ID: 1105295966

View in Genome Browser
Species Human (GRCh38)
Location 13:19088152-19088174
Sequence AGCCAAAGCTGGGTGGGTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 230}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105295961_1105295966 -2 Left 1105295961 13:19088131-19088153 CCTGGCTGCATATGTGTAGACAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 230
1105295949_1105295966 30 Left 1105295949 13:19088099-19088121 CCCTCAAGATGCTTCCACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 194
Right 1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 230
1105295959_1105295966 12 Left 1105295959 13:19088117-19088139 CCTGGGCTGGGGTCCCTGGCTGC 0: 1
1: 0
2: 9
3: 81
4: 602
Right 1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 230
1105295956_1105295966 16 Left 1105295956 13:19088113-19088135 CCACCCTGGGCTGGGGTCCCTGG 0: 1
1: 0
2: 2
3: 71
4: 534
Right 1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 230
1105295960_1105295966 -1 Left 1105295960 13:19088130-19088152 CCCTGGCTGCATATGTGTAGACA 0: 1
1: 0
2: 1
3: 8
4: 158
Right 1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 230
1105295958_1105295966 13 Left 1105295958 13:19088116-19088138 CCCTGGGCTGGGGTCCCTGGCTG 0: 1
1: 1
2: 11
3: 53
4: 527
Right 1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 230
1105295951_1105295966 29 Left 1105295951 13:19088100-19088122 CCTCAAGATGCTTCCACCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105295966 Original CRISPR AGCCAAAGCTGGGTGGGTCT CGG Intergenic
901670390 1:10852578-10852600 AGCCACAGCAGGATGGGTCCTGG - Intergenic
902242959 1:15100934-15100956 AGCCCAGGCTTTGTGGGTCTCGG + Intronic
902375229 1:16027258-16027280 AGCCACAGGTGGGTGGGGGTGGG + Intronic
902581770 1:17412238-17412260 AGCCATAGCTGCGTGGGTGCAGG - Intronic
902921969 1:19671646-19671668 AGCCAAGGCTAAGTGGGGCTGGG - Intronic
902934630 1:19755949-19755971 AGCAAAAGCAAGGTGGGGCTGGG + Intronic
903018859 1:20379656-20379678 AGCCAAAGCTGGGTGAGGGCTGG + Intergenic
903576854 1:24344681-24344703 AGCCCGAGCTGGATGGGTCAAGG - Intronic
904285755 1:29452348-29452370 AGCCAATGATGGGTGGGTGGAGG + Intergenic
904436826 1:30504506-30504528 AGCCATAGCTGGGGTGGTCAAGG - Intergenic
904622322 1:31782870-31782892 ATCTCAAGCTGGGTGGGCCTTGG + Intergenic
905274256 1:36806916-36806938 GGGCAAAGCTGAGTGGGTCCTGG + Intronic
905447962 1:38039552-38039574 AGCCTGACCAGGGTGGGTCTGGG - Intergenic
905670180 1:39786300-39786322 GGCCACAGCTGGGAGGGCCTGGG + Intronic
905807251 1:40885853-40885875 AGCCAAAGCTCGCTGGGCATAGG - Intergenic
906191759 1:43903535-43903557 GGCCTAGGCTGGGTGGGTGTGGG + Intronic
906688626 1:47778428-47778450 AGCCACATCTGGGTGTGCCTTGG - Intronic
906753307 1:48285726-48285748 AGCTGAAGCTGGGTGGGGCGGGG - Intergenic
907404337 1:54244621-54244643 AGGCACAGCGGGGTGGGTCAAGG + Intronic
908251375 1:62268567-62268589 AGTGAGAGCTGGGTGGGCCTCGG + Intronic
909151564 1:72012331-72012353 AGCCATAGCTGGGTGAGGCAGGG + Intronic
910438052 1:87225637-87225659 AGCCCAAGGTGGGGGGGTCTTGG + Intergenic
910724217 1:90321596-90321618 AGCTAACTCTGGGTGGGTCAGGG + Intergenic
910800186 1:91137641-91137663 AGCCACAGCAGAGTGGGTCATGG + Intergenic
913455648 1:119027922-119027944 AGCAAATGCTGGGTGTGCCTGGG - Intergenic
915912104 1:159921913-159921935 AGCCAAACCAGGGTGGGGATGGG - Intronic
916028864 1:160859291-160859313 AGACAAAGAGGAGTGGGTCTTGG + Intronic
916175436 1:162034158-162034180 AGCAAAAGCCGTGTGGTTCTGGG - Intergenic
916679990 1:167094989-167095011 AGCCCCAGCTGGGAGGGGCTGGG + Intronic
916802342 1:168226510-168226532 AGCCTTTGCTGGGTGGGTCGGGG + Intronic
918436377 1:184517627-184517649 AGCACAGGCTGGGTGGGGCTGGG + Intronic
919601815 1:199632697-199632719 AGCCAAACCAGGGTGGGGCATGG + Intergenic
919806013 1:201381433-201381455 GGACAAAGATGGGTGGGTCCAGG + Exonic
919980531 1:202640250-202640272 TGCCAAGGCTGGGTGGGGCGGGG - Intronic
923160540 1:231310767-231310789 AGTCAAGGCTGGGTAGGACTTGG + Intergenic
1066034539 10:31468185-31468207 GGGCAAAGCTGGGTGGGACTGGG - Intronic
1067105755 10:43365102-43365124 AGCCTCAGCTGGGTGGGTGCAGG + Intergenic
1067476818 10:46572923-46572945 AGCCAAAGGTTTGTGGATCTTGG - Intergenic
1067617920 10:47768857-47768879 AGCCAAAGGTTTGTGGATCTTGG + Intergenic
1068962571 10:62880465-62880487 AGACCAAGATGGGAGGGTCTGGG - Intronic
1070087604 10:73252213-73252235 AGCCCATGCGGGGTGGGTTTGGG - Intronic
1070833616 10:79434955-79434977 CTCCAAGGCTGGGTGGGGCTGGG - Intronic
1072171800 10:92870242-92870264 AGCCAGAGCTGGGTGGCACGCGG - Intronic
1073293326 10:102424064-102424086 GGCCAAAGCTCGGGGGGACTTGG - Exonic
1074138977 10:110654596-110654618 TGCCTAAACTGGGTGAGTCTTGG + Intronic
1076667771 10:132102765-132102787 AGGCCAAGCTGTGTGGGTGTGGG - Intergenic
1077384129 11:2261049-2261071 GGGGAAAGCTGGATGGGTCTGGG - Intergenic
1077579604 11:3408370-3408392 ACCCACAGATGGGTGGGACTTGG + Intergenic
1078164666 11:8871489-8871511 AGCCGGAGCTGGGAGAGTCTGGG + Intronic
1081852180 11:46281449-46281471 AGCCCCAGCTGGGAGGGTGTGGG + Intronic
1081911547 11:46703123-46703145 AGCCCAGGCTGGGTGAGACTTGG - Exonic
1083263955 11:61537636-61537658 AGCCCATGGTGGGAGGGTCTGGG - Intronic
1084209728 11:67615402-67615424 GGCCCAAGCCGGGTGGGTCAGGG + Intergenic
1084236624 11:67791907-67791929 ACCCACAGATGGGTGGGACTTGG + Intergenic
1084933673 11:72575791-72575813 GGCCAGCGCTGGGAGGGTCTAGG + Intergenic
1085392981 11:76191919-76191941 AGCCATGGGTGGGTGGGGCTGGG - Intronic
1085766459 11:79287416-79287438 ACCCAGGGCTGGATGGGTCTGGG - Intronic
1086588610 11:88485224-88485246 AAGCAAATCTGGGTGGGGCTGGG + Intergenic
1087297990 11:96399730-96399752 AGCCACAGCTGGGGTGGTCAAGG - Intronic
1087582125 11:100070510-100070532 AGCCAACGATACGTGGGTCTGGG - Exonic
1088491847 11:110396319-110396341 CGCCCAAGCTGGGAGGTTCTGGG + Intergenic
1089442396 11:118528491-118528513 AGCCAGAGCTGACTGGGTATGGG - Intronic
1089754181 11:120674329-120674351 AGCCAGGGCTGGGTGGGAATGGG - Intronic
1090386753 11:126361709-126361731 AACCAAAGGTAGGTGGTTCTGGG + Intronic
1091227240 11:133964943-133964965 AGCCACAGCTGGAGGGCTCTAGG + Intergenic
1091799778 12:3317448-3317470 AGCCAAGGCTGTGGGGGTCTGGG + Intergenic
1092909917 12:13137711-13137733 AGCCACAGCTGGGAGGGCCTTGG - Intronic
1094089247 12:26629766-26629788 AGCAAAGGCTGGGTGGGTCGGGG - Intronic
1095206789 12:39447301-39447323 AGCCAACGATGGGAAGGTCTGGG - Intergenic
1096575782 12:52552083-52552105 GGCCACAGCTGAGTGGCTCTGGG - Intronic
1096656599 12:53096480-53096502 ACCCAGAGTTGGGTGGGTGTGGG + Intergenic
1097013698 12:55970800-55970822 CCCCAAGGCTGGGTGGGTCTGGG - Intronic
1102879040 12:116470211-116470233 GGCCAAAGCAGAGGGGGTCTGGG - Intergenic
1103034598 12:117646545-117646567 AGCCAAAGCCTGGAGGGTTTGGG + Intronic
1104414964 12:128590495-128590517 AGCCAAGGCTGTGTGAGTCAAGG + Intronic
1105295966 13:19088152-19088174 AGCCAAAGCTGGGTGGGTCTCGG + Intergenic
1108358614 13:49650070-49650092 AGCCAAGGCTGAGTGGGATTAGG + Intergenic
1111522144 13:89419269-89419291 AGGCAAAGCTTCTTGGGTCTTGG + Intergenic
1112557551 13:100482485-100482507 AACCAAGGATGGGTGGGCCTGGG + Intronic
1113793872 13:113045504-113045526 AGCCCAAGCAGGGGGGGCCTTGG - Intronic
1114365828 14:22026307-22026329 GGGCAAAGCTAGGTGGGGCTGGG - Intergenic
1114587610 14:23828336-23828358 GGCTAGAACTGGGTGGGTCTGGG + Intergenic
1114628732 14:24146461-24146483 AGGCCAAGCTGGGTGGTTCAGGG - Intronic
1115008256 14:28512056-28512078 AGCCAAAGCAGGGTGGGGCATGG - Intergenic
1119846586 14:77834938-77834960 AGCCCAGCCTGGGTTGGTCTGGG - Intronic
1121737076 14:96225992-96226014 AGCCGTAGCTGGGTGTGTCCAGG - Intronic
1122804492 14:104249738-104249760 AGGGAAAGCTGTGTGGGCCTGGG + Intergenic
1122867932 14:104617581-104617603 AGCTAAAGCTGGGTGGGTAGGGG - Intergenic
1125368719 15:38947042-38947064 AGCCAAAGCTGAATGGGATTAGG + Intergenic
1125529866 15:40406057-40406079 AGCCAAGGCTGGGTGGGCGCTGG - Intronic
1125538044 15:40454073-40454095 ACCCAGAGCTGGGTGGGTAAGGG + Intronic
1127555261 15:60081470-60081492 GGCCATAGTTGGTTGGGTCTAGG - Intergenic
1129154161 15:73707383-73707405 ACCCAAAGCTGGGTAGGGCCAGG - Intronic
1129612810 15:77073871-77073893 AGCCAAATATGGTTAGGTCTCGG - Intronic
1130234492 15:82121590-82121612 AGCAAAAGCTGGTAGGGACTGGG + Intergenic
1130630927 15:85568401-85568423 ACCGAAAGATGGGTGGGTTTTGG + Intronic
1132842101 16:1983163-1983185 AGCCCAAGGTGGCAGGGTCTTGG - Intronic
1134009422 16:10840588-10840610 AGCCAAAGGTGTGTCGGTCGTGG + Intergenic
1134248355 16:12556696-12556718 AGCCAAAGGCCAGTGGGTCTTGG + Intronic
1139486706 16:67261221-67261243 AGCCAAGGCTGGAGGGATCTTGG - Intronic
1141717688 16:85736164-85736186 AGCCGAAGATGGGTGGGACCTGG + Intronic
1142469097 17:152827-152849 GGCCAAAGCTAGATGGGTCAAGG - Intronic
1142957297 17:3530615-3530637 AGCCACAGCTGGAGGAGTCTTGG - Intronic
1143460667 17:7101524-7101546 AGCCAGAGCTGGGCAGGTGTGGG + Exonic
1143545224 17:7591490-7591512 GGTCAAATCTGGGTGGGTCGAGG + Exonic
1143781553 17:9232045-9232067 AGCCAGAGGTGGGAGGGCCTCGG + Intronic
1144945381 17:18967031-18967053 AGCCAGGGCTGTGTGGCTCTTGG + Intronic
1145264548 17:21373513-21373535 ACCCAAAGCTGGGAGAGACTGGG + Intergenic
1148127223 17:45243076-45243098 AGGCGGAGCTGGGTGGGGCTGGG - Intronic
1148205268 17:45775831-45775853 AGCCACAGCAGGATGGGGCTGGG - Intergenic
1149168241 17:53779845-53779867 AGCAGAAGCAGGGTGGGGCTTGG + Intergenic
1152229676 17:79108191-79108213 AGCCGAAGGTAGGAGGGTCTTGG + Intronic
1152367828 17:79866967-79866989 AGCATAACCTGGGTGGGGCTGGG + Intergenic
1152745401 17:82036460-82036482 AACCCAAGCTGGCTGGGGCTGGG + Intronic
1153658372 18:7305195-7305217 TGTCAAAGCTGGGTGTTTCTGGG + Intergenic
1153844084 18:9033002-9033024 AGCCACAGCTGGGGTGGTCAAGG - Intergenic
1154073736 18:11178975-11178997 ACCCACAGCTGGCTGAGTCTAGG + Intergenic
1156652406 18:39239728-39239750 AGCCAAACAGGGTTGGGTCTGGG - Intergenic
1160727609 19:624541-624563 ACCCAGAGCTGGGAGGGTCTTGG - Intronic
1161750873 19:6095644-6095666 AGACCAAGCTGGGTGGAGCTCGG + Intronic
1161780202 19:6286617-6286639 AGCCAAAGCTGGGCAGATATCGG + Intergenic
1162524272 19:11198056-11198078 AGCAAAAGTTTGGTGGGTCTGGG - Intergenic
1163117374 19:15196490-15196512 GGCCCAAGCTGGGTGGGTCTGGG - Intronic
1164085674 19:21899937-21899959 AGCCGAAGCAGGGTGGGGCATGG - Intergenic
1166342656 19:42148176-42148198 GGGCAGGGCTGGGTGGGTCTTGG - Intronic
1166944426 19:46388289-46388311 AGCCCAGCCTGGGTGGGTGTTGG - Intronic
1167160960 19:47766739-47766761 ACCCAAAGCTGTGGTGGTCTAGG + Intergenic
1167677264 19:50895041-50895063 AGTGAGTGCTGGGTGGGTCTGGG - Intergenic
1168492446 19:56822006-56822028 TGCCCAAGCTGTGTGGGTCCAGG + Intronic
925798221 2:7569592-7569614 AGGCAAAGCTGGGTGATGCTGGG - Intergenic
926913895 2:17875768-17875790 AGAAAAAGCATGGTGGGTCTGGG + Intergenic
932669069 2:73720969-73720991 ACCCAAAGGTGCGTGGATCTGGG + Intergenic
933589710 2:84218685-84218707 GCCCAAAGCTGGCTGTGTCTGGG + Intergenic
933995040 2:87661969-87661991 AGCCAAAGCTGGGGGTGTTGGGG + Intergenic
936298820 2:111288944-111288966 AGCCAAAGCTGGGGGTGTTGGGG - Intergenic
937301643 2:120846372-120846394 AGCCATAACTGGCTGGGCCTGGG + Intronic
938323293 2:130380230-130380252 AGCAAGAGCAGGGTGGATCTAGG + Intergenic
940080612 2:149796563-149796585 AGCCAAAGCAGGGTGAGGCATGG - Intergenic
942268005 2:174247690-174247712 TGCCAAAGGTGGGAGGGACTTGG - Intronic
946532648 2:220589029-220589051 TGCCAAAGCTGGCTGGTTGTAGG - Intergenic
948298602 2:236884943-236884965 AGCCAACACTGGATGGGCCTGGG - Intergenic
1169003055 20:2182173-2182195 AGCTAAAGTTGGGTGGGGGTTGG + Intergenic
1169569712 20:6892509-6892531 AGGCAAAGCTGTGTGTGTGTTGG + Intergenic
1171283836 20:23922095-23922117 AGCCAGAGCTGGGGGACTCTAGG + Intergenic
1171381298 20:24736292-24736314 AGGCAAGTCTGGGTGGGCCTGGG - Intergenic
1172008368 20:31832335-31832357 AGCCCCAGATGGGTGGGGCTGGG - Intronic
1172871320 20:38137099-38137121 AGCCAAAGGTGGGAGCGTCCAGG - Intronic
1175103364 20:56596039-56596061 AGGAAAAGCTGGGTGGGTGGGGG - Intergenic
1175984844 20:62759482-62759504 AGCCCAGGCTGGGTGGGACACGG + Intronic
1176156632 20:63625499-63625521 GATCAAAGCTGGGTGGGTCTTGG - Intronic
1178284078 21:31310370-31310392 GGCCAAAGCTGGCTGGCTGTGGG - Intronic
1178843270 21:36155658-36155680 AGCCACAGCTGGGTGGGGACAGG + Intergenic
1179943796 21:44656943-44656965 ATCCCATGCTGGGGGGGTCTGGG - Intronic
1182177736 22:28309674-28309696 TGCCAAAGATGGGTGTCTCTAGG + Intronic
1182550729 22:31099512-31099534 AGCCTTAGCTGGGTGGCGCTGGG + Intronic
1182605639 22:31501031-31501053 AGGCCAAGGTGGGTGGGTCACGG - Intronic
1182750835 22:32640992-32641014 AGCTTAAGCTGGGTGTGCCTGGG + Intronic
1183040989 22:35177935-35177957 AGCCACAGGTCTGTGGGTCTGGG - Intergenic
1183466228 22:37981737-37981759 ATCCAGATCTGGGTGGGGCTTGG - Intronic
951129691 3:19027179-19027201 AGCCAAAAAGTGGTGGGTCTGGG + Intergenic
954256015 3:49406898-49406920 AGGCCAAGGTGGGTGGGTCACGG + Intronic
954456338 3:50601664-50601686 AGGCAAAGCTGGGTGGCCCTAGG - Intergenic
954623203 3:52007292-52007314 AGCCAAACCTGGGTGGGGGTGGG - Intergenic
954797380 3:53168440-53168462 AGCGAAAGGTGGATGGGCCTGGG + Intronic
954982656 3:54760442-54760464 AGCCAATTCAGGGAGGGTCTTGG + Intronic
955364357 3:58298662-58298684 GGCCAAAGCTGGCTGGGTCGGGG + Intergenic
957409398 3:79818040-79818062 AGCCACAGATTGGTGGATCTAGG + Intergenic
958094775 3:88929666-88929688 AGCCGAAGGAGGGTGGGGCTAGG + Intergenic
959170875 3:102842253-102842275 AGCCAAAGTAGGGTGGGGCATGG - Intergenic
959302631 3:104622356-104622378 AGCCAAAGCTAGATTGGCCTTGG - Intergenic
960845819 3:122003728-122003750 AGCCAAAGGTGGCTGGGAGTGGG + Intronic
961302269 3:125929862-125929884 ACCCACAGATGGGTGGGACTTGG - Intronic
961522592 3:127475582-127475604 AGCCCATGGTGGGTGGGGCTTGG - Intergenic
961662303 3:128475880-128475902 AGCCAGAGCTGGGGGAGGCTGGG - Intergenic
961871718 3:129993236-129993258 AGGCAAACCAGGGTGGGTCCTGG + Intergenic
962442127 3:135429884-135429906 AGGCAATGCTGGGGAGGTCTGGG - Intergenic
964717579 3:159738884-159738906 AGCCAAACATGGGTCGGTCTGGG + Intronic
964746992 3:160022009-160022031 AGTCAAGGCTGGGTAGGACTTGG - Intronic
965370440 3:167855599-167855621 AGGCAAAGGTGGGTGGTTCAAGG + Intergenic
966623077 3:181986654-181986676 AGCCAAAGCTGTCTGAGTCCAGG - Intergenic
966850345 3:184161013-184161035 AGCCAGAGCTGGATGGGAGTGGG + Intronic
967881261 3:194303374-194303396 AGCCAAAGGTGGGTTGGACAAGG + Intergenic
968812555 4:2806562-2806584 AGGCAAGGCGAGGTGGGTCTGGG - Intronic
968995381 4:3942074-3942096 ACCCACAGATGGGTGGGACTTGG + Intergenic
970743523 4:19266589-19266611 AGCAAAAGTTGGGTGGGGTTGGG + Intergenic
972418690 4:38867550-38867572 AGCCCAGGGCGGGTGGGTCTCGG - Intergenic
972869440 4:43279116-43279138 AGCTAAAGCTTTGTGGGTCTAGG + Intergenic
974847257 4:67365957-67365979 AGCCAAAGCCTACTGGGTCTTGG - Intergenic
975727201 4:77303553-77303575 AGCCAAAGCAGGGTGGGGCGTGG - Intronic
979364431 4:119803469-119803491 AGCCTAAGTTGGATGGGGCTGGG + Intergenic
981354657 4:143774408-143774430 GGGGAAAGCTGGGTGGGGCTGGG + Intergenic
983290488 4:165798001-165798023 AACCAAAGCTGCTTGGGTCAAGG - Intergenic
986920604 5:12674556-12674578 AGCCTAAGCAGGGTGGGGCGTGG - Intergenic
988010163 5:25471696-25471718 TGCCAATGTTGAGTGGGTCTTGG + Intergenic
990937085 5:61162554-61162576 CGCCATTGCTGTGTGGGTCTTGG + Intergenic
992761759 5:79956655-79956677 GGCCCAGGCTGGGTGTGTCTGGG - Intergenic
994720261 5:103372232-103372254 AGCCAGATATGGGTTGGTCTGGG + Intergenic
995542876 5:113201518-113201540 AGCAAAAGCTAGTTGGTTCTTGG - Intronic
996646778 5:125826844-125826866 AGACAAAGCAGGGTGTGACTGGG - Intergenic
997899498 5:137752771-137752793 AGCAAAACCTGGGTGGGGGTTGG - Exonic
998252104 5:140560411-140560433 GGCCAAAGGTGTGTGGGTCGCGG + Exonic
998580240 5:143366216-143366238 AACCAAAGCTGGGTTGGGCACGG + Intronic
998617018 5:143751920-143751942 AGCCATAGGTGGGTGGGAGTTGG - Intergenic
998682219 5:144481403-144481425 AGCCACCCCTGGGTGAGTCTAGG - Exonic
999388566 5:151173716-151173738 AGAGAAAACAGGGTGGGTCTGGG - Intergenic
999932734 5:156451178-156451200 TGCCATAGATGTGTGGGTCTGGG + Intronic
1001104614 5:168842674-168842696 AGACACACCTGGGTGGGGCTTGG - Intronic
1002382169 5:178838910-178838932 GGCCAAGGCTGGGTGGGGCCTGG + Intergenic
1002648554 5:180674355-180674377 GGCCAAGGCTGGGTGGGGCCTGG - Intergenic
1002790479 6:434179-434201 AGCAAAAGCATGCTGGGTCTAGG - Intergenic
1005867750 6:29948946-29948968 AGCAGTAGCTGGGTGGGCCTTGG - Intergenic
1006108510 6:31730373-31730395 GGCCAGATCTGGGTGGGCCTGGG - Intronic
1006455018 6:34126705-34126727 AGCAACAGCTGGGCTGGTCTTGG - Intronic
1009610141 6:65930923-65930945 AGCCAGAGCTGGGTAGATATTGG - Intergenic
1010470060 6:76216967-76216989 AGCCAAAGCTGCATGGGCTTTGG + Intergenic
1013850277 6:114505215-114505237 AGCCATAGCTGGGTGGGTGAAGG + Intergenic
1015823178 6:137284316-137284338 AGCTTATGCTGGGTGGGTGTGGG + Intergenic
1016734863 6:147467015-147467037 AGCCTGAGCTGGGTGGGGTTTGG - Intergenic
1017002621 6:150006427-150006449 GGGCATAGCTTGGTGGGTCTGGG + Intergenic
1018954114 6:168396543-168396565 GGCAGAAGCCGGGTGGGTCTGGG - Intergenic
1022112265 7:27239124-27239146 AGCCGGAGGTGGGTGGTTCTGGG - Intergenic
1022324656 7:29320275-29320297 AGCCACAGTTTGGTGGCTCTGGG - Intronic
1029421211 7:100472711-100472733 TGCCAGTGCTGGGTGGGGCTGGG - Intronic
1029513940 7:101014208-101014230 ACCCAGGGCTGGGAGGGTCTGGG - Intronic
1031602041 7:123721983-123722005 CTCCAAAGCTGGGTGGCTTTGGG + Intronic
1032000927 7:128264905-128264927 AGGCAAGTCTGGGAGGGTCTGGG + Intergenic
1033504970 7:141990858-141990880 AGCCATAGCTGGGTGGAAGTGGG - Intronic
1037565210 8:20112280-20112302 AGCAAGAGGTGGCTGGGTCTGGG - Intergenic
1040400144 8:47042116-47042138 AGCTAAAGGTGGGTGGGTTATGG - Intergenic
1042020786 8:64370185-64370207 AGCCAAAGCGCAGCGGGTCTGGG - Intergenic
1046821682 8:118640554-118640576 AGCCAGAGCTGGGTGAGAGTTGG + Intergenic
1048547941 8:135404633-135404655 ATCCAAAGCTGGCTGAGTCCAGG + Intergenic
1057263831 9:93601218-93601240 AGCCAAACCTGGGTGGGCCCCGG - Intronic
1057304878 9:93906276-93906298 AGACACAGTTAGGTGGGTCTAGG - Intergenic
1058957220 9:109960258-109960280 AGCGAAAGGTGGGTGGGTGCAGG - Intronic
1060916937 9:127397421-127397443 AGCCGAAGCTGAGTGGGCCCAGG - Exonic
1060945658 9:127568410-127568432 AGCGCGAGCTGGCTGGGTCTGGG + Intronic
1061070974 9:128310526-128310548 GGCCTGAGCTGGGTGGGACTGGG + Intronic
1062067609 9:134537207-134537229 CTACAGAGCTGGGTGGGTCTGGG + Intergenic
1187280433 X:17854643-17854665 AGCCAAGACTGGGTGTGTTTGGG - Intronic
1188143925 X:26586544-26586566 GGGCAAAGCTGGGTGGGAGTTGG + Intergenic
1188872290 X:35387846-35387868 AGCCATAGATTGGTGGGTCCAGG - Intergenic
1188985093 X:36762029-36762051 AGCCAAAGTTGTATGGGTGTGGG - Intergenic
1189236603 X:39491788-39491810 AGGCTAAGCAGGGTGGGTCGAGG - Intergenic
1191150094 X:57211423-57211445 GGGCAAAGCTGGGTGGGGCTAGG - Intergenic
1191169196 X:57423752-57423774 GGGCAAAGCTGAGTGGGACTGGG - Intronic
1193613369 X:83659166-83659188 AGAAAAGGCTGGGTAGGTCTGGG + Intergenic
1195112057 X:101658834-101658856 AGCAAAAGCTGGATGGGACGCGG + Intronic
1195828824 X:109033024-109033046 AGCCACAGCAGGGTAGGGCTAGG - Intergenic
1196806260 X:119589556-119589578 AGTCAAATCTGTGTGGCTCTCGG + Exonic
1198591179 X:138184246-138184268 ATCCAAGGCTAAGTGGGTCTTGG + Intergenic
1199722305 X:150550740-150550762 AGCCCATGCCGGCTGGGTCTTGG - Intergenic