 11:83851331-83851353 GGAGACAGCCAGGGCTGGGCGGG + Intronic
1089754183 11:120674335-120674357 CTGGACAGCCAGGGCTGGGTGGG - Intronic
1090200608 11:124852745-124852767 ATAGACACCCAAAGAGGGGTCGG + Intergenic
1090431218 11:126648201-126648223 GTAGGCAGGCACAGCTGGGGAGG - Intronic
1090896197 11:130977382-130977404 AGAGAGAGCCAAAGCAGGGTGGG - Intergenic
1092982195 12:13807872-13807894 GGAGCCATCCTAAGCTGGGTGGG - Intronic
1094424568 12:30304915-30304937 GAAGAGAGGCAAAGCTGGTTTGG + Intergenic
1096510159 12:52123380-52123402 GTACACAGCAAAAGCTGGCTTGG + Intergenic
1101854912 12:108434186-108434208 GAAGACAGCCAAAGCAGGAAAGG - Intergenic
1102491499 12:113292000-113292022 ACAGACAGACAGAGCTGGGTAGG - Intronic
1103069130 12:117926248-117926270 GTAGAAAACCAAGGCTGGGATGG - Intronic
1105295606 13:19086030-19086052 GTAGACACTCACAGCTGAGTCGG + Intergenic
1105295965 13:19088146-19088168 GTAGACAGCCAAAGCTGGGTGGG + Intergenic
1106289571 13:28348146-28348168 TTAGGCAGTCACAGCTGGGTAGG - Intronic
1109367653 13:61377683-61377705 GTACAGAGACAAAGCGGGGTTGG + Intergenic
1109981398 13:69913088-69913110 GGAGAAAGGCATAGCTGGGTGGG - Intronic
1113781891 13:112981847-112981869 GGAGACAGCCAGGGCTGGGAGGG - Intronic
1113914199 13:113861234-113861256 GGAAACAGCCAGGGCTGGGTAGG + Intronic
1116987367 14:51235825-51235847 GGATACAGCTAAAGCAGGGTTGG + Intergenic
1118140007 14:63070536-63070558 GAAGACAGCCAATACTTGGTTGG + Intronic
1118178271 14:63464400-63464422 GTAGTCAGCCAAGGCTGTCTGGG + Intronic
1121929873 14:97962809-97962831 GCAGACACCCAAAGCTAGGAGGG - Intronic
1122329415 14:100902634-100902656 GTAGGCAGCCACAGCAGGGCTGG + Intergenic
1122437420 14:101709586-101709608 GTAGACGGCCGGAGGTGGGTGGG + Intergenic
1123823384 15:24055333-24055355 GTAGAGGGGAAAAGCTGGGTGGG - Intergenic
1125579747 15:40776688-40776710 GGAGGCAGCCAGAGCTGGGGTGG - Intronic
1126838047 15:52687575-52687597 TTAGACAGGCAAAGTGGGGTAGG + Intronic
1130031472 15:80318219-80318241 GAAGACAGCCAAACCTGGGAGGG - Intergenic
1130563818 15:84978888-84978910 TTAGACAGGCAAAGCTGTGAGGG + Intergenic
1139572959 16:67824848-67824870 GTAGAAAGGCAGAGCAGGGTAGG - Intronic
1140294757 16:73697918-73697940 GTAGAAAACAAAATCTGGGTGGG - Intergenic
1140894816 16:79315672-79315694 TTACACTGCCAATGCTGGGTGGG + Intergenic
1141246190 16:82309710-82309732 ATAGTGAGCCAAAGCAGGGTGGG - Intergenic
1141854199 16:86670019-86670041 CTGGAGAGCCAAAGCTGGGCCGG + Intergenic
1141865880 16:86749443-86749465 GTGGACAGCCAAGGCCAGGTAGG - Intergenic
1149755832 17:59184649-59184671 TTAAACCGCCAGAGCTGGGTGGG + Intronic
1149772210 17:59331392-59331414 CCAGAGTGCCAAAGCTGGGTGGG - Intergenic
1157904899 18:51561011-51561033 GTAGCCAGGCAAAGCTGGGATGG + Intergenic
1159808037 18:72979494-72979516 GTAGACAACCTAAGCTCTGTTGG + Intergenic
1163425120 19:17236641-17236663 GGAGAGAGCCAGTGCTGGGTGGG - Intronic
1165894511 19:39133608-39133630 GCAGACAGCAGAAGGTGGGTGGG - Intronic
1166176431 19:41074827-41074849 GTAGACTTCGAAAGGTGGGTGGG - Intergenic
925931281 2:8709971-8709993 GAAGACAGTCAACGGTGGGTTGG + Intergenic
927040694 2:19227543-19227565 ACAGACAGCAAAAGTTGGGTAGG + Intergenic
927195245 2:20542311-20542333 GGAGACAAGAAAAGCTGGGTTGG - Intergenic
927918027 2:26949051-26949073 GTAGATAGCCAAGGTTGGGAGGG - Exonic
929163495 2:38857203-38857225 ATAAACAGCCAAACATGGGTAGG + Intronic
929455282 2:42060777-42060799 GGAGCCAGCCAAAGCTGGGCAGG + Intergenic
932187800 2:69713859-69713881 GTAGACAGCGAAAGCTGCTGAGG - Intronic
933727843 2:85436631-85436653 GAAGACAGCCCAAGGTGGGGCGG - Intronic
937692143 2:124768700-124768722 GGAGTCAGACAGAGCTGGGTGGG - Intronic
941368800 2:164638618-164638640 GTAGACAGAGAAGGCGGGGTTGG + Intergenic
943665862 2:190607541-190607563 CTTGGCAGCCAAATCTGGGTTGG - Intergenic
944948680 2:204721130-204721152 GTATACAGCTAAAACTTGGTTGG + Intronic
947927295 2:233932977-233932999 GTAGAGAGGCAAGGGTGGGTTGG - Intronic
1170209770 20:13836887-13836909 GTAGAAATCCAAAGCTGGCAAGG + Intergenic
1170672022 20:18443370-18443392 GACGACAGCCAAATATGGGTGGG + Exonic
1170912811 20:20591909-20591931 ATAGAAAACCATAGCTGGGTAGG + Intronic
1171305014 20:24097705-24097727 GTAGACAACCAAAACTCAGTGGG - Intergenic
1172869946 20:38129730-38129752 TGGGACAGCCAGAGCTGGGTGGG - Exonic
1174124730 20:48295747-48295769 GAAAACAGCCAAAGCTAGTTGGG + Intergenic
1178088546 21:29137330-29137352 GCAGTCTGCCAAAGGTGGGTGGG + Intronic
1178571902 21:33746034-33746056 GTAGTCAGCCAATGATGGGACGG - Intronic
1180231389 21:46428756-46428778 GGAGACAGGCAGCGCTGGGTGGG + Intronic
1180842504 22:18965886-18965908 GCAGGCAGTCAAACCTGGGTTGG - Intergenic
1181616034 22:24055052-24055074 GGCGACAGCCACAGCTGGGTTGG - Exonic
1182360571 22:29744212-29744234 GTATACGGCCAAGACTGGGTGGG + Intronic
1182503053 22:30762602-30762624 GAAGACAGCAGAAGCTGGATGGG - Intronic
949394051 3:3596055-3596077 GTAGACAACCTAAGCTGGCATGG + Intergenic
952706861 3:36387070-36387092 TTAGACAGCAAAAGTTGGTTTGG - Intronic
954834311 3:53452149-53452171 GTAGACAGACAAAGCTTCATGGG - Intergenic
955963919 3:64368702-64368724 TAAGACAGCCCCAGCTGGGTGGG + Intronic
956211274 3:66804161-66804183 GGAGGAAGCCATAGCTGGGTTGG - Intergenic
956916964 3:73881676-73881698 TTAGAGAGCCAAAGGAGGGTTGG + Intergenic
957114263 3:76004333-76004355 GTAGCCACCCAAATCTGAGTGGG + Intronic
962801890 3:138897666-138897688 GAAGCCAGCCAGAGCTGGCTGGG + Intergenic
965976326 3:174627925-174627947 GGAGACGTCCAAAGCTGGGAGGG + Intronic
969504647 4:7577304-7577326 GTAGACAGGTAAAGCCAGGTGGG + Intronic
970218244 4:13781223-13781245 AGAGACAGACAAAGCTGGTTGGG + Intergenic
970811382 4:20098653-20098675 GTACAAAACCAAAGCTGGGAAGG + Intergenic
978555313 4:109973396-109973418 GCAGCCAGGCAAAGGTGGGTGGG - Intronic
982089979 4:151872054-151872076 AGAGATAGCCAAACCTGGGTGGG + Intergenic
986290658 5:6396697-6396719 GTAGAGCACCAAAGCAGGGTAGG + Intergenic
986556092 5:9011035-9011057 CTGGACAGCCAAGGCTGGATTGG + Intergenic
986916191 5:12623832-12623854 GTAGAGGAGCAAAGCTGGGTGGG + Intergenic
988263122 5:28915236-28915258 GTAGAAAGCCAAAGGTGGTTTGG - Intergenic
992022817 5:72641283-72641305 TGAAACAGCCACAGCTGGGTTGG + Intergenic
996400846 5:123060555-123060577 GTAGACAGCCAAAGATTGCCAGG + Intergenic
997454709 5:134007906-134007928 GAAGACAGTCAAATCTTGGTGGG + Intergenic
998096246 5:139396958-139396980 GTGGACAGCCAAGGGTAGGTAGG + Intronic
999423484 5:151465413-151465435 ATAGACCGCCAAAGCTGGAATGG - Intronic
1000272172 5:159696607-159696629 AGAGTCAGCCAGAGCTGGGTTGG - Intergenic
1006793276 6:36717240-36717262 GAAGACAGCCAGAGATGGGAGGG - Intronic
1009727942 6:67558632-67558654 GAGGGCAGCCAAAGCAGGGTGGG - Intergenic
1017960552 6:159217261-159217283 GGAGACAGCCAAGGCTGGCGCGG + Intronic
1019526852 7:1484319-1484341 GAAGACGACCAGAGCTGGGTCGG + Intronic
1021456187 7:20831670-20831692 GTAGGCAGAGAAAGCTGGGAAGG - Intergenic
1022865016 7:34408656-34408678 GAAGACAGCCATACCTGTGTAGG - Intergenic
1025663673 7:63571065-63571087 GTAGACAGCCACAGGTAGGCTGG + Intergenic
1026853262 7:73737784-73737806 GTAGACAGCCAAAGGCTTGTAGG + Intronic
1031139696 7:117928531-117928553 GTAGACAGGCAGAGCTTGTTGGG - Intergenic
1032839052 7:135699576-135699598 CCAGACAGCCCAAGCTGGGTTGG - Intronic
1036406688 8:8461570-8461592 GTAAACAGCCCAAGGTGGTTTGG + Intergenic
1044593692 8:93938621-93938643 AGAGACAGCCAAAGTGGGGTGGG - Intergenic
1057263832 9:93601224-93601246 GCAGACAGCCAAACCTGGGTGGG - Intronic
1057264201 9:93603315-93603337 GTAGACAACCACAGCTAAGTCGG - Intronic
1058543411 9:106035615-106035637 GGGGACTGCCAAAGCTGGTTTGG + Intergenic
1060215442 9:121736064-121736086 CTAGACAGCCTAAGCTGAGAAGG - Intronic
1060552214 9:124491030-124491052 GGAGACAGCCAGAGGCGGGTGGG - Intronic
1186842203 X:13495338-13495360 CTAGACATCCAAACCTGGATGGG - Intergenic
1188143924 X:26586538-26586560 GGAGAGGGGCAAAGCTGGGTGGG + Intergenic
1190480941 X:50876133-50876155 GGCGTCAGACAAAGCTGGGTTGG - Intergenic
1197553162 X:127919810-127919832 GGACACAGCCAAAGCAGTGTTGG - Intergenic
1199574572 X:149301069-149301091 AGAGACAGGCACAGCTGGGTTGG - Intergenic