ID: 1105303138

View in Genome Browser
Species Human (GRCh38)
Location 13:19152700-19152722
Sequence AATGATGCACAGACAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105303132_1105303138 14 Left 1105303132 13:19152663-19152685 CCCAGGAACACAGAGCTGACTGC 0: 1
1: 0
2: 2
3: 33
4: 232
Right 1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG 0: 1
1: 0
2: 0
3: 36
4: 311
1105303133_1105303138 13 Left 1105303133 13:19152664-19152686 CCAGGAACACAGAGCTGACTGCC 0: 1
1: 0
2: 2
3: 32
4: 243
Right 1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG 0: 1
1: 0
2: 0
3: 36
4: 311
1105303135_1105303138 -8 Left 1105303135 13:19152685-19152707 CCATCTGGCCTGCAAAATGATGC 0: 1
1: 0
2: 0
3: 19
4: 152
Right 1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG 0: 1
1: 0
2: 0
3: 36
4: 311
1105303131_1105303138 27 Left 1105303131 13:19152650-19152672 CCAAGGAAGTCGTCCCAGGAACA 0: 1
1: 0
2: 3
3: 10
4: 106
Right 1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG 0: 1
1: 0
2: 0
3: 36
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105303138 Original CRISPR AATGATGCACAGACAGAGGT AGG Intergenic
900089930 1:915781-915803 AAGGCTGCACAGCCAGAAGTGGG + Intergenic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
900895964 1:5483120-5483142 GAAGAGGCACAGACAGAGGGGGG - Intergenic
900902972 1:5529277-5529299 ACAGACACACAGACAGAGGTTGG + Intergenic
901396176 1:8983560-8983582 AATGATGTACATACACAGTTAGG + Intergenic
902730086 1:18363507-18363529 AGGGATGCAGAGACACAGGTGGG + Intronic
903335808 1:22623774-22623796 AGTGAGGGACAGACAGAGGGTGG + Intergenic
904841277 1:33373436-33373458 AATGATGGAGAGAGAGAGGAAGG - Intronic
905253060 1:36662111-36662133 ACTGATGGACAAACAGAGGCTGG - Intergenic
905580483 1:39080583-39080605 AATGATGCACAAAACGAGGCAGG - Intergenic
906226398 1:44125926-44125948 TATGAGGTGCAGACAGAGGTTGG - Intronic
906262072 1:44400836-44400858 AAGGAGGCAGAGACAGAAGTGGG - Intergenic
906658834 1:47568155-47568177 AATGCTGCACTGACAGGGCTGGG + Intergenic
906722817 1:48021640-48021662 ACTGATGCACAGACAGGATTGGG - Intergenic
906725851 1:48043669-48043691 GGTGAGGCACAGACAAAGGTAGG - Intergenic
907031373 1:51175581-51175603 AATAATGCAAAACCAGAGGTAGG - Intergenic
909410267 1:75341955-75341977 TCTGATGCACAGACAGATTTGGG + Intronic
911242903 1:95484319-95484341 ACGGATGAACTGACAGAGGTAGG + Intergenic
911330814 1:96523661-96523683 ACTGGAGCAGAGACAGAGGTGGG - Intergenic
911791558 1:102022320-102022342 AATGAAGCACAGAAAAAAGTAGG - Intergenic
911817092 1:102367526-102367548 ACTGAGTAACAGACAGAGGTTGG + Intergenic
912136093 1:106661824-106661846 AATGAGTAACAGGCAGAGGTTGG + Intergenic
912797820 1:112703539-112703561 AATGAAGCAAAGACAGGGGTAGG + Intronic
914218356 1:145655286-145655308 ATGGATGCACTGACAGAAGTAGG - Intronic
914470917 1:147977977-147977999 ATGGATGCACTGACAGAAGTAGG - Intronic
915939646 1:160110748-160110770 AATGCAGCACAGGCAGAGGCTGG + Intergenic
915990749 1:160513013-160513035 AAGGATGAACTGACAGAAGTAGG + Intronic
917850622 1:179060633-179060655 AATTTTCCACAGACAGGGGTTGG - Intronic
918192226 1:182186834-182186856 CATGATGGAAAGAGAGAGGTTGG + Intergenic
919212765 1:194509810-194509832 ACTGAGTAACAGACAGAGGTTGG + Intergenic
920270916 1:204763169-204763191 ATTGAGGCACAGGCAGTGGTGGG + Intergenic
922144900 1:222932689-222932711 AATGCTGGAAAGAAAGAGGTAGG - Intronic
923242707 1:232101086-232101108 GAAGGTGCACAGACAAAGGTTGG + Intergenic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
924163628 1:241259780-241259802 AATGATGCAGTGACAGATGCAGG - Intronic
924260772 1:242228567-242228589 AGTCATACACATACAGAGGTTGG + Intronic
924376277 1:243412760-243412782 AATGATTTAAAGGCAGAGGTAGG - Intronic
924650244 1:245919375-245919397 AGTGATGCCCAGACACATGTTGG - Intronic
1065668163 10:28085255-28085277 ACTGAAGCACAGAGAGAAGTAGG - Intronic
1066298188 10:34074586-34074608 AACAATGTACAGACAGCGGTGGG - Intergenic
1067191359 10:44070801-44070823 GATGCTGCACAGACACAGGGAGG + Intergenic
1069098251 10:64286695-64286717 AATGAAACACAGACAGAAGCAGG - Intergenic
1069835434 10:71305023-71305045 AATGAAGTAGAGACAGAGGAAGG - Intergenic
1071307989 10:84315992-84316014 AAAGATGCATAGGCAGAGGTAGG - Intergenic
1071681614 10:87711761-87711783 AATGAAGGACAGACAGAGGAAGG - Intronic
1072370076 10:94757419-94757441 TTTGATGAACTGACAGAGGTAGG - Intronic
1075017280 10:118919255-118919277 AGTGATGCCCAGATAGAGGAGGG + Intergenic
1075093379 10:119455838-119455860 AAGGAAGAGCAGACAGAGGTGGG - Intronic
1076380554 10:130022211-130022233 AAAGACACACAGACAGAGGGAGG + Intergenic
1076417741 10:130303552-130303574 AATGATGCAGAGAGAGAGGGAGG - Intergenic
1077905411 11:6529100-6529122 CATGATGTACAGGCAGAGATGGG + Exonic
1078269463 11:9781460-9781482 AATGATGTGCAGACAGAGCCAGG + Intronic
1079252785 11:18799290-18799312 AATGAGGCAGATACTGAGGTAGG + Intergenic
1080769672 11:35328877-35328899 AGTGATCCAGAGACAGAGTTGGG - Intronic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1082057059 11:47826925-47826947 AATGATGCAAAATCAGTGGTGGG + Intronic
1082067378 11:47911635-47911657 AAAGAAGCAGAGACAGAGGCAGG + Intergenic
1084603800 11:70161415-70161437 AAGGATGCACAGCAAGAGGCAGG - Intronic
1085848917 11:80097658-80097680 AATGATGAACCGGCTGAGGTGGG - Intergenic
1087474432 11:98618839-98618861 ACTGATGAACAGGCAGAGGTTGG - Intergenic
1088478708 11:110271451-110271473 ACTGTTGCAAAGACAGAGGAAGG - Intronic
1090336923 11:125975284-125975306 AGTGATTCTCAGACAGAGGTAGG - Intronic
1091067833 11:132533381-132533403 GATGATACATTGACAGAGGTTGG + Intronic
1091123294 11:133074926-133074948 GATGGTGGACAGACAGGGGTGGG - Intronic
1092000413 12:5027142-5027164 AATGTTCCAGAGACAGAAGTAGG + Intergenic
1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG + Intergenic
1092995616 12:13947715-13947737 AATGAGCCACAGCCAAAGGTGGG - Intronic
1093234776 12:16594209-16594231 CATGCTGCACATACAGAGATTGG - Exonic
1094515867 12:31125661-31125683 AATTCAGCACAAACAGAGGTCGG - Intergenic
1097271305 12:57776183-57776205 AAAGAGGCACAGAAAGAGGGAGG - Intronic
1098604568 12:72374203-72374225 GATGATGAACATACAGGGGTTGG + Intronic
1098606707 12:72399174-72399196 ATTTTTCCACAGACAGAGGTGGG - Intronic
1099143756 12:79012917-79012939 AATGAAGCAAAGAAAGAGGGTGG - Intronic
1099730012 12:86488905-86488927 AATTCTGGGCAGACAGAGGTGGG + Intronic
1099955147 12:89346022-89346044 AGGGAGGCACAGAGAGAGGTGGG + Intergenic
1100086542 12:90917709-90917731 AAAGAAGCCCAGACCGAGGTAGG - Intronic
1100745650 12:97642807-97642829 GATGAGTTACAGACAGAGGTGGG - Intergenic
1100821660 12:98437324-98437346 AATGATGCAAAGAAAGATTTAGG + Intergenic
1101960292 12:109244227-109244249 CATGAGGCATAGGCAGAGGTAGG - Intronic
1103880922 12:124165324-124165346 ACTGAGTAACAGACAGAGGTTGG - Intronic
1104308649 12:127634069-127634091 AATGCTGCACAGAAAGATGTGGG + Intergenic
1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG + Intergenic
1107428316 13:40316330-40316352 CATGATGGCAAGACAGAGGTGGG - Intergenic
1107650506 13:42540374-42540396 ACAGATGCACAGAGTGAGGTAGG + Intergenic
1108646040 13:52429528-52429550 GGTGATGCACAGACACAGGCAGG - Intronic
1109416756 13:62050916-62050938 ACTGAGTCACAGGCAGAGGTTGG + Intergenic
1109765825 13:66895868-66895890 AATGATGCACAAAGAGAGGGGGG - Intronic
1110850415 13:80238862-80238884 ATGGATGCATAGACAGAGTTGGG + Intergenic
1112002126 13:95220668-95220690 AAAAATGCACAGAGAGAGGAGGG + Intronic
1112740511 13:102467780-102467802 ATGGAAGCACAGACAGAAGTGGG + Intergenic
1113404603 13:110026678-110026700 AATGATGCAGAGAGTGAGGTGGG + Intergenic
1113888073 13:113671426-113671448 AATCATGGAAAGACAGAGCTGGG - Intronic
1114551334 14:23534355-23534377 AATGTGGCCCAGACAGAGGATGG - Exonic
1114867091 14:26609253-26609275 AATGATGGACGGACAGAAATTGG - Intergenic
1115736149 14:36332326-36332348 GATCATGCACAGACAGGGTTAGG - Intergenic
1117487058 14:56208500-56208522 AATGATGCAAAAGCAGTGGTGGG + Intronic
1117721674 14:58634785-58634807 AATGATGCTCAGACTTTGGTGGG + Intronic
1117932070 14:60854291-60854313 ATTGATGAACTGACAGAAGTAGG - Intronic
1118926876 14:70199263-70199285 ATTGATGAACTGACAGAAGTAGG - Intergenic
1120252925 14:82081280-82081302 AGTAATGCACAGACAGACATAGG - Intergenic
1120325742 14:83023451-83023473 AATGTTGAACTGGCAGAGGTGGG - Intergenic
1120683343 14:87507752-87507774 AATGAAACACAGAAAGAGGGGGG + Intergenic
1123901689 15:24883504-24883526 GAGGATGCAGGGACAGAGGTTGG - Intronic
1125423222 15:39525419-39525441 AAAAATGCCCAAACAGAGGTGGG + Intergenic
1126278526 15:46914794-46914816 TATGCTGTAAAGACAGAGGTTGG - Intergenic
1126918240 15:53490036-53490058 ATTGAAGCACAAAGAGAGGTAGG + Intergenic
1128408891 15:67372824-67372846 TATGATGCACAAACAAATGTGGG - Intronic
1128477369 15:68008701-68008723 AATGATGCTCATACAGGGGTAGG + Intergenic
1129138022 15:73571637-73571659 AAGAGTGCACAGGCAGAGGTCGG + Intronic
1129972469 15:79790926-79790948 GAGGATGCAGAGACAGTGGTTGG - Intergenic
1130046201 15:80446848-80446870 AATGAGACAGAGACAGAGGAAGG - Intronic
1133752350 16:8734782-8734804 AAAGATGTACAGACAGAAGGAGG + Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135619653 16:23944933-23944955 AATGAGGGACAGAGAGAGGAGGG + Intronic
1137369344 16:47890389-47890411 ACTGAGGCACAGAGAGAGATGGG - Intergenic
1137897134 16:52226119-52226141 ATTGATTCACAGTCAGAGATGGG - Intergenic
1138161261 16:54756858-54756880 AATGAGGCTCAGAGAGAGGTTGG - Intergenic
1138828531 16:60351209-60351231 CAGGTTACACAGACAGAGGTTGG + Intergenic
1139092443 16:63664829-63664851 AGAGATGCAGAGACAGAGCTTGG - Intergenic
1139207466 16:65043243-65043265 ATTCATGCACAGACATAGGAAGG + Intronic
1140135947 16:72205604-72205626 AATGATGCAAAGACAGAGCATGG + Intergenic
1142537759 17:631602-631624 AAGGCTGCACAGACTGAGTTAGG - Exonic
1143345194 17:6244101-6244123 CATGATGCTCAGTCAGAGCTGGG + Intergenic
1144564348 17:16347695-16347717 AATGATGCAGAGACAGTGATGGG + Intronic
1145065878 17:19761000-19761022 AATGAGGCATAGACAGATGGTGG - Intergenic
1145233255 17:21190459-21190481 CAGGATGGCCAGACAGAGGTGGG - Intronic
1146012060 17:29203975-29203997 AATGAGGTACAGACTGACGTGGG - Intergenic
1146200959 17:30858072-30858094 TATGATGGACAGAAAGTGGTTGG + Intronic
1147195208 17:38761919-38761941 AAGGATGTAGAGACAGAGGATGG + Intronic
1148774949 17:50090029-50090051 AATTCTGGACAGACAGATGTTGG + Intronic
1149112457 17:53049494-53049516 AATGACTAACAGACAGAGGTTGG - Intergenic
1150197596 17:63317129-63317151 GATGATGCAGAGAAAGAAGTTGG - Intronic
1151373621 17:73666946-73666968 AAAGATGCTCACACAGAGGTGGG + Intergenic
1151574661 17:74946670-74946692 ATTGAGGCACAGACAGGTGTTGG - Exonic
1151668305 17:75558048-75558070 AATGATGCAAACACAGAGAGGGG - Intronic
1151738258 17:75960220-75960242 ACTTATGCCCAGACAGAGATGGG - Exonic
1152825905 17:82464630-82464652 AATAATGCTCAGGCAGTGGTGGG + Intronic
1152895546 17:82909048-82909070 ACTGAGGCACAGAGAGAGGGAGG - Intronic
1153041494 18:816532-816554 AAGCAGGCACAGCCAGAGGTGGG + Intergenic
1156864465 18:41873457-41873479 GATGATGTATTGACAGAGGTTGG - Intergenic
1157884668 18:51355029-51355051 ATGGCTGCAGAGACAGAGGTTGG + Intergenic
1158534911 18:58299315-58299337 AAAGATGCAAAGACTGAGCTTGG + Intronic
1158684134 18:59597727-59597749 AATGAAGCCAACACAGAGGTGGG - Intronic
1160007811 18:75081064-75081086 GCTGATGCCCCGACAGAGGTGGG + Intergenic
1161719460 19:5895025-5895047 ACTGATGCACAGAGGGAGGCCGG + Intronic
1165787049 19:38467880-38467902 AGTGAGGCACAGACAGAGGCAGG - Intronic
1166054751 19:40281644-40281666 ACAGATGCAGAAACAGAGGTCGG - Intronic
1167739171 19:51313362-51313384 AATGACCCAGAGACAGAGGCAGG - Intronic
925166733 2:1720180-1720202 AGAGATGCACAGAGAGAGGGAGG + Intronic
925166757 2:1720318-1720340 AGAGATGCACAGAGAGAGGGAGG + Intronic
925166772 2:1720395-1720417 AGAGATGCACAGAGAGAGGGAGG + Intronic
925166776 2:1720415-1720437 AGGGATGCAGAGAGAGAGGTGGG + Intronic
925346452 2:3175283-3175305 AATGATGCACAGACAGCTGATGG + Intergenic
925702793 2:6655605-6655627 ACTGAGGCCCAGATAGAGGTTGG + Intergenic
925964798 2:9054180-9054202 AATGATGCAGAAAAAGAGGTTGG + Intergenic
927303339 2:21541232-21541254 AATGAACCACTGACAGTGGTTGG - Intergenic
927718398 2:25367479-25367501 AACGATGCCCACACAGAGCTGGG + Intergenic
930021505 2:47004608-47004630 AAGGAGGCTCAGACAGAGGGAGG + Intronic
930393829 2:50795030-50795052 AGTAATGCACAGAGATAGGTAGG - Intronic
930709245 2:54534637-54534659 AGTGGTGAACAGACAGAGGAGGG - Intronic
931155677 2:59626107-59626129 AATGATGGATACACAGAAGTTGG + Intergenic
932361477 2:71111538-71111560 AATAATCCACACACAGAGGTGGG - Intronic
933452090 2:82467486-82467508 AGAGATGCACAGACAGAAGTTGG + Intergenic
933798808 2:85943288-85943310 ACTGGTTAACAGACAGAGGTTGG - Intergenic
934099723 2:88641273-88641295 GGTGATGCACTGACAGAGGTGGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
935418368 2:102842243-102842265 AATAATGCAGAGAGGGAGGTAGG - Intronic
936013695 2:108942263-108942285 AAGGTCACACAGACAGAGGTGGG + Intronic
937421541 2:121760391-121760413 GCTGAAGCACAGAGAGAGGTAGG + Intronic
938280120 2:130057854-130057876 AATGATGCACAGGTACAGCTTGG - Intergenic
938331077 2:130448569-130448591 AATGATGCACAGGTACAGCTTGG - Intergenic
938358871 2:130672934-130672956 AATGATGCACAGGTACAGCTTGG + Intergenic
938435264 2:131279587-131279609 AATGATGCACAGGTACAGCTTGG + Intronic
938970440 2:136426298-136426320 TTTGATGCACAGACAAATGTAGG + Intergenic
939265957 2:139872714-139872736 AATGAGTCACAGACATTGGTTGG + Intergenic
940621631 2:156120885-156120907 ACTGAGTGACAGACAGAGGTTGG + Intergenic
942924212 2:181412257-181412279 ATTGATGAATAGACAGAAGTAGG + Intergenic
943273572 2:185839631-185839653 AAAGAGGTACAGACAGAGGTGGG + Intergenic
944989600 2:205220675-205220697 AATGATGGACAGTCAGGGTTGGG + Intronic
945021744 2:205579902-205579924 AATGATACACAGTCCAAGGTAGG - Intronic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
947370213 2:229438129-229438151 AATGAAGCAAAGACAGAAGAAGG + Intronic
947788282 2:232844507-232844529 GATGATGCAGTGAAAGAGGTGGG + Exonic
948251723 2:236535231-236535253 AATGTTTCACAGGCAGAGCTTGG + Intergenic
948881531 2:240860102-240860124 AATGTGGCCCAGACAGAGGCAGG + Intergenic
1169241750 20:3987194-3987216 AGTGATGCAGAGACAGAAGGAGG + Intronic
1169387936 20:5166843-5166865 AATGATGCACAGCCAGGGAGGGG + Intronic
1170482232 20:16777429-16777451 AATGCTGCATAGACATAGGAAGG + Intergenic
1171071549 20:22073502-22073524 CCAGATGCACAGACAGTGGTAGG - Intergenic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1172590800 20:36116529-36116551 AATGAAGCACTGACAGCTGTTGG - Intronic
1173065580 20:39707403-39707425 AATGATACAAGGACAGAGGAAGG + Intergenic
1173262781 20:41451478-41451500 GAAAAGGCACAGACAGAGGTGGG + Intronic
1173375624 20:42480184-42480206 AATAAGGCACAGACACAGGTAGG - Intronic
1174423749 20:50417497-50417519 ACTGAGGCACAGAGAGAGGGTGG + Intergenic
1175495234 20:59409900-59409922 AATGAGGAATAGACAGAGATGGG + Intergenic
1176005429 20:62860120-62860142 AATCTTTCACAGACACAGGTAGG - Exonic
1176624161 21:9077657-9077679 ACTGATGGACGGACAGACGTGGG - Intergenic
1178024051 21:28444830-28444852 AATGAGGCACAGAAAGATGAAGG + Intergenic
1178251113 21:31004237-31004259 AAGGATGCTCAGAGGGAGGTTGG - Intergenic
1179387369 21:40956007-40956029 ATTGGGGCACAGAGAGAGGTTGG - Intergenic
1179947469 21:44687923-44687945 TATGATGCACTGACAGAGGCCGG + Intronic
1181377295 22:22469690-22469712 AAAGATACACAGACACAGGTAGG - Intergenic
1183563868 22:38598772-38598794 AATGAGGCACAGAGAGAAGCTGG + Intronic
950520726 3:13496290-13496312 AATGAGTCACTGACAGAGCTGGG - Intronic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
953201032 3:40778932-40778954 AATAAGGCACTGACACAGGTGGG - Intergenic
954123629 3:48515896-48515918 ATTGTTGCAAAGACATAGGTAGG - Intergenic
955392863 3:58533999-58534021 ACGTATGCACAGACAGAGTTGGG - Exonic
955710546 3:61774743-61774765 AATGAAGCAGAGACACCGGTAGG - Intronic
956087697 3:65630434-65630456 CATGAAGCTCAGACAGAGGGTGG + Intronic
956620393 3:71216242-71216264 AATGAGGCAAAGGAAGAGGTGGG - Intronic
958048206 3:88311968-88311990 AATGTGGCAAAGACAGAAGTTGG - Intergenic
960198420 3:114799820-114799842 GATGATGCACGGACAGAGCAAGG - Intronic
960619995 3:119628233-119628255 CATGAAGCGCAGACAGAGTTGGG - Intronic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
962398070 3:135034889-135034911 TAGGATGCACAGCCAGAGGAAGG + Intronic
962727047 3:138240079-138240101 AAGGATGTACAGTCAGAGGTGGG - Intronic
963018276 3:140846631-140846653 AATGACACCCAGACAGAAGTGGG + Intergenic
964797361 3:160513853-160513875 AATGATACACAGAAAGGGCTAGG + Intronic
965052168 3:163664538-163664560 AATGAGTAACAGGCAGAGGTTGG - Intergenic
965083325 3:164063973-164063995 ACTGAGTAACAGACAGAGGTTGG + Intergenic
965935785 3:174109324-174109346 AATAATGCACAGTCATAGGAGGG - Intronic
966652226 3:182314626-182314648 AAGGATGAACTGACAGAAGTAGG - Intergenic
967185527 3:186941394-186941416 AATGATGCACACCCAGAAATTGG + Intronic
967787273 3:193511261-193511283 AAGGATGCAAAGAAAGAGGCAGG + Intronic
968014605 3:195318333-195318355 AATGAGTAACAGGCAGAGGTTGG + Intronic
968258028 3:197297432-197297454 AATTAAGAACAGACAGAAGTCGG + Intronic
969509626 4:7610407-7610429 AGGTATGCACAGACAGGGGTGGG - Intronic
969528208 4:7714907-7714929 AAGGATGGACAGAGACAGGTAGG - Intronic
970806813 4:20046207-20046229 AGTGAGGGAGAGACAGAGGTGGG + Intergenic
974149288 4:57985161-57985183 AATGATGCAAAGACTTAGGTTGG + Intergenic
980267541 4:130537532-130537554 GAAGATGGAGAGACAGAGGTAGG + Intergenic
982057666 4:151569172-151569194 AATGAGGCATAGACAAAGCTGGG + Intronic
982065001 4:151646579-151646601 CATGATGCTGAGTCAGAGGTGGG + Exonic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
982094489 4:151909590-151909612 AACTAGCCACAGACAGAGGTTGG - Intergenic
982219265 4:153111006-153111028 AATGATTCACTGACCCAGGTTGG + Intergenic
982521094 4:156417515-156417537 ACTGGAGAACAGACAGAGGTTGG - Intergenic
984195122 4:176650010-176650032 AGCGATGCACAGGCAGAGGCTGG - Intergenic
984579232 4:181491544-181491566 AATTATGCAAAGACAGAGTAAGG + Intergenic
984948055 4:184985291-184985313 AAGCATGCACAGACAATGGTTGG - Intergenic
985523442 5:389867-389889 AATGAAGAAAAGACAGAGGCAGG + Intronic
987281574 5:16419245-16419267 AGAGATGCAAAAACAGAGGTAGG + Intergenic
988062430 5:26189260-26189282 ATTGATGCAAAGGCAGTGGTTGG + Intergenic
988792584 5:34622338-34622360 TTTAATGCTCAGACAGAGGTGGG - Intergenic
990143275 5:52730386-52730408 ACTGAGTAACAGACAGAGGTTGG + Intergenic
990317859 5:54601081-54601103 ACAGATGGACAGACAGAGGGAGG - Intergenic
990950404 5:61293037-61293059 AATGAGGCAGAGGCAGAGCTGGG + Intergenic
992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG + Intergenic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
994780355 5:104081024-104081046 GATGATACACATACATAGGTAGG + Intergenic
995011493 5:107261085-107261107 AATGAGTAACAGACAGAGGTTGG - Intergenic
996243653 5:121232911-121232933 ACTGATGAACATACAGAGGCAGG - Intergenic
996708774 5:126523403-126523425 TCTGATGCACAGAGAGAGGATGG - Intergenic
998062949 5:139133406-139133428 CATGAGGCACTGAGAGAGGTGGG - Intronic
999166331 5:149552064-149552086 AATAATGCAAAGACATAGGATGG - Intronic
999694030 5:154172560-154172582 AATGATGTACACAAAGAGATTGG + Intronic
999716272 5:154362997-154363019 ACTGATACAAAGACTGAGGTTGG - Intronic
1000047435 5:157533264-157533286 TTTGATGCAAAGACAGGGGTTGG - Intronic
1002044505 5:176534360-176534382 GATGATGGGCAGGCAGAGGTTGG - Intronic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1002770077 6:282880-282902 CATGATGCTCAGAGAGATGTGGG + Intergenic
1004155560 6:13164535-13164557 ACTGCGGCACAAACAGAGGTGGG - Intronic
1006310276 6:33252764-33252786 AATGTAGCACAGACAGAAGATGG + Intronic
1007244405 6:40450177-40450199 AAGGATGCAAAGTCAGTGGTGGG - Intronic
1007601347 6:43083588-43083610 AATGTTACACAGACAGCAGTGGG + Intronic
1008129199 6:47701318-47701340 AATCATGCACAGAAAGAGGCGGG + Intronic
1008636344 6:53414666-53414688 AATGCTCCATAGACAGATGTAGG + Intergenic
1008797656 6:55323611-55323633 AATGATGCAGAGAAAATGGTAGG - Intergenic
1009980580 6:70721535-70721557 AATGGGGAACAGACAGAGGATGG - Intronic
1010280472 6:74017798-74017820 AGTGATACAAAGACAAAGGTAGG + Intergenic
1011591100 6:88971653-88971675 AGGGATGCAAAGACAGAAGTGGG + Intergenic
1013379790 6:109556974-109556996 ATGGATGAACTGACAGAGGTAGG - Intronic
1014633760 6:123819258-123819280 AATGAAATACAGACAGAGATTGG + Intronic
1015409210 6:132873125-132873147 AATGATGCAGAGAAAGTGGGTGG - Intergenic
1016068640 6:139710610-139710632 GAAGCTGCAAAGACAGAGGTAGG - Intergenic
1016185388 6:141192418-141192440 ACTGGGGAACAGACAGAGGTTGG - Intergenic
1016371505 6:143379350-143379372 AATGAAGAACAGACATCGGTGGG + Intergenic
1017010899 6:150063483-150063505 AAGGCTGCACAGCCAGGGGTAGG - Intronic
1017191238 6:151654843-151654865 AATGAAGCACTGACAGGAGTGGG + Intergenic
1017544605 6:155437615-155437637 AATGATGCCCAGACATAGGCAGG + Intronic
1018543851 6:164913985-164914007 AAAGATGCAGAAACAGAGGCAGG - Intergenic
1020315762 7:6904376-6904398 GTTGATGGACAGAGAGAGGTTGG - Intergenic
1021382240 7:19982377-19982399 AAGGATGTAGAGAAAGAGGTAGG - Intergenic
1023635428 7:42204715-42204737 AATCAAGCTCAGAAAGAGGTTGG - Intronic
1024185931 7:46947692-46947714 AATGATACACAGTCAAAGGAAGG + Intergenic
1026125213 7:67573438-67573460 AATGATGCGAAGACAGAGGGAGG - Intergenic
1028514663 7:91663891-91663913 TAGCATGTACAGACAGAGGTGGG - Intergenic
1030147848 7:106374499-106374521 CATGATGCACAGTCAGCTGTGGG + Intergenic
1030412416 7:109198130-109198152 AAGGATGCAGACACAGAGGCCGG + Intergenic
1030692059 7:112546441-112546463 ATTGATGAACTGACAGAAGTAGG - Intergenic
1030758223 7:113316462-113316484 AATGAGGTGAAGACAGAGGTGGG + Intergenic
1031186195 7:118482627-118482649 AATGGGTAACAGACAGAGGTTGG - Intergenic
1031375362 7:121017967-121017989 AAGAATGCCAAGACAGAGGTAGG - Intronic
1033791633 7:144797633-144797655 ATGGATGAACTGACAGAGGTAGG + Intronic
1033977298 7:147117205-147117227 AATCATGCACAGAGACAGGGTGG - Intronic
1034060561 7:148083422-148083444 AATGATGCACATTCCGAGGGTGG + Intronic
1035318248 7:158011162-158011184 AATGACGTACAGACCCAGGTGGG - Intronic
1037054625 8:14423774-14423796 AATGATGCAGAGAAAGATGGGGG - Intronic
1037849284 8:22313178-22313200 AAAGATGAACAGACAGAGCAAGG - Intronic
1038706852 8:29902202-29902224 ATGGATGAACTGACAGAGGTAGG + Intergenic
1038989938 8:32857170-32857192 AATGATTCACAGACAAACTTTGG - Intergenic
1039168665 8:34715514-34715536 ACTGAGTAACAGACAGAGGTTGG - Intergenic
1039786169 8:40835990-40836012 AATGTTGCAAAGGCAGAGGAAGG + Intronic
1040002641 8:42592175-42592197 AATGAAACAAAGACAGAGTTCGG - Intergenic
1040671878 8:49701859-49701881 AATAATGCATAGAGAGAGGCTGG - Intergenic
1041168170 8:55112327-55112349 AATCATGCACATATAGAAGTAGG + Intronic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1043884348 8:85581280-85581302 AATGATGAGCTGACAGATGTAGG + Intergenic
1047215408 8:122872133-122872155 AAAGATGCACAGACAGCTGATGG + Intronic
1047431425 8:124796566-124796588 GAGGCTGCACAGTCAGAGGTGGG + Intergenic
1047698844 8:127430290-127430312 AATGATGAACACACAGACATGGG + Intergenic
1048294818 8:133206413-133206435 TAGGATGCACAGACAGAAGGTGG + Intronic
1048960872 8:139575730-139575752 AATGATTCAGAGACAGGGGCAGG - Intergenic
1050661599 9:7889110-7889132 ACTGATGCACAGACAGACTGCGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1054943151 9:70765791-70765813 AATGTTGCACAGAAAAAGATGGG - Intronic
1055954520 9:81761513-81761535 AATGAAGCAGAGAAAGAGGGGGG - Intergenic
1056884193 9:90424302-90424324 CATGATGCTCAGACAAAGGTCGG - Intergenic
1057183340 9:93041379-93041401 AATGAGGCCCAAACAGAGGTTGG + Intergenic
1057511374 9:95682143-95682165 AATGATGCGCAAACAGAAGGTGG - Intergenic
1058554982 9:106157606-106157628 AATGGTCCACAGACTGAGTTAGG + Intergenic
1062267816 9:135695448-135695470 AAAGATGAACACCCAGAGGTGGG + Intronic
1062623076 9:137431282-137431304 CTCGATGCAGAGACAGAGGTCGG + Exonic
1203747344 Un_GL000218v1:48085-48107 ACTGATGGACGGACAGACGTGGG - Intergenic
1203562393 Un_KI270744v1:69716-69738 ACTGATGGACAGACAGACGTGGG + Intergenic
1186219422 X:7333815-7333837 GATAATGCACGGACAGAGCTGGG + Intronic
1188259817 X:28009071-28009093 ACTGAATAACAGACAGAGGTTGG - Intergenic
1189326740 X:40116895-40116917 GATGATCCACAGACAGAAGGTGG + Intronic
1190995562 X:55605509-55605531 TTTGATGAACTGACAGAGGTAGG - Intergenic
1191978439 X:66899521-66899543 ACTGAAGCACTGACAGTGGTGGG + Intergenic
1192662264 X:73053521-73053543 ACTGAAGAACTGACAGAGGTAGG + Intergenic
1193397789 X:81005722-81005744 ACTGAAGCACAGAAAGAGGGTGG - Intergenic
1193535004 X:82703755-82703777 AATGCTTCACTGACAGACGTGGG + Intergenic
1194952550 X:100144474-100144496 AATGAGTAACAGGCAGAGGTTGG + Intergenic
1195044303 X:101042320-101042342 AAAGGTACACATACAGAGGTTGG + Intronic
1195844120 X:109208328-109208350 TTTGATGAACTGACAGAGGTAGG - Intergenic
1198280564 X:135138118-135138140 AAAGATGAACACACAGAGGGAGG + Intergenic
1198290395 X:135234396-135234418 AAAGATGAACACACAGAGGGAGG - Intergenic
1198836184 X:140806990-140807012 ACTGAGTAACAGACAGAGGTTGG - Intergenic
1199193196 X:144996592-144996614 ACTGATTAACAGACAGAGGTTGG + Intergenic
1199850033 X:151719374-151719396 AATGATTAACAGAGAGAAGTTGG + Intronic
1200330408 X:155290879-155290901 AATGAGGTACAGACTGACGTGGG - Intronic
1201160664 Y:11163080-11163102 ACTGATGGACGGACAGACGTGGG - Intergenic