ID: 1105298565

View in Genome Browser
Species Human (GRCh38)
Location 13:19113096-19113118
Sequence CCATCACAAGGTAAGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105298565_1105298573 30 Left 1105298565 13:19113096-19113118 CCCAGTTTCTTACCTTGTGATGG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1105298573 13:19113149-19113171 CTAGAAGCAGAAAAAAAAAATGG 0: 1
1: 0
2: 30
3: 270
4: 2753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105298565 Original CRISPR CCATCACAAGGTAAGAAACT GGG (reversed) Intergenic
902193551 1:14781020-14781042 ACATTAAAAGGCAAGAAACTTGG + Intronic
902284850 1:15401038-15401060 CCTTCACAAGGAAGGGAACTGGG - Intergenic
904761926 1:32811482-32811504 CCATCACAAGGTGATAGACGCGG - Intronic
905094956 1:35462247-35462269 TCATAGCAAGGTAAGTAACTGGG - Intronic
907023459 1:51091607-51091629 CCATGACAATGAGAGAAACTTGG + Intergenic
907066628 1:51490646-51490668 TAATCACAAGGTCAGATACTAGG + Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
908036867 1:60064168-60064190 CCATCACAAGGTGAAGAACAAGG - Intronic
909130949 1:71736691-71736713 TCATCACAAGGTAATATCCTGGG - Intronic
909641807 1:77876555-77876577 ACATCTGAAGGTATGAAACTTGG + Exonic
910004828 1:82383578-82383600 CCATCAGAAGCTAAGAAGCAAGG - Intergenic
911025594 1:93433243-93433265 CCATCTCAAAATAAAAAACTGGG + Intergenic
911235357 1:95406136-95406158 CCATCCCAAGGGAAGAATCAGGG - Intergenic
911715789 1:101131361-101131383 CCTGAGCAAGGTAAGAAACTGGG - Intergenic
912605664 1:110986293-110986315 CCATGACAAGGTAAGGATCTGGG + Intergenic
912630397 1:111241953-111241975 CCATAATAAGGGAAGAAACTAGG - Intronic
913813791 1:122936239-122936261 ACAACACAAGGTAAGTTACTGGG - Intergenic
913816985 1:122993007-122993029 ACAACACAAGGTAAGTTACTGGG - Intergenic
913826376 1:123161074-123161096 ACAACACAAGGTAAGTTACTGGG - Intergenic
913826760 1:123167874-123167896 ACAACACAAGGTAAGTTACTGGG - Intergenic
913841096 1:123424448-123424470 CCAACACAAGGGAAGTTACTGGG - Intergenic
913850128 1:123587411-123587433 ACAACACAAGGTAAGTTACTGGG - Intergenic
913851687 1:123614949-123614971 ACATCACAAGGAAAGTTACTGGG - Intergenic
913854463 1:123664920-123664942 CCAACACAAGGGAAGTTACTGGG - Intergenic
913872911 1:123996291-123996313 CCAACACAAGGGAAGTTACTGGG - Intergenic
913894682 1:124385738-124385760 ACAACACAAGGTAAGTTACTGGG - Intergenic
913903257 1:124539691-124539713 CCAACACAAGGGAAGTTACTGGG - Intergenic
913906259 1:124593400-124593422 ACAACACAAGGTAAGTTACTGGG - Intergenic
914964843 1:152246680-152246702 GCATGCCAAGGTAAGAAATTTGG - Intergenic
916297527 1:163236521-163236543 CCATCAGAAGGTTTGGAACTAGG - Intronic
919588667 1:199471302-199471324 CCAAGAAAAGGTAAGAAACTGGG + Intergenic
1067399097 10:45954666-45954688 CCATCTCAAGGGAAGAATCAGGG + Intergenic
1067550758 10:47234220-47234242 CCACCTGAAGTTAAGAAACTTGG - Intergenic
1067867418 10:49923882-49923904 CCATCTCAAGGGAAGAATCAGGG + Intronic
1068518844 10:58057127-58057149 CCATCCCAAGGGAAGAATCAGGG - Intergenic
1068543062 10:58317621-58317643 ACAACAAAATGTAAGAAACTTGG - Intergenic
1068654511 10:59560813-59560835 CCATCTAAGGGTAAGAAAATGGG + Intergenic
1069027159 10:63555118-63555140 TCATCAAAAGCTATGAAACTTGG - Intronic
1071761918 10:88617190-88617212 CCATGACAGAGTAAGAAACATGG + Intergenic
1071829000 10:89353444-89353466 CCAACCCAAGGGAAGAAACAGGG + Intronic
1071889445 10:89986937-89986959 TAATCACAATGTAAGAAGCTAGG - Intergenic
1076942800 10:133621050-133621072 TGATCACAAGATAAAAAACTTGG + Intergenic
1077515831 11:3001617-3001639 CTATGACAAAGGAAGAAACTGGG + Intronic
1077839207 11:5955649-5955671 CCATCCCAAGGGAAGAACCAGGG - Intergenic
1078216821 11:9318679-9318701 CCATCCCAAGGGAAGAATCAGGG - Intergenic
1078290434 11:10005367-10005389 CCACCCCAAGGGAAGAATCTGGG + Intronic
1078709322 11:13775713-13775735 CCATAACAATGTAAAAAACTGGG + Intergenic
1079820875 11:25126360-25126382 CCATCACAAGTGAACAAATTTGG - Intergenic
1080435237 11:32234449-32234471 CCTTCTCCAGGTGAGAAACTTGG - Intergenic
1081837203 11:46165560-46165582 GCATGACAATGTGAGAAACTTGG - Intergenic
1081946789 11:47003008-47003030 TCATCAAAAGTTAAGAAACTAGG + Intronic
1082943012 11:58727882-58727904 CCACCACAAGGGAAGAATCAAGG + Intronic
1083065476 11:59919244-59919266 CAATAACAAGGTAAAAAAATTGG + Intergenic
1085032019 11:73277656-73277678 GCATGACAAGGTAAGGAACCTGG + Intronic
1086451709 11:86923775-86923797 CCCACAGAAGTTAAGAAACTTGG + Intronic
1086916733 11:92538367-92538389 CTATACCAAGTTAAGAAACTTGG - Intronic
1095287295 12:40429440-40429462 TCATCACAAGTTAAGACATTTGG - Intronic
1099673652 12:85728714-85728736 AGCTCACAAGGCAAGAAACTGGG - Intergenic
1101219926 12:102627997-102628019 CCATCCCAAGGCAAGAATCAAGG + Intergenic
1101445554 12:104734597-104734619 CCATGGCAAAGTAAGAAACATGG - Intronic
1102636387 12:114328103-114328125 CCATCACAAGCTCTGAAGCTGGG - Intergenic
1103613069 12:122135696-122135718 GCATCGCAAGGGAAGTAACTGGG + Intronic
1105298565 13:19113096-19113118 CCATCACAAGGTAAGAAACTGGG - Intergenic
1109756856 13:66772610-66772632 CCATAACATGGTATGAATCTTGG + Intronic
1109997503 13:70148076-70148098 CCTTCACATGATAAGAACCTTGG - Intergenic
1112537795 13:100277429-100277451 ACATCACAGGGTAAGAATATAGG - Intronic
1114795200 14:25707058-25707080 CCCCCAAAAGGAAAGAAACTTGG + Intergenic
1115306937 14:31943486-31943508 TCATCACAAGAAAAGAAACAGGG - Intergenic
1115643145 14:35348183-35348205 CCATTACAAGGTGATAGACTTGG - Intergenic
1115887888 14:37994105-37994127 CCATCCCAAGGGAAGAATCAGGG + Intronic
1116822617 14:49640209-49640231 ACATCATATAGTAAGAAACTTGG - Intergenic
1122587425 14:102818826-102818848 TCATCACAAGAAAAGGAACTTGG + Intronic
1127279763 15:57478937-57478959 CCCTAATAAGGTAAGAATCTGGG - Intronic
1130506159 15:84544333-84544355 CCTTCACAAGATAAAAAACAAGG - Intergenic
1131748545 15:95478538-95478560 CCCTCCCAAGGTCAGAGACTGGG + Intergenic
1132035579 15:98481075-98481097 CCATCACATGGTAACAAAACAGG + Intronic
1132548176 16:543257-543279 CCATCCCGAGGTCTGAAACTCGG - Intronic
1134264692 16:12683150-12683172 CCATCAAAACGTAAGGACCTTGG + Intronic
1134921710 16:18122660-18122682 CCACTACAAGGGATGAAACTGGG + Intergenic
1138330215 16:56207898-56207920 CCATCACTAGGTAAAAAAGTAGG + Intronic
1140900216 16:79360156-79360178 CCATCACAAGCTTGGAAACAGGG - Intergenic
1144721982 17:17477256-17477278 TCATCAAATGGTAAGAACCTAGG + Exonic
1146590080 17:34121287-34121309 CCATCACAAAGCCACAAACTGGG - Intronic
1149762428 17:59244217-59244239 CCATCCCAAGGGAAGAATCAAGG - Intronic
1154467193 18:14658338-14658360 CCATCACAAGGTGATAGACCTGG + Intergenic
1158785748 18:60710196-60710218 CCATCATAAAGTCAGAAAGTTGG + Intergenic
1158971674 18:62673993-62674015 CTATCACTAGGTTAGAAATTGGG + Intergenic
1159207111 18:65267016-65267038 GCATAACAAGGTTAGAAGCTGGG - Intergenic
1162420689 19:10564659-10564681 CCACCACCAGGTAATAACCTAGG + Intronic
1164531828 19:29054779-29054801 ACATCATAAGGAAAGAAACCAGG - Intergenic
925121542 2:1422152-1422174 GTATCACACTGTAAGAAACTGGG + Intronic
925530157 2:4850448-4850470 CCATCCCCAGGCAAAAAACTTGG - Intergenic
928771341 2:34705423-34705445 CCATGACAAAGTAAAAAATTTGG + Intergenic
930772343 2:55140883-55140905 CCATAACAAATTAACAAACTGGG + Intergenic
930772351 2:55140960-55140982 CCATAACAAATTAACAAACTGGG + Intergenic
935832495 2:107014858-107014880 CAATCACAAGGTCCCAAACTAGG - Intergenic
938330595 2:130445636-130445658 CCATCACAAGGACAGAAATAAGG + Intergenic
938359349 2:130675867-130675889 CCATCACAAGGACAGAAATAAGG - Intergenic
939111762 2:138017125-138017147 GAATCACAAGGTCAGAAACTAGG - Intergenic
939497618 2:142942818-142942840 CCATCCCAAGGGAAGAATCAGGG - Intronic
940304117 2:152207390-152207412 GCATCACAAGGAATGAATCTGGG - Intergenic
945809013 2:214525332-214525354 CATTCCCAAGGTAAGCAACTCGG + Intronic
947401242 2:229733467-229733489 CCACCACAAGGGAAGAATCAGGG - Intergenic
947691580 2:232141748-232141770 CCACCACAAGGTGAAAAGCTAGG - Intronic
948955920 2:241291251-241291273 CCATCTCACGGCAAGAGACTGGG + Intronic
1169774729 20:9240147-9240169 CCATCACATAGTAATAAACTGGG + Intronic
1171177048 20:23060021-23060043 CCATCCCAAGGGAAGAATCAGGG + Intergenic
1171312504 20:24156144-24156166 TCATCAAATGGGAAGAAACTGGG - Intergenic
1171456347 20:25274880-25274902 CCATCAAAGTGTAAGAGACTGGG - Intronic
1172885994 20:38231189-38231211 CCATCCCCAGGTAAGGATCTGGG - Exonic
1173406679 20:42772352-42772374 CCATCACAGAGTAAGACTCTGGG - Intronic
1173629380 20:44499292-44499314 CCTTCTCTAGGTAAGACACTTGG - Exonic
1176807322 21:13499341-13499363 CCATCACAAGGTGATAGACCTGG - Intergenic
1176951600 21:15053860-15053882 TCTTCACAAAGCAAGAAACTAGG + Intronic
1180288924 22:10778980-10779002 GCATCACAATGTTAAAAACTTGG + Intergenic
1180674857 22:17580235-17580257 CTTTCACAAAGGAAGAAACTTGG - Intronic
1184261264 22:43318109-43318131 CCATGACAAAGTAACAAACTAGG - Intronic
951756972 3:26101690-26101712 CCATCCCAAGGGAAGAATCAGGG - Intergenic
952610925 3:35207508-35207530 ACATTACAAGGAAGGAAACTAGG - Intergenic
953093516 3:39752861-39752883 CCATCCCAAGGGAAGACACTTGG + Intergenic
955616126 3:60808695-60808717 CCTTTACAAGGAAAGTAACTTGG - Intronic
956460751 3:69469510-69469532 CATACACAAGGTAATAAACTGGG - Intronic
957498268 3:81018746-81018768 GCATAACTAGGTAAAAAACTTGG - Intergenic
959053903 3:101550567-101550589 CCATCCTAAGGGAAGAAACATGG + Intergenic
959081540 3:101806897-101806919 CCAACACAAAATAATAAACTGGG - Intronic
960708679 3:120505892-120505914 CCATCCCAAGGGAAGAATCGGGG + Intergenic
963610879 3:147466373-147466395 CCAGCACTAGGAAAGAAACAAGG - Intronic
964666258 3:159177241-159177263 CCCACACAATATAAGAAACTGGG + Intronic
964695002 3:159497494-159497516 ACATTACAAGGGAAGAAACTGGG + Intronic
966454612 3:180101193-180101215 GCATCACAATTTAAGAAACTTGG - Intergenic
967782268 3:193452490-193452512 CCATCACAAAGTGAGAGAGTTGG + Intronic
968761321 4:2443921-2443943 CTATCAGAAGGGAAAAAACTGGG - Intronic
970370270 4:15398932-15398954 CCATCCCAAGGGAAGAATCAGGG - Intronic
971399447 4:26262572-26262594 CCAACACAAAGGAAGAATCTAGG - Intronic
974101132 4:57418438-57418460 CCTTCAAAAGGTAGGAAACTTGG + Intergenic
977397191 4:96485378-96485400 TCATCAGAAAGTTAGAAACTAGG - Intergenic
977654722 4:99507569-99507591 CAATAACAAGGTAAGCAACCGGG + Intergenic
977720618 4:100236220-100236242 CCATTACTAGGTAAAAAAATCGG - Intergenic
978290773 4:107136991-107137013 TCATGACAAAGTAAGAAAATAGG - Intronic
978581260 4:110233406-110233428 CCATCAAAAGATTAGAACCTGGG + Intergenic
978833189 4:113114246-113114268 CCATCCCAAGGAAAGATACCTGG + Intronic
979656148 4:123196726-123196748 CTATCAAACGGTAACAAACTTGG - Intronic
980798391 4:137714885-137714907 CCATCCCAAGGGAAGAATCGGGG + Intergenic
980854520 4:138423627-138423649 CCCTCAAAAGGCAGGAAACTGGG - Intergenic
982475456 4:155844427-155844449 CCATCACTAGGTAAGAAAACTGG + Intronic
983349115 4:166564371-166564393 CCATCTCAAGGGAAGAATCACGG - Intergenic
983742390 4:171151596-171151618 CTACCACAAGGAAAGAAACACGG - Intergenic
984283806 4:177704323-177704345 TAATCACAATGTAAGAAACCAGG - Intergenic
985342160 4:188966253-188966275 TCATCAATACGTAAGAAACTAGG - Intergenic
985912287 5:2893791-2893813 CCACCACAAGCTAAGGTACTGGG + Intergenic
986133872 5:4956374-4956396 CAATCACAAGATAAGAGAATAGG + Intergenic
987955713 5:24737471-24737493 GAATCACAAAGTAAGAGACTGGG - Intergenic
990958526 5:61367755-61367777 CAATCAGAAGGTAAGAAAACTGG - Intronic
991121178 5:63016033-63016055 CCACCACCAGAAAAGAAACTGGG - Intergenic
991245944 5:64507868-64507890 CCATCTCAGGGTAGGAGACTCGG + Exonic
991487291 5:67150683-67150705 CCATCAGAAGGTAAAGAAGTGGG + Intronic
993521628 5:88909778-88909800 CCATTAACAGGTAAGAAACAAGG - Intergenic
993667279 5:90715338-90715360 CCATGACAAGGAAAGAAATCTGG + Intronic
994501647 5:100586646-100586668 CCAACACAAAGTAATAAATTTGG - Exonic
996523465 5:124452292-124452314 TCTTCCCAAGCTAAGAAACTAGG + Intergenic
996927135 5:128841138-128841160 CCTGCACAAGGCAAAAAACTTGG - Intronic
998909369 5:146941803-146941825 CCATAACAAAGTCACAAACTAGG + Intronic
1000996317 5:167962392-167962414 CCAGCACAAGGTGCAAAACTTGG + Intronic
1002665290 5:180818894-180818916 CCAAGACAATGTTAGAAACTTGG + Intergenic
1004407212 6:15344341-15344363 ACATCCCAAGGTAAGCAAGTAGG - Intronic
1005246638 6:23893230-23893252 CCATCCCAACATAAGAATCTAGG - Intergenic
1008467582 6:51847822-51847844 CCATCACCAGGTCAGAACCAAGG - Exonic
1011021670 6:82820323-82820345 ACATCTCTAGGTAATAAACTGGG + Intergenic
1011346156 6:86371243-86371265 CCATCACAGGCCCAGAAACTTGG - Intergenic
1012513738 6:100034300-100034322 CCATCACAAGGTATCACACATGG - Intergenic
1013887470 6:114987791-114987813 CCATCACAAGTTAAGACTTTGGG - Intergenic
1015762102 6:136674347-136674369 CCTGAACAAGGAAAGAAACTTGG - Intronic
1015989974 6:138929701-138929723 CCATCAAAAGGTAAATGACTTGG - Intronic
1016572679 6:145532510-145532532 CCATTACAAGGTAATCAACCTGG - Intronic
1016927087 6:149361508-149361530 CCATCACAGGCTCAGAAACCAGG - Intronic
1018468741 6:164078281-164078303 CCCTGACAAGGTAATAAGCTGGG + Intergenic
1019138615 6:169928914-169928936 CCATCTCCAGGTAGGAACCTGGG - Intergenic
1019641973 7:2108136-2108158 CCATCAGAAGAGAACAAACTTGG + Intronic
1021502685 7:21347720-21347742 CCATCCCAAGGGAAGAATCAGGG - Intergenic
1021692393 7:23243242-23243264 CCAACACATGGTCAGAAACTTGG - Intronic
1024791302 7:52967697-52967719 CCATCACAAAATAACAGACTGGG + Intergenic
1026094269 7:67329904-67329926 CCATTAACAGGTAAGAAACAGGG + Intergenic
1027368960 7:77487702-77487724 GCATCTCAAGTTAAGTAACTTGG - Intergenic
1027897157 7:84060164-84060186 CCAGCACAAGGTAACACAATGGG + Intronic
1030822948 7:114117709-114117731 CCAGCCCAAGCTAAGACACTGGG - Intronic
1032847832 7:135767024-135767046 ACTTGACAAGGAAAGAAACTAGG - Intergenic
1033294369 7:140117267-140117289 CCATCAAAAGTTCAGAAACATGG - Intronic
1034588959 7:152122454-152122476 ACAGCTCAAGCTAAGAAACTGGG - Intergenic
1035485287 7:159218720-159218742 CAATCACGAGGTAAAAGACTTGG - Intergenic
1035815900 8:2540171-2540193 CCATCCCAAGATAAGAAATCAGG - Intergenic
1039623822 8:39026855-39026877 CCCTCACAGTGTAAGAAACATGG - Intronic
1039739323 8:40366996-40367018 CTATCACAAGAAAAGAAAATTGG - Intergenic
1039875396 8:41580396-41580418 CCATTAATAGGTAAGAATCTGGG + Intronic
1042015183 8:64301057-64301079 CCATTACTTGGTAATAAACTGGG + Intergenic
1043510323 8:80944733-80944755 ACAGCACTAGGTGAGAAACTGGG + Intergenic
1044357825 8:91245272-91245294 CAATCACAATGTTAGAAAATTGG + Intronic
1044603504 8:94028820-94028842 CCATCACCAGTTAAAACACTTGG - Intergenic
1046513022 8:115222438-115222460 CCACCACAAGGGAAGAAGCAGGG + Intergenic
1048814952 8:138323838-138323860 CCATTAAAAGGTAAGAATCTAGG + Intronic
1052778775 9:32759257-32759279 TCATTACAAGATAAGAAACAGGG + Intergenic
1055159232 9:73104782-73104804 CCATCACTAGGTTAAAATCTGGG - Intergenic
1059041401 9:110819125-110819147 TCAACACAAGGTATGAAAATTGG + Intergenic
1060672200 9:125479700-125479722 CCATCAGAAGACAAGCAACTGGG + Intronic
1061330454 9:129889135-129889157 CCCACACAGGGAAAGAAACTTGG + Exonic
1185509317 X:651066-651088 ACATCACAAAGTAAGAAGCAGGG - Intronic
1187381519 X:18806053-18806075 CTATTACAAGGCAAGAAAATAGG + Intronic
1190435536 X:50421096-50421118 CCATAAGAAAGAAAGAAACTGGG - Intronic
1190751234 X:53363390-53363412 CCCACACATGGTATGAAACTGGG + Intergenic
1191884582 X:65875312-65875334 CCACCCCAAGGGAAGAATCTGGG - Intergenic
1197517371 X:127450528-127450550 TAATCACAAGGCAACAAACTAGG + Intergenic
1198942384 X:141970787-141970809 CCCTAACAAGATAATAAACTAGG - Intergenic
1199082376 X:143591240-143591262 CCATCCCAAGGGAAGAATCAGGG + Intergenic
1202363812 Y:24140288-24140310 CCTTCACAAGATAAAAAACAAGG + Intergenic
1202506968 Y:25529834-25529856 CCTTCACAAGATAAAAAACAAGG - Intergenic