ID: 1105295968

View in Genome Browser
Species Human (GRCh38)
Location 13:19088165-19088187
Sequence TGGGTCTCGGCCAGTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105295959_1105295968 25 Left 1105295959 13:19088117-19088139 CCTGGGCTGGGGTCCCTGGCTGC 0: 1
1: 0
2: 9
3: 81
4: 602
Right 1105295968 13:19088165-19088187 TGGGTCTCGGCCAGTCTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 114
1105295960_1105295968 12 Left 1105295960 13:19088130-19088152 CCCTGGCTGCATATGTGTAGACA 0: 1
1: 0
2: 1
3: 8
4: 158
Right 1105295968 13:19088165-19088187 TGGGTCTCGGCCAGTCTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 114
1105295958_1105295968 26 Left 1105295958 13:19088116-19088138 CCCTGGGCTGGGGTCCCTGGCTG 0: 1
1: 1
2: 11
3: 53
4: 527
Right 1105295968 13:19088165-19088187 TGGGTCTCGGCCAGTCTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 114
1105295956_1105295968 29 Left 1105295956 13:19088113-19088135 CCACCCTGGGCTGGGGTCCCTGG 0: 1
1: 0
2: 2
3: 71
4: 534
Right 1105295968 13:19088165-19088187 TGGGTCTCGGCCAGTCTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 114
1105295961_1105295968 11 Left 1105295961 13:19088131-19088153 CCTGGCTGCATATGTGTAGACAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1105295968 13:19088165-19088187 TGGGTCTCGGCCAGTCTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105295968 Original CRISPR TGGGTCTCGGCCAGTCTGCA TGG Intergenic
900389257 1:2427001-2427023 TGGGCCTCTGCCACTCTGCCAGG - Intronic
906489573 1:46257750-46257772 TGGGTCTGGGCTGATCTGCATGG + Intronic
907524641 1:55047000-55047022 AGGATCTGGTCCAGTCTGCAGGG - Intronic
912804237 1:112743280-112743302 TGGGTCCCGGGTAGGCTGCAGGG + Intergenic
913608956 1:120492279-120492301 TGGGCCTGTGCTAGTCTGCATGG - Intergenic
914380087 1:147107998-147108020 TGCATCTCAGCCTGTCTGCATGG + Intergenic
915086929 1:153395364-153395386 TGGGTGGGAGCCAGTCTGCAGGG - Intergenic
915325956 1:155081177-155081199 TAGGTCGCGGCCGGTGTGCAAGG - Intronic
916471703 1:165129889-165129911 TCTGCCTCTGCCAGTCTGCAGGG - Intergenic
919160325 1:193821585-193821607 AGTGTCTCGGTCAGTTTGCAAGG + Intergenic
1066616330 10:37298727-37298749 TGGATCATGGCCAGCCTGCAGGG + Intronic
1066674807 10:37876837-37876859 TGGGTTTCTGCCAGTCTGATAGG + Intergenic
1069933988 10:71902538-71902560 TGGGTCTTGGTCACACTGCATGG - Intergenic
1071326477 10:84523689-84523711 TGGCTCTCTGCCAGGCTGGAGGG + Intergenic
1074063879 10:109994784-109994806 TGGGTCATGGCCAGACTTCAGGG + Intergenic
1075642638 10:124075791-124075813 TGAGTCTGGGCCAGCCTGCAGGG + Intronic
1077215332 11:1393114-1393136 TGTGTCTCGGCATCTCTGCAGGG - Intronic
1077309057 11:1880504-1880526 GGGGGCTCGGCCAGGCTGCGTGG - Intronic
1081615890 11:44591048-44591070 TGGATCTTGGCCAGTGTGCCTGG + Intronic
1081621803 11:44623132-44623154 TGGGTCTCTGTCCTTCTGCAGGG - Intergenic
1088647832 11:111931139-111931161 GGGGTCTCGGCCAGTCACGATGG - Intronic
1089640588 11:119844941-119844963 TGGGTCTCGGCCAGTGGATAGGG - Intergenic
1089970296 11:122688010-122688032 GGGGTCTGGGCCACTCGGCATGG + Intronic
1090395669 11:126416520-126416542 TGGGTCTCACCCAGGCTGCTGGG + Intronic
1091398535 12:169167-169189 TGGGTCCTGGGCAATCTGCAGGG + Intronic
1095506605 12:42905460-42905482 TGGGTCAGGGCCAGCCTTCAGGG + Intergenic
1101602682 12:106224230-106224252 AGGTTCTAGGCCAGACTGCATGG - Intergenic
1101998111 12:109539566-109539588 TGGTTCACGGCAAGACTGCATGG - Intergenic
1102566209 12:113799006-113799028 TGGATCTCGGCCACAGTGCAGGG + Intergenic
1103918240 12:124386783-124386805 CCGGTCTCGGCCTGTCTGCCCGG + Intronic
1105295968 13:19088165-19088187 TGGGTCTCGGCCAGTCTGCATGG + Intergenic
1111837757 13:93410010-93410032 TGGATGTAGGCCAGTCTCCAGGG - Intronic
1113385457 13:109843808-109843830 TGGGTCTTGGCCAGTGTTGAAGG + Intergenic
1118362918 14:65070931-65070953 TGGCTCTGAGCCAGCCTGCAAGG + Intronic
1120319133 14:82936620-82936642 TCAGTATCGGCCAGTCTGGATGG + Intergenic
1122961586 14:105096364-105096386 TGGGCCAGGGCCAGGCTGCACGG - Intergenic
1123105973 14:105841210-105841232 TGTGGCTCGGACACTCTGCAGGG + Intergenic
1125752207 15:42036682-42036704 TGGGCCCCGGCCAGTGTCCAGGG - Intronic
1125841818 15:42808823-42808845 GGGGTCTCGGTCTGTCAGCAAGG - Intronic
1130107783 15:80942115-80942137 TGGGTCTGGGCCCGACTGGACGG - Intronic
1133680850 16:8118506-8118528 TGGGACTCGGCCTGGCTGCCTGG - Intergenic
1137579089 16:49622465-49622487 TGGGTTTCTGCCAGGCTGCGAGG - Intronic
1142224699 16:88871819-88871841 GGGGTCTCGGGGAGGCTGCATGG + Intergenic
1143646880 17:8235958-8235980 TGGACCTCGGCCTGTTTGCAGGG - Exonic
1143890933 17:10101875-10101897 TGGTTCTTGGCCAGGCTGCCTGG + Intronic
1145061259 17:19735737-19735759 TTGGCCTCAGCCACTCTGCAGGG + Intergenic
1147038848 17:37701769-37701791 TGGAACTCAGCCAGTCTGCGAGG + Intronic
1147759413 17:42787861-42787883 TGGGACTCAGCCAGGCTGGATGG - Exonic
1148995507 17:51705867-51705889 GGGGTCTCTGCCACTGTGCAAGG + Intronic
1150141939 17:62737592-62737614 TGGGGCTGGGCCAGTCTTCCGGG - Intronic
1150491413 17:65576955-65576977 TGGTGCCAGGCCAGTCTGCAAGG - Intronic
1151242402 17:72768467-72768489 TGGGGCTCTTCCAGTCTGCCTGG - Intronic
1151680331 17:75619644-75619666 TGGGTCTCGGGCAGTCTCCTGGG - Intergenic
1153634863 18:7104860-7104882 TGGGCCTGGGCCCGTCTGCAGGG - Intronic
1157346244 18:46837284-46837306 TCGGTCTCTGCCAATCTGGAAGG + Intronic
1160522429 18:79515503-79515525 TGGTCCCCGGCCAGGCTGCAGGG - Intronic
1160989448 19:1854502-1854524 GGGCTCCCGGCCAGGCTGCAGGG + Exonic
1161267741 19:3372624-3372646 TGGGACTCGGAGAGTGTGCACGG + Intronic
1161364228 19:3868904-3868926 GGGGTCCCGGCCAGGCTGCAGGG + Intronic
1163426289 19:17242725-17242747 TGGGCCTCTGCCTGCCTGCAGGG - Intronic
1163602977 19:18259788-18259810 TGAGTCACGGCCAGTCTGTTGGG + Intronic
1164179730 19:22807740-22807762 TGGGTCGCGCCCACCCTGCAGGG - Intergenic
1166183372 19:41123941-41123963 TGTGTGTGGGCCAGGCTGCATGG - Intronic
1166518497 19:43464188-43464210 AGGGTCCCGGCCAGGCTGAAAGG + Intronic
1167534598 19:50041722-50041744 TGGGTCTTGGGGGGTCTGCAGGG - Exonic
929094690 2:38252096-38252118 GAGGTCTCAGCCAATCTGCAGGG - Intergenic
932498496 2:72159739-72159761 TCTGTCTAGGCCAGTCTCCATGG + Intergenic
933374977 2:81467452-81467474 TAGGTCTCGGGGCGTCTGCAGGG + Intergenic
941935081 2:170975646-170975668 TGCTGCTCTGCCAGTCTGCAGGG - Intergenic
945452525 2:210009902-210009924 TGGGCCTTGGCTAATCTGCATGG + Intronic
948705129 2:239786253-239786275 GTGGTCTCAGCCAGTTTGCAAGG + Intronic
948882711 2:240868675-240868697 CGGGTCACGGCCAGGCAGCAGGG - Exonic
1170348650 20:15416109-15416131 TGGGGAGCAGCCAGTCTGCAAGG - Intronic
1173169968 20:40715995-40716017 TGGGTCTGTGCTTGTCTGCAGGG + Intergenic
1175823718 20:61925259-61925281 GGGGGCTCGGCCAGTTCGCAGGG - Intronic
1184604142 22:45562621-45562643 TGGGGCTCTGCCAGTGAGCAGGG + Intronic
1185167588 22:49271202-49271224 TGGGTCTCTGCAAGTCTTCCAGG - Intergenic
949539121 3:5018466-5018488 TGGGCCTGTGCCAGTTTGCATGG + Intergenic
949847331 3:8385033-8385055 TTGGTCTCTGCCAGTCTTAATGG + Intergenic
954440884 3:50521423-50521445 TGGGGCTAGACCAGACTGCAGGG - Intergenic
955015317 3:55064221-55064243 TGGGGCACAGCCAGTCTACAAGG + Intronic
955091890 3:55760693-55760715 GGTGTCTCTGCTAGTCTGCATGG + Intronic
958803738 3:98784861-98784883 TGGGTTTCTGACAGTATGCATGG + Intronic
959023183 3:101211449-101211471 TGGGTCTCAGACTGACTGCATGG - Intergenic
961599807 3:128052075-128052097 AGGGTCTCCGCCTGCCTGCAGGG + Intronic
963220762 3:142809241-142809263 TGGGACTCGGTCTGTCTTCATGG - Intergenic
966147247 3:176826077-176826099 ACGGTCTCTGCCAGCCTGCAAGG + Intergenic
968267564 3:197374203-197374225 TGGGTCTCCTCCAGGCTGCAGGG + Intergenic
969088208 4:4672131-4672153 CGGGTGTGGGCCAGTGTGCAGGG + Intergenic
973729448 4:53809746-53809768 ATGGTCTCTGCCAATCTGCAAGG - Intronic
974624054 4:64399601-64399623 TGGGTCTAGGCAAGGCAGCAGGG - Intronic
984989577 4:185366931-185366953 ATGGTCTCGGCCAGTCTGTAGGG + Exonic
986558284 5:9033731-9033753 TGGGTCTCAGTCTGACTGCAGGG + Intergenic
987999446 5:25330519-25330541 TGGGCCTTGGCCAGTGTCCAGGG - Intergenic
992256434 5:74925709-74925731 TGGCTCTCGCCCAGGCTGGAGGG + Intergenic
1001756596 5:174175114-174175136 TGGGTCTCTGCGTGACTGCATGG - Intronic
1002764756 6:229310-229332 TGGGTCTCAGCCAGTTTCAATGG + Intergenic
1006387335 6:33738695-33738717 TGCGTCCCGGCCACACTGCAGGG + Intronic
1006937109 6:37726128-37726150 TGGGTGTCAGCCAGTTTGCCTGG - Intergenic
1013466376 6:110420565-110420587 TTGGTCTTGGCCAGTGGGCATGG - Intergenic
1013535632 6:111060851-111060873 TGGGTCTCCTCTAGTCAGCAGGG - Intergenic
1017949670 6:159126210-159126232 TGGGTGTCTTCCAGTCTGCCTGG - Intergenic
1018619487 6:165716088-165716110 TGGGCTTCATCCAGTCTGCAAGG - Intronic
1020078967 7:5276346-5276368 TGGGGCTCAGCGAGTTTGCAAGG + Intronic
1025199926 7:56955832-56955854 TGGGGCTCAGCGAGTTTGCAAGG - Intergenic
1025672020 7:63621100-63621122 TGGGGCTCAGCGAGTTTGCAAGG + Intergenic
1027631395 7:80610606-80610628 TCTGTCTCGCCCAGGCTGCAGGG + Intronic
1030076255 7:105739506-105739528 TGGTTCTGGCCCAGACTGCAAGG - Intronic
1033598015 7:142870377-142870399 TGGGTCCCCGCCAGCCTGCAGGG - Exonic
1035382399 7:158448174-158448196 TGTGTCTGGGCCACTCTGCTGGG - Intronic
1035740432 8:1924155-1924177 TGGCTCACGGCCAGGCTCCACGG - Intronic
1036848499 8:12185778-12185800 TGGTTCTCGGCCTGTCTAGAGGG + Intronic
1036869859 8:12428059-12428081 TGGTTCTCGGCCTGTCTAGAGGG + Intronic
1040872468 8:52114697-52114719 TGGGTAAAGGCCACTCTGCAGGG + Intronic
1048982162 8:139708430-139708452 GGGGTCTAGTCCAGTCTGCAGGG - Intergenic
1052817566 9:33113381-33113403 TGTGTCTCTGCCAATCTGCTGGG - Exonic
1054867872 9:70021114-70021136 TGGCTCTGGGCCAGCCTGCTGGG - Intergenic
1055017908 9:71638903-71638925 TGGGTGTTGGTCATTCTGCAGGG + Intergenic
1057263828 9:93601205-93601227 TGGGCCCCGGCCAATCTGCACGG - Intronic
1057885278 9:98824922-98824944 TGGTTCTGGGCCACACTGCACGG + Intronic
1058013450 9:100003879-100003901 TGGTTCTAGGCCAGTCTCCATGG - Intronic
1060091736 9:120748874-120748896 GGGGTATCAGCCACTCTGCATGG - Intergenic
1186641640 X:11461914-11461936 TGGGCTTCAGGCAGTCTGCAGGG - Intronic
1199862515 X:151814721-151814743 TGGATCTGTGCCAGTCTGCAAGG - Intergenic
1202369551 Y:24187652-24187674 TGGGTCACCGCCAGTATGGATGG + Intergenic
1202501234 Y:25482465-25482487 TGGGTCACCGCCAGTATGGATGG - Intergenic