ID: 1105301126

View in Genome Browser
Species Human (GRCh38)
Location 13:19135607-19135629
Sequence CAACTTGCAATGTAAGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105301126 Original CRISPR CAACTTGCAATGTAAGTCTC TGG Intergenic
903399886 1:23034779-23034801 TAACTTTCCATGAAAGTCTCAGG - Intronic
903424464 1:23243697-23243719 CAACCTGCAGAGTAGGTCTCAGG - Intergenic
904382407 1:30120205-30120227 GAATTTGCAATGGAAATCTCAGG - Intergenic
907480314 1:54741318-54741340 CAACATGCAAGGTGAGCCTCTGG - Intronic
910059587 1:83073217-83073239 CAACCTGAAGTGGAAGTCTCTGG + Intergenic
911995497 1:104760442-104760464 CAGCTTTCAATGTAAGTATTAGG - Intergenic
912935723 1:114002317-114002339 CAATTGGCAATGTATGTCTAAGG - Intergenic
919478489 1:198056985-198057007 CAGCTTCCCATGTTAGTCTCAGG + Intergenic
920762281 1:208796517-208796539 CAAATTTCAATTTAAATCTCTGG - Intergenic
923816307 1:237383122-237383144 CAATTTGCAATGGAAGTCCATGG - Intronic
1062864999 10:844635-844657 CAACTTGCTATCTCAGTGTCTGG + Intronic
1063078444 10:2740422-2740444 CAATTTGCAATTTAAGACTTCGG + Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1070617613 10:77981096-77981118 CAACTTGCCATGGGACTCTCTGG + Intronic
1071568525 10:86684057-86684079 CAACTTGCAGTGCAATTCTTTGG + Intronic
1073416885 10:103391178-103391200 CAATGTGAAATGTAAGTTTCTGG - Intronic
1076804262 10:132847321-132847343 CAACCTGCAATGTGTGTCACAGG - Exonic
1078251695 11:9621968-9621990 CAATTTGCAATATAAGATTCAGG + Intergenic
1078320786 11:10332729-10332751 CATCTTGAATTGTAATTCTCAGG + Intronic
1080739770 11:35052919-35052941 CAACTTGAAATGGCAGTCCCAGG - Intergenic
1087115196 11:94517352-94517374 GAACTTGCAGGGTAAGTTTCAGG - Intergenic
1089202517 11:116732959-116732981 CAGCTTGCCTTGTAAGGCTCGGG + Intergenic
1091144431 11:133265266-133265288 CAACTAGCAATGTCTGACTCAGG + Intronic
1091468738 12:708524-708546 CAACTGGCACTCTATGTCTCTGG - Intergenic
1091487287 12:901846-901868 CAAATTTCAATGTAACTTTCTGG + Intronic
1093918076 12:24828189-24828211 TACTTTTCAATGTAAGTCTCAGG + Intronic
1094177037 12:27551578-27551600 CATTGTGTAATGTAAGTCTCTGG + Intronic
1094791866 12:33924632-33924654 CAACTTGCTATGAAAATCTTTGG - Intergenic
1096910518 12:54979222-54979244 AAACTTGAAATGAAAGACTCTGG - Intronic
1098632608 12:72742130-72742152 CAACTTGGAAAGTATATCTCAGG + Intergenic
1099537173 12:83858508-83858530 CAGCTTCCTATGTTAGTCTCAGG + Intergenic
1100770853 12:97921443-97921465 AAACTTGGAATGTGAGTCACTGG + Intergenic
1105301126 13:19135607-19135629 CAACTTGCAATGTAAGTCTCTGG + Intergenic
1111271335 13:85891464-85891486 CATCTTGAAATGTAATTCCCAGG + Intergenic
1113137101 13:107103586-107103608 CACCTAACAATGTATGTCTCAGG + Intergenic
1116912736 14:50488333-50488355 CATCTTGAATTGTAATTCTCAGG - Intronic
1126661756 15:51039389-51039411 CAGCTTCCTATGTTAGTCTCAGG + Intergenic
1126987281 15:54326737-54326759 CATTTTGCAAGGGAAGTCTCAGG + Intronic
1128473328 15:67974976-67974998 CATCCTGCAATCTAAGGCTCAGG - Intergenic
1137533289 16:49297890-49297912 TAACTTGCAATTTAAGGCTGTGG + Intergenic
1137797743 16:51236452-51236474 CATCCGGCAATGTAATTCTCTGG + Intergenic
1140842085 16:78849180-78849202 CAAGAGTCAATGTAAGTCTCTGG + Intronic
1146653869 17:34623698-34623720 CAACTTGCACAGTGAGTCTGTGG + Intronic
1153104592 18:1511822-1511844 CAGCTCCCAATGTTAGTCTCAGG + Intergenic
1156120534 18:33837244-33837266 CAACTTACTATGTCTGTCTCAGG + Intergenic
1156761598 18:40598082-40598104 CAACTTGTAAAGTTTGTCTCAGG + Intergenic
1157914392 18:51650592-51650614 CATGTTGCAATTTTAGTCTCAGG + Intergenic
1162440938 19:10691716-10691738 CAACTTGCCATGTAAGGGTGTGG - Exonic
925300392 2:2807643-2807665 GCACTTGCAATGTAAGGCGCTGG + Intergenic
925570570 2:5307800-5307822 CAACTTGTAATGTTACTCTGAGG - Intergenic
928859243 2:35836076-35836098 CATCTTGCATTGTAATTCCCAGG + Intergenic
932278617 2:70470730-70470752 GAACTTGCACTCTAAGCCTCAGG - Intronic
937547864 2:123046492-123046514 CAGCTGGGAATGTGAGTCTCAGG - Intergenic
943889083 2:193262791-193262813 CAAATTGCAAAGCAAGTCTAAGG + Intergenic
943980154 2:194539455-194539477 CAGCTCCCTATGTAAGTCTCAGG - Intergenic
944847480 2:203683062-203683084 CAAATTCCAATTTAGGTCTCTGG - Intergenic
945917149 2:215715879-215715901 CAACTTGTAATGCCTGTCTCAGG - Intergenic
1169414906 20:5407867-5407889 CTAAATGCAATCTAAGTCTCAGG + Intergenic
1172165267 20:32894939-32894961 AAGCTTGCAAAGTAAGTCCCAGG - Intronic
1175633463 20:60561061-60561083 TAACTTGAAAGGTAAATCTCTGG + Intergenic
1179945375 21:44670649-44670671 CAAATCCCTATGTAAGTCTCAGG - Intronic
1182876889 22:33700002-33700024 GAACCTGCAATGTAAGTCAGTGG - Intronic
949817783 3:8078426-8078448 CATCTTGAATTGTAATTCTCAGG - Intergenic
952338166 3:32422716-32422738 CAACTTGCAATGGATTTCTCAGG - Intronic
959983649 3:112548025-112548047 CAAATTGCAATGGAAGTAGCAGG + Intronic
960892224 3:122461080-122461102 CAGCTTGCAATGTAGTTGTCAGG + Intronic
962229769 3:133652728-133652750 CAACTTCCAAAGTAAGATTCAGG + Intronic
962947876 3:140188445-140188467 CAAGGTGCAATGTAAGCATCAGG - Intronic
970515083 4:16821258-16821280 AAACTTGCACTGAAACTCTCAGG - Intronic
977719699 4:100224694-100224716 CAGCTCCCTATGTAAGTCTCAGG + Intergenic
977798226 4:101194068-101194090 TAACTTACAGAGTAAGTCTCTGG + Intronic
978966390 4:114747098-114747120 CAAACTGCAATGTAAGACTAGGG + Intergenic
985232019 4:187828587-187828609 CTACTTGGAATGAAATTCTCAGG + Intergenic
990652858 5:57922309-57922331 CATCTTGAATTGTAATTCTCAGG + Intergenic
991091249 5:62695994-62696016 CAGCTTGAAATATAAGTTTCTGG - Intergenic
991573963 5:68083431-68083453 CAACTTGAAATGGAAGACTAGGG + Intergenic
995025345 5:107414255-107414277 CAAGGTGGAATTTAAGTCTCAGG - Intronic
998778067 5:145625697-145625719 CAAATAGCACTGTAAGCCTCTGG + Intronic
999506426 5:152202657-152202679 GAACTAGCAATGGAAATCTCAGG + Intergenic
1000771615 5:165361897-165361919 CACCTTGCAATTTAAGTTTGAGG - Intergenic
1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG + Intergenic
1009036165 6:58119526-58119548 AAAATTTCAATGTAAGTCTGTGG + Intergenic
1009211982 6:60873145-60873167 AAAATTTCAATGTAAGTCTGTGG + Intergenic
1010538752 6:77064188-77064210 CAGCTTCCTATGTTAGTCTCAGG + Intergenic
1012611868 6:101228308-101228330 CAACATGCAACCTAGGTCTCTGG + Intergenic
1017336644 6:153268821-153268843 CAGCTTCCTATGTTAGTCTCAGG - Intergenic
1018251482 6:161875953-161875975 TACCTGGGAATGTAAGTCTCAGG - Intronic
1027494434 7:78869791-78869813 CATCTTGAATTGTAATTCTCAGG - Intronic
1028375124 7:90137405-90137427 CATCTTGCATTGTAATCCTCAGG - Intergenic
1033861813 7:145637631-145637653 CAACTTCTAATGTAACTTTCAGG - Intergenic
1034741512 7:153478424-153478446 CAGCTTCCTATGTTAGTCTCAGG - Intergenic
1036397967 8:8385071-8385093 CAACTTCTGATGTAAGTCTGAGG - Intronic
1038747963 8:30270557-30270579 CAGCTTGCATTGTATTTCTCTGG - Intergenic
1038989776 8:32855534-32855556 CAACTTTCATTTTAAGTCCCAGG + Intergenic
1039140830 8:34385805-34385827 CAGCTTCCTATGTTAGTCTCAGG - Intergenic
1039249432 8:35645395-35645417 CAGCTTGCAATTTTAGCCTCTGG + Intronic
1042729915 8:71921220-71921242 CAAGTTGCTATGAAAGTTTCTGG - Intronic
1043539668 8:81246074-81246096 AAACTTGCAATCTAGGGCTCAGG + Intergenic
1045049811 8:98312851-98312873 CAGATTGCATTGTATGTCTCAGG + Intergenic
1050206735 9:3204427-3204449 AAACTAGAAATGTAACTCTCCGG + Intergenic
1054728932 9:68680959-68680981 CAATTTGCAATGTATTTCTCTGG + Intergenic
1056818999 9:89823823-89823845 CAGCTCCCAATTTAAGTCTCTGG + Intergenic
1058125714 9:101192239-101192261 AGAGTTGCAATCTAAGTCTCAGG - Intronic
1059071839 9:111146252-111146274 CAACATGATATGTAGGTCTCGGG - Intergenic
1059149073 9:111931296-111931318 CAAGTTGCAATGCAAAACTCTGG + Exonic
1188373291 X:29395399-29395421 CTACTTGCTTTTTAAGTCTCAGG - Intronic
1191652786 X:63559567-63559589 CAACTAGCAATGAAAATCTCTGG - Intergenic
1192681777 X:73260395-73260417 CAATGTGCAATGTAGTTCTCCGG - Intergenic
1193549655 X:82875477-82875499 CAGCTTGCTATGTTAGTCTCAGG - Intergenic
1197593199 X:128434692-128434714 CATCTGCCAATGTAAGTATCAGG + Intergenic
1197683977 X:129418755-129418777 CAACTTTCAAAGTAACCCTCTGG + Intergenic
1198342813 X:135731837-135731859 CAGCTGGCAATGTAAGTCCCTGG + Intergenic
1198345176 X:135751458-135751480 CAGCTGGCAATGTAAGTCCCTGG - Intergenic