ID: 1105303471

View in Genome Browser
Species Human (GRCh38)
Location 13:19154237-19154259
Sequence AGTCCCACCCAGCTGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 3, 2: 5, 3: 34, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105303471_1105303473 1 Left 1105303471 13:19154237-19154259 CCAGGCAGCAGCTGGGTGGGACT 0: 1
1: 3
2: 5
3: 34
4: 336
Right 1105303473 13:19154261-19154283 GCTCTTCCCACGTCCCCCAGAGG 0: 2
1: 0
2: 1
3: 11
4: 174
1105303471_1105303474 2 Left 1105303471 13:19154237-19154259 CCAGGCAGCAGCTGGGTGGGACT 0: 1
1: 3
2: 5
3: 34
4: 336
Right 1105303474 13:19154262-19154284 CTCTTCCCACGTCCCCCAGAGGG 0: 2
1: 1
2: 0
3: 23
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105303471 Original CRISPR AGTCCCACCCAGCTGCTGCC TGG (reversed) Intergenic
900252519 1:1678520-1678542 AGTGCCACCCAGACGCTCCCAGG + Intronic
900290279 1:1920805-1920827 AGGCCCGCCCAGCTCCTGCGTGG - Intergenic
900412188 1:2517651-2517673 AGTGCCACCCAGCTCAGGCCAGG + Intronic
901684731 1:10937592-10937614 GGCCCCACGCAGCTGCAGCCGGG + Intergenic
901702558 1:11053478-11053500 TGGCCCACCCAGCTGCAGCCTGG + Intergenic
902246434 1:15124091-15124113 TGGCACACCCAGCTGCTGCCAGG - Intergenic
903278147 1:22234302-22234324 AGCCCCATCCAGCTTCTGCCCGG + Intergenic
903795649 1:25927252-25927274 AGACCCACGCAGACGCTGCCAGG + Intergenic
903965196 1:27084084-27084106 AGCCCCACCCAGCTGCAGGGAGG - Intergenic
904029320 1:27524046-27524068 ACTCCAACCCAGCTGCCCCCAGG - Intergenic
904031283 1:27534998-27535020 ACCCCCACCCAGCTCCTCCCAGG + Intronic
904649698 1:31995596-31995618 AGTCACAGCCAGCTGATTCCTGG - Intergenic
904851991 1:33466555-33466577 CATCTCACCCAGCTCCTGCCAGG + Intergenic
904999606 1:34657990-34658012 TGTCCCTCCCAGTTGCAGCCAGG + Intergenic
905450525 1:38053272-38053294 AGTCCCAACCAGCACCTGCTGGG + Intergenic
905825399 1:41022628-41022650 AGCCCAACCTGGCTGCTGCCCGG - Exonic
907573780 1:55507447-55507469 AGCCCCAGCCTACTGCTGCCAGG - Intergenic
909336476 1:74480634-74480656 ATTCCCATCCAGCTGGAGCCGGG + Exonic
910852763 1:91665017-91665039 AGTCACACCCAGAAGCTGACTGG - Intergenic
911274146 1:95840490-95840512 TTTCCCACCCACCTGCTGGCAGG - Intergenic
912816225 1:112830835-112830857 AGTCACACCCAGAAGCTGACTGG + Intergenic
913960439 1:143334676-143334698 AGGCCCAGGCCGCTGCTGCCAGG + Intergenic
914054795 1:144160249-144160271 AGGCCCAGGCCGCTGCTGCCAGG + Intergenic
914124351 1:144806112-144806134 AGGCCCAGGCCGCTGCTGCCAGG - Intergenic
915333061 1:155125589-155125611 AGTCCCACGCTGCAGCTGCTTGG - Intergenic
918115232 1:181490431-181490453 AGCCCCACCCACCTGCTTCTGGG - Intronic
918646990 1:186916944-186916966 AGTCACACCCAGAAGCTGACTGG - Intronic
919444343 1:197683087-197683109 AGTCCCCTCCTGCTGCTTCCTGG - Intronic
919759821 1:201090594-201090616 AGTCCCAGTGAGCTGCTGGCAGG + Intronic
919807015 1:201386252-201386274 AGTCCCACCCAGGTAGTCCCTGG - Intronic
920282822 1:204857278-204857300 AATCCCACCCAGCTTGGGCCAGG + Intronic
920293980 1:204944651-204944673 AGTCCCACTCAGCTGGCTCCAGG - Intronic
922717930 1:227886721-227886743 CGTCCGACCCAGCTGTTTCCAGG - Intergenic
923023668 1:230187487-230187509 AGCCCCACCCAGATGCTGCCGGG - Intronic
1063662193 10:8042656-8042678 AGTCCGACCAAGCTACTGACGGG + Intergenic
1065472103 10:26092676-26092698 AGTTCCACTCAGCTGCTTGCAGG - Intronic
1067028873 10:42866933-42866955 AGGCCCAGGCCGCTGCTGCCAGG + Intergenic
1067196783 10:44126673-44126695 AGACACAGCCTGCTGCTGCCTGG - Intergenic
1067811208 10:49428738-49428760 ATTCCCAGGCAGCTGCTGCCAGG - Intergenic
1068127910 10:52864676-52864698 AGTCCACCACAGCTGCAGCCCGG - Intergenic
1069824647 10:71247591-71247613 AGTCCAACTCAGCTGGGGCCAGG - Intronic
1069909056 10:71748827-71748849 CGTCCCTCCCTGCTGCTGCTGGG - Exonic
1070555613 10:77525562-77525584 GGCCCCACACAGCTGGTGCCTGG + Intronic
1072335009 10:94390032-94390054 AGTCACACCCAGAAGCTGACTGG + Intergenic
1072433111 10:95390962-95390984 AGTACCTCCCAGATGGTGCCTGG - Intronic
1072688991 10:97558045-97558067 AGTCACACCCAGAAGCTGACTGG - Intronic
1073421064 10:103423998-103424020 AGTCCCGCCCAATTGTTGCCGGG + Intronic
1075093533 10:119456579-119456601 TGTGCCACCCAGCAGCTGCCAGG + Intronic
1076494040 10:130885257-130885279 GGCCCCACCCAGCTGGTGCTGGG + Intergenic
1076867883 10:133177090-133177112 GGACCCATGCAGCTGCTGCCTGG + Intronic
1077077368 11:707677-707699 GGACCCACCCCACTGCTGCCCGG + Intronic
1077365542 11:2160110-2160132 ACTCCCACCCATCTCCAGCCGGG + Intronic
1077910164 11:6566321-6566343 AGTCCACCCCAGGTGCAGCCTGG + Exonic
1078320073 11:10326588-10326610 ACTTTCACCCAGCCGCTGCCTGG - Intronic
1078387176 11:10902930-10902952 AGTCTCACTCAGCTCCTGCCCGG - Intergenic
1079102281 11:17549205-17549227 AGTTCCACCCACCTGCAGCTAGG + Intronic
1080959848 11:37145737-37145759 AGCCCCACCAAACTTCTGCCTGG + Intergenic
1081993147 11:47348206-47348228 AGTCCCACCCAGATGAGACCCGG + Intronic
1083782524 11:64925661-64925683 AGTCTCACCCAGCACCTCCCAGG + Exonic
1084421721 11:69063756-69063778 AGGGGGACCCAGCTGCTGCCTGG + Intronic
1085533263 11:77203859-77203881 AGTCCATCCCAGCTGCTGTGAGG + Intronic
1088041055 11:105382651-105382673 AGTCATCCCCAGCTGCTGCTAGG + Intergenic
1088714625 11:112538090-112538112 GGTTCCAACCTGCTGCTGCCTGG + Intergenic
1090196877 11:124824167-124824189 GGCCCCTCCCAGCTGCTGGCAGG + Intergenic
1090440850 11:126724497-126724519 AGTCCCTCCCAGATCCTGCCTGG - Intronic
1091168298 11:133499648-133499670 AGGGTCACCCACCTGCTGCCTGG + Intronic
1091263496 11:134252850-134252872 AGTCCCAGCCAGCCTCTTCCGGG + Exonic
1091301418 11:134510409-134510431 AGTCTCCCCCAGTTGCTGGCTGG - Intergenic
1093122894 12:15294558-15294580 TGTGCCACACGGCTGCTGCCAGG - Intronic
1095098191 12:38159006-38159028 GGTCCCACTCAGAGGCTGCCGGG - Intergenic
1097412049 12:59267770-59267792 TGTCCCACCCTGCTTCTGCTCGG - Intergenic
1100027411 12:90147308-90147330 AGTCCCTCCCAAGTGCTGGCAGG + Intergenic
1101904548 12:108814902-108814924 CATCCCACTCCGCTGCTGCCTGG - Intronic
1102203619 12:111075175-111075197 GTTCCATCCCAGCTGCTGCCAGG + Intronic
1103516267 12:121510211-121510233 ATCCCCACCCTGCTGCTTCCCGG + Intronic
1104376042 12:128266655-128266677 AGTCCCGCGCAGCTGCTGCGGGG - Intergenic
1104455788 12:128911229-128911251 CGTGCCACCCACCTTCTGCCTGG + Intronic
1104685265 12:130780711-130780733 TGTCCCACACAGCTGGAGCCAGG - Intergenic
1104900762 12:132188539-132188561 AGCCCCACCCGCCAGCTGCCAGG + Intergenic
1105303471 13:19154237-19154259 AGTCCCACCCAGCTGCTGCCTGG - Intergenic
1106402844 13:29445969-29445991 AGTCCCACCCACCAACTTCCAGG - Intronic
1106695100 13:32164433-32164455 TGTCCCACACAGCTGCTCCCAGG + Intronic
1107085933 13:36428067-36428089 ACTCATACCCAGCTACTGCCTGG + Intergenic
1108493166 13:51001036-51001058 AGGCCCAACCACCTTCTGCCAGG - Intergenic
1108673067 13:52711308-52711330 AGGCCCACCCAGGTGGTGGCAGG + Intronic
1112356182 13:98676408-98676430 AGTCCCACCCAGCTACTAACAGG - Intergenic
1113454991 13:110442120-110442142 AGTTCCACAGAGCTGCTCCCTGG + Intronic
1114152896 14:20064563-20064585 AGTCCCTCCCAGCTGTGGTCTGG + Intergenic
1114538405 14:23437347-23437369 AGTCCCCCCCAGGCCCTGCCAGG + Intergenic
1115925263 14:38425850-38425872 TGTCCCACACAGCTGCTGCTGGG + Intergenic
1118763692 14:68895972-68895994 AGTCTCAGCCACCTGCTCCCAGG + Intronic
1119322900 14:73742083-73742105 AGTCCCACCCTGCAGCTTCATGG - Intronic
1121020971 14:90579958-90579980 TGTCCTCCACAGCTGCTGCCAGG + Intronic
1121109146 14:91300597-91300619 AGGCTCACCCAGGAGCTGCCAGG + Intronic
1121608152 14:95256511-95256533 AGTACCTCCCACCTGCTGCTGGG + Intronic
1123445595 15:20328178-20328200 AGTCTCACCAAGCTGCTTCATGG + Intergenic
1123491391 15:20784811-20784833 AGTCCCAGGCAGATGCTGTCAGG - Intergenic
1123547893 15:21353902-21353924 AGTCCCAGGCAGATGCTGTCAGG - Intergenic
1126716550 15:51524553-51524575 AGCACCACGCTGCTGCTGCCAGG - Intronic
1128866943 15:71121173-71121195 AGCACCACCACGCTGCTGCCTGG - Intronic
1128886601 15:71293897-71293919 AGTCCCTCCCAGTGGCTGCCTGG + Intronic
1130108872 15:80949010-80949032 AGCCCCTGCCAGCAGCTGCCTGG + Exonic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1202956223 15_KI270727v1_random:81132-81154 AGTCCCAGGCAGATGCTGTCAGG - Intergenic
1132799726 16:1746077-1746099 GAACCCACCCAGCGGCTGCCTGG + Intronic
1132881060 16:2161916-2161938 AGTGCCACACACCTGCAGCCAGG - Intronic
1132882262 16:2167680-2167702 TGGCACCCCCAGCTGCTGCCAGG + Intronic
1133035429 16:3031404-3031426 ACTCACCTCCAGCTGCTGCCGGG + Intronic
1134187846 16:12098501-12098523 AGCAGCACCCAGCTGCTTCCAGG + Intronic
1135062836 16:19285731-19285753 AGTCTGTCCCAGCTCCTGCCAGG + Intronic
1138129746 16:54469637-54469659 ATTCCCACCCAGATGGTGGCTGG + Intergenic
1138530279 16:57630998-57631020 AGCCCCACACAGCACCTGCCTGG - Intronic
1138711006 16:58970273-58970295 AGCCCCTCCCAAGTGCTGCCAGG - Intergenic
1139534301 16:67562258-67562280 AGCCCCACCCAGCGGGAGCCAGG + Intergenic
1139847107 16:69929043-69929065 AGTCCCTCACAGCTGATCCCTGG - Intronic
1139962064 16:70723866-70723888 TTTCCCACCAATCTGCTGCCAGG + Intronic
1141203821 16:81917502-81917524 AGTCCCACCCACCAGGTGCAGGG + Intronic
1141716782 16:85731448-85731470 AGACCCACCCACCTGTTTCCAGG - Intronic
1141823513 16:86463682-86463704 CAGCCCTCCCAGCTGCTGCCTGG - Intergenic
1142302262 16:89265596-89265618 AGCGCTACCCAGCTCCTGCCTGG - Intergenic
1142350681 16:89577962-89577984 TGCCCCATCCAGCTGCTGCCAGG + Intronic
1142493371 17:292907-292929 AATGCCAGCCACCTGCTGCCGGG + Intronic
1142852563 17:2711377-2711399 AGTCGCCCCCGGCTGCGGCCCGG - Intronic
1143475840 17:7203593-7203615 AGGCCCACCTTGCTGCTCCCAGG - Exonic
1143622121 17:8086656-8086678 AGACCCAGCCACCTGCTGCTAGG - Intronic
1144639426 17:16929413-16929435 AGTGCCACCCATCTGCTGAGAGG + Intergenic
1145069075 17:19787862-19787884 TGCCACACACAGCTGCTGCCAGG - Intronic
1145260585 17:21352276-21352298 TTACCCACCCAGCCGCTGCCCGG + Intergenic
1145864641 17:28233095-28233117 AGTCACACCCAGAAGCTGACTGG - Intergenic
1147703344 17:42409680-42409702 GGTCCCACCCATCTGCTTGCTGG + Intronic
1147810112 17:43162764-43162786 AGTCACACCCAGAAGCTGACTGG - Intergenic
1147857007 17:43488687-43488709 TGCACCACCCAGCAGCTGCCTGG + Intronic
1148166673 17:45488976-45488998 TGGCCCACCCATCTGATGCCGGG + Intronic
1148367816 17:47069797-47069819 TGGCCCACCCATCTGATGCCAGG - Intergenic
1148462834 17:47848035-47848057 AGGTCCATCCAGCTGGTGCCCGG + Exonic
1148497221 17:48060113-48060135 AGTCACTCCAACCTGCTGCCTGG - Exonic
1148551707 17:48554553-48554575 AGTCCCTGGCTGCTGCTGCCAGG + Intronic
1149300187 17:55298093-55298115 ACTCCCACCCAGCATTTGCCTGG + Intronic
1149496588 17:57122170-57122192 AGTCACACCCAATTCCTGCCAGG - Intergenic
1149543153 17:57483830-57483852 GCTCCCTCCCATCTGCTGCCTGG - Intronic
1150377848 17:64696704-64696726 AGTCCCTCCCAGGTGCACCCTGG + Intergenic
1150397849 17:64835379-64835401 TGGCCCACCCATCTGATGCCGGG + Intergenic
1151201343 17:72470039-72470061 AGTCCCACCCAGCTACTTACTGG + Intergenic
1151365069 17:73611794-73611816 AGTCCAGCCCAGCTTCTGCCCGG + Intronic
1151534222 17:74729646-74729668 AGTCCCACGCAGCTCCTGCCAGG - Intronic
1151535640 17:74737417-74737439 AGTCCAACCCAGACGCAGCCAGG - Intronic
1151583029 17:74990857-74990879 TCTTCCACCCAGCTGCTCCCTGG + Intronic
1151682291 17:75628542-75628564 AGCCCAGCCCATCTGCTGCCAGG + Intronic
1152069033 17:78126113-78126135 AGCCCATCCCATCTGCTGCCTGG - Intronic
1152784355 17:82240290-82240312 AGTCCCACCCAGCAGCTGAAGGG + Intronic
1153964307 18:10166399-10166421 AGGGCCTCCGAGCTGCTGCCAGG + Intergenic
1154154409 18:11932644-11932666 AGTTCCCCCCAGCTGCTGGCTGG + Intergenic
1155087031 18:22468700-22468722 CTTGCCACACAGCTGCTGCCAGG + Intergenic
1157246430 18:46058795-46058817 GGTCCCACCCCGCTGGTGACAGG - Intronic
1157507476 18:48238906-48238928 AGCCCCACTCACCGGCTGCCTGG + Intronic
1157804562 18:50648633-50648655 TCTCACACCCAGCTGCTGCAGGG + Intronic
1158546885 18:58404587-58404609 AGTGCCAGCCTGCTACTGCCTGG - Intergenic
1158569617 18:58586572-58586594 TGCCCCCTCCAGCTGCTGCCAGG - Intronic
1160105019 18:75965812-75965834 GGTCCCTCCCAGATGCTGGCAGG + Intergenic
1161400339 19:4064466-4064488 AGCCCAGCCCTGCTGCTGCCAGG - Intronic
1161542123 19:4858327-4858349 AGGGCCACCCAGCTGCTGAGGGG + Intronic
1161864352 19:6822522-6822544 CCTCCCACCCAGCGCCTGCCGGG + Intronic
1162828191 19:13267303-13267325 AGGCTCCCCCAACTGCTGCCCGG - Intronic
1163686350 19:18714033-18714055 CCTCCCACCCTGCTGCTTCCGGG - Intronic
1163934349 19:20428674-20428696 AGTCACACCCAGAAGCTGACTGG - Intergenic
1163943015 19:20512436-20512458 AGTCACACCCAGAAGCTGACTGG - Intergenic
1165130273 19:33627727-33627749 AGTCCCACACTCCTGGTGCCAGG + Intronic
1165487579 19:36104793-36104815 AGTCCGTGCCTGCTGCTGCCCGG - Exonic
1165665157 19:37621844-37621866 AGTCCTAAGCAGCTGCTGCATGG + Intronic
1165718319 19:38061474-38061496 TGTCCCAGGCAGCTTCTGCCTGG - Intronic
1165895265 19:39137418-39137440 AGTGCTCCCAAGCTGCTGCCTGG + Intronic
1165916720 19:39265219-39265241 CGTCCCTCCCCGCGGCTGCCAGG - Intergenic
1165983946 19:39751163-39751185 TGTACCACTCTGCTGCTGCCAGG - Intergenic
1202694275 1_KI270712v1_random:112927-112949 AGGCCCAGGCCGCTGCTGCCAGG + Intergenic
925357962 2:3255751-3255773 AGTCTCACTCATCTGCTCCCTGG + Intronic
925982087 2:9185080-9185102 AGTCCCCCCCAGCTACTGAAGGG - Intergenic
926136296 2:10339030-10339052 ACTCCCATCCTGCTGCTTCCTGG - Intronic
926343868 2:11927800-11927822 TGACCCACCCAGCTTCTGCAGGG + Intergenic
927826900 2:26315596-26315618 AGTCCCATCCTCCTGCAGCCAGG - Exonic
929430329 2:41880868-41880890 AGTCCCACTCTGTTGCTCCCAGG + Intergenic
929557827 2:42936628-42936650 GGTCCCACCCTGCCCCTGCCTGG + Intergenic
930475344 2:51875101-51875123 AATGCCGCACAGCTGCTGCCAGG - Intergenic
932094251 2:68832706-68832728 AGTCCCAACCACCTGCTTCCTGG - Intergenic
933339572 2:81004917-81004939 TGTGCCATGCAGCTGCTGCCAGG + Intergenic
933952284 2:87341641-87341663 AGGCCCAGGCCGCTGCTGCCAGG - Intergenic
934236525 2:90237980-90238002 AGGCCCAGGCCGCTGCTGCCAGG - Intergenic
934574408 2:95391154-95391176 ACCCCCACCCGACTGCTGCCTGG + Intergenic
935666822 2:105519312-105519334 TGTCTCAGCCACCTGCTGCCTGG + Intergenic
935925593 2:108065189-108065211 GTTCCCATCCAGCTGCTTCCTGG - Intergenic
937863738 2:126732734-126732756 AGTCCCACCCACCTGAGCCCTGG - Intergenic
937955576 2:127420183-127420205 AGTGCCACACAGGGGCTGCCAGG + Intronic
937957841 2:127431900-127431922 AGATCCACCGACCTGCTGCCTGG + Intergenic
938292200 2:130156206-130156228 AGTCCCACCCAGCTGCCGCCTGG - Intronic
938464351 2:131516763-131516785 AGTCCCACCCAGCTGCCGCCTGG + Intergenic
939800305 2:146699739-146699761 CGTACCACACAGCTGCTGCCAGG - Intergenic
940013861 2:149082954-149082976 AGGCACACCCAGGTGCAGCCAGG - Intronic
941866616 2:170341936-170341958 AGTCACACTCAGCTGCTTCCTGG - Intronic
942068905 2:172297709-172297731 ATTCCCACACAGCTGCTGGGTGG - Intergenic
942453433 2:176122507-176122529 TGGCCCGCCCAGCGGCTGCCAGG - Intergenic
943396940 2:187350841-187350863 TGTCTCACTCAGCTGCTGTCTGG + Intronic
943408299 2:187515559-187515581 AGTCACACCCAGAAGCTGACTGG + Intronic
945251593 2:207769584-207769606 CCTCCCGCCCAGGTGCTGCCAGG - Intergenic
945920612 2:215751312-215751334 AATTCCATCCATCTGCTGCCTGG + Intergenic
945932086 2:215865464-215865486 AGTGCCAGCTGGCTGCTGCCAGG + Intergenic
946161330 2:217837808-217837830 AGACCCAGCCAGGGGCTGCCAGG + Intronic
946671545 2:222110308-222110330 AGTCCCACTTAGCTGATGCCAGG + Intergenic
948030607 2:234814537-234814559 AGTCCCAGCCCGCTGCTCTCTGG + Intergenic
948264981 2:236629410-236629432 TGTCCCACCCAGCAGCCCCCTGG - Intergenic
948636520 2:239341320-239341342 AGGCTCACCGAGGTGCTGCCTGG - Intronic
948884126 2:240874524-240874546 GTTCCCATCCAGCTGCAGCCTGG + Intronic
1168852511 20:986260-986282 AGTCCCTCCCTGCTGCTCACTGG + Intronic
1171148860 20:22809517-22809539 AAACCCACCCACCTGCAGCCTGG + Intergenic
1171408721 20:24931573-24931595 AGTCACACCCAGAAGCTGACTGG + Intergenic
1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG + Intronic
1173869843 20:46334449-46334471 ACCCCCAGCCAGCTGCAGCCCGG + Intergenic
1174189727 20:48731788-48731810 CGGCCCACCCAGCTGCTGCTAGG + Intronic
1174568134 20:51481631-51481653 AGTCGCACCAAGCTGCAGCCTGG - Intronic
1175076824 20:56382355-56382377 AGCCCCAGCCAGGTGTTGCCAGG + Intronic
1175218822 20:57405453-57405475 AGGCCCAGGCAGCTCCTGCCAGG - Intronic
1175513697 20:59554137-59554159 AGTCACACCCAGAAGCTGACTGG - Intergenic
1175722503 20:61295777-61295799 CGTGCCCACCAGCTGCTGCCCGG + Intronic
1175822508 20:61918053-61918075 CGTCCCAGCCAGCTGCTGGAGGG + Intronic
1175955941 20:62609524-62609546 ACTCCCACACAGCAGCTGCCAGG - Intergenic
1176023741 20:62975436-62975458 AGTGCCAGCCAGCTGCTGCCCGG + Intergenic
1179816533 21:43909767-43909789 AGTCCCACCCAGTGGCTTCTCGG - Intronic
1179897379 21:44370204-44370226 AGCCCCACCCAGCTGCCTGCTGG - Intronic
1180003265 21:45004664-45004686 ACACCCACCATGCTGCTGCCCGG - Intergenic
1180135824 21:45861170-45861192 ACCCCCTCTCAGCTGCTGCCTGG + Intronic
1180917193 22:19497457-19497479 ACTCCCACACAGCTGCCGCAGGG - Intronic
1181164527 22:20976296-20976318 AGACCCTCCCACCTGCTCCCTGG - Exonic
1181165407 22:20980443-20980465 TTTCCCACCTAGCTTCTGCCAGG - Intronic
1182111244 22:27725250-27725272 AGCCCTTCCCAGCTGCTGGCTGG + Intergenic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
1182510110 22:30813591-30813613 ATCCTCACCCAGCTGCTGCAGGG + Intronic
1183135312 22:35881457-35881479 AGTCCCACCCAGCTACTCGAGGG + Intronic
1183209578 22:36442673-36442695 AGTTCCACCCAGCCACTCCCAGG - Intergenic
1183281608 22:36935498-36935520 AATCCCACCCAGCTCCCTCCAGG + Intronic
1183722177 22:39568927-39568949 GTGCCCACCCAGCTGCTGCTGGG - Intergenic
1184330376 22:43823495-43823517 TTGCCCACCCAGCTGCAGCCAGG + Intergenic
1184390662 22:44201362-44201384 AGTACCACCCAGCTGCTCAATGG + Intronic
1185193678 22:49454799-49454821 AAGGCCTCCCAGCTGCTGCCCGG + Intronic
1185400398 22:50612757-50612779 AGTCCCCTGTAGCTGCTGCCTGG + Intronic
949903549 3:8839529-8839551 AGTCCCACCCAGCATTTGCAGGG + Intronic
950158429 3:10741321-10741343 AGGCCCACACAGCTGCTGAGTGG + Intergenic
952543562 3:34395155-34395177 AGTCCAACCCTGCCACTGCCAGG - Intergenic
954418175 3:50404361-50404383 AGCCCCACCCAGCTGCTGCCAGG + Intronic
954642394 3:52108890-52108912 AGTGCCCCCCAGCGGATGCCTGG + Intronic
956890247 3:73606381-73606403 AGTCTGACCCTGCTGCTTCCTGG + Intronic
957367794 3:79249204-79249226 ATGCCCACCCAGCAGCTGCAAGG - Intronic
959443876 3:106413066-106413088 TGTGCCACACGGCTGCTGCCAGG + Intergenic
959530430 3:107429946-107429968 AGTCCACCGCAGCAGCTGCCGGG - Intergenic
961756152 3:129128407-129128429 AAGCCCACCCACCTCCTGCCAGG + Intronic
962146005 3:132840812-132840834 AGTCACAGCCAGCAGCTCCCAGG + Intergenic
962347585 3:134629718-134629740 ATTCTCAACCAGATGCTGCCAGG + Intronic
962997968 3:140650672-140650694 TGTGCCACGCAGCTGCCGCCAGG - Intergenic
965602989 3:170473089-170473111 TGTCCCACCCAGGTGCCTCCAGG + Intronic
966715120 3:183006750-183006772 AGCCCCACCCAGCTAGTGCCAGG - Intergenic
967363264 3:188656249-188656271 AGGCGCTCCCAGGTGCTGCCAGG + Intronic
968494893 4:910124-910146 GGTCTCACCCAGCTCCTCCCAGG + Intronic
968952973 4:3704073-3704095 CTCCCCACCCACCTGCTGCCTGG - Intergenic
968982951 4:3860575-3860597 AGACCAACACAGCAGCTGCCAGG - Intergenic
969264206 4:6054572-6054594 AGGCCCAGCCAGCTGCGGCAGGG + Intronic
969355485 4:6622891-6622913 ACTCCAGCCCAGCTCCTGCCTGG - Exonic
969484870 4:7466639-7466661 AGTCCTCACCAGCTACTGCCTGG - Intronic
972275113 4:37549860-37549882 AGTCACACCCAGAAGCTGACTGG + Intronic
973788618 4:54358195-54358217 GGTCTCTCCCAGCTGCTACCTGG + Intergenic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
974949665 4:68572823-68572845 AGTCACACCCAGAAGCTGACTGG - Intronic
974988143 4:69054735-69054757 AGTCACACCCAGAAGCTGACTGG + Intronic
977110752 4:92951412-92951434 AGTCACACCTCGCTGCAGCCTGG + Intronic
977262913 4:94819475-94819497 ATTCCCACACAGCTCCTTCCTGG - Intronic
977557381 4:98499207-98499229 AGCCCACCCCAGCTTCTGCCCGG + Intronic
977571200 4:98631590-98631612 GGTCCCATCCAACTGCTGCTAGG + Intronic
977659242 4:99563705-99563727 CGGCCTACCCAGCTGCTCCCTGG - Intronic
978382533 4:108144653-108144675 ATTCCCACACAGCTGCTGGAGGG + Intronic
978982424 4:114964185-114964207 ATTTCCCACCAGCTGCTGCCTGG - Intronic
979038723 4:115759438-115759460 AGTCCCTCCCAAGTGCTGGCAGG + Intergenic
979183159 4:117755760-117755782 AGCCCCTCCCAGGTGCTGGCAGG - Intergenic
982662577 4:158224754-158224776 AGTCACACCCAGAAGCTGACTGG - Intronic
983898168 4:173103673-173103695 AGTCACACCCAGAAGCTGACTGG + Intergenic
983904948 4:173172269-173172291 AGCCCCTCCCCGCTGCTGGCAGG - Intronic
984952120 4:185015883-185015905 AGTCTCACCCAGCTGGTGGGCGG + Intergenic
985384867 4:189434668-189434690 CATGCCACACAGCTGCTGCCAGG + Intergenic
985576225 5:674653-674675 GGCCCCAGCCAGCTGCTGGCAGG - Intronic
986265146 5:6184434-6184456 AGTGCCACTCATCTCCTGCCTGG + Intergenic
987640091 5:20601576-20601598 AGCCCCACTCACCAGCTGCCTGG + Intergenic
989095843 5:37780623-37780645 AGTCACACCCAGAAGCTGACTGG - Intergenic
990036677 5:51329888-51329910 AGTCACACCCTCCTACTGCCAGG - Intergenic
995331011 5:110946059-110946081 AGCCCCACCCCAGTGCTGCCAGG + Intergenic
1000707772 5:164532985-164533007 CATACCAGCCAGCTGCTGCCTGG - Intergenic
1002496460 5:179616169-179616191 ACCCCCACTCAGCTGCTGGCTGG + Exonic
1003181768 6:3798346-3798368 GGTACAACCCAGCTGCAGCCTGG + Intergenic
1003555594 6:7137132-7137154 CGTCACATCCAGCTGCTGTCAGG + Intronic
1004108902 6:12695032-12695054 ATTCACACCCATCTGCTTCCAGG - Intergenic
1004348971 6:14874406-14874428 AGTCCCCCCCAGCAGCTAACTGG + Intergenic
1004474265 6:15956579-15956601 AGCCCCTCCCAGGTGCTGGCAGG - Intergenic
1004674278 6:17826074-17826096 AGTACCACCCAGCTGTGGCATGG - Exonic
1006031978 6:31183018-31183040 AGTCACACCCAGAAGCTGACTGG - Intergenic
1007114736 6:39335603-39335625 GTTCCAACCCAGCTGCAGCCAGG - Exonic
1007425951 6:41746238-41746260 TGTCACATCCAGCTGGTGCCAGG - Intronic
1007752192 6:44077211-44077233 AGCCTCACCCACCTCCTGCCAGG - Intergenic
1010317954 6:74472035-74472057 AGTCACACCCAGAAGCTGACTGG + Intergenic
1011351000 6:86423713-86423735 TGTCCCACCCAGCTGGTGACTGG - Intergenic
1016857368 6:148684506-148684528 AGCCCCACCCAGATTCTGCAGGG - Intergenic
1017722534 6:157253870-157253892 AGTCCCTCCCAGAGCCTGCCTGG + Intergenic
1017877711 6:158537430-158537452 AGTTCCACACAGCCGCTCCCAGG - Intronic
1018507904 6:164491233-164491255 TGCCCCACCCTGCTGCTGCCTGG + Intergenic
1018898388 6:168037319-168037341 TTTCCCACCCAGGCGCTGCCAGG - Intronic
1019429173 7:990899-990921 AATCCCTCCCAGCTGTTGTCAGG + Intergenic
1019499474 7:1357854-1357876 AGTCCCACCCAGGCCCTCCCTGG - Intergenic
1019607077 7:1915352-1915374 CTTCCCAGCCAGGTGCTGCCAGG - Intronic
1019748376 7:2713307-2713329 AGTCCCAGCCAGCCGCTCCCAGG + Exonic
1020322864 7:6953001-6953023 AGTCACACCCAGAAGCTGACTGG - Intergenic
1021378785 7:19940940-19940962 AAAAACACCCAGCTGCTGCCTGG + Intergenic
1022149541 7:27586981-27587003 CGTGCCACCCAGCTGCTGCATGG + Intronic
1022451144 7:30516558-30516580 AGTCCCACCCAGCTACTCAGGGG + Intronic
1023875972 7:44286614-44286636 TGTCCCACCCACCTGCGGTCAGG - Intronic
1024980810 7:55156169-55156191 AGCCCCGCTCAGCAGCTGCCAGG + Intronic
1025183463 7:56837630-56837652 ACTCCCACCCAGCAACTCCCTGG + Intergenic
1025688462 7:63739337-63739359 ACTCCCACCCAGCAACTCCCTGG - Intergenic
1026557572 7:71421584-71421606 GGTCCCACCCAGCTGCCTCTCGG + Intronic
1029159923 7:98544300-98544322 GGTCCCACCCAGGTGCTGCAGGG - Intergenic
1029175963 7:98664655-98664677 AGTCCCTTCCACCTGCTACCAGG + Intergenic
1029683038 7:102125460-102125482 AGGCCCTCCCAGCGGCGGCCAGG - Intronic
1031802446 7:126265113-126265135 AGTCCTTCTCAGCTGCAGCCTGG + Intergenic
1033387524 7:140893029-140893051 AGCCTCACCCATCTCCTGCCTGG + Intronic
1034239373 7:149598145-149598167 AGGCCTACCCAGCTGCAACCTGG + Intergenic
1036752960 8:11454879-11454901 GGCCCCACAGAGCTGCTGCCGGG + Intronic
1038089856 8:24240744-24240766 AGTCACACCCAGAAGCTGACTGG + Intergenic
1039484223 8:37898959-37898981 AGGCCTTCCCCGCTGCTGCCCGG + Intronic
1040079560 8:43274019-43274041 AGCACCTCCCAGCTTCTGCCTGG + Intergenic
1041512424 8:58666608-58666630 ATTCCCAACCTGCTTCTGCCTGG - Intergenic
1041515662 8:58696280-58696302 AGTCACACCCAGAAGCTGACTGG + Intergenic
1041661314 8:60404258-60404280 AGTGACACTCAGCTGGTGCCTGG + Intergenic
1042082671 8:65071982-65072004 TGTATCACACAGCTGCTGCCAGG + Intergenic
1044115367 8:88328072-88328094 AGCCCCACCCAGCTCATGGCTGG - Intergenic
1046463568 8:114572618-114572640 AGTCCCTCCCAAGTGCTGGCCGG + Intergenic
1048957163 8:139546743-139546765 AGTCACACCCAGAAGCTGACTGG - Intergenic
1049095514 8:140545921-140545943 AGGCCCTCCCACGTGCTGCCTGG - Intronic
1049353256 8:142175449-142175471 AGTGCCACCCAGCACCTGCAGGG + Intergenic
1049638910 8:143705531-143705553 AGTCCCCCCCAGCACCTCCCGGG - Intronic
1050428441 9:5536456-5536478 AGTTCCTCCCAGCTGCTGCCTGG - Intronic
1052003772 9:23321266-23321288 AGTACCACACAGCTGCTGAGTGG - Intergenic
1053653701 9:40194667-40194689 AGTGCCCCCAAGCTCCTGCCTGG - Intergenic
1053904085 9:42823826-42823848 AGTGCCCCCAAGCTCCTGCCTGG - Intergenic
1054530900 9:66181687-66181709 AGTGCCCCCAAGCTCCTGCCTGG + Intergenic
1057183104 9:93040337-93040359 TGTCGCAGCCAGCTGCTGCAGGG - Intergenic
1059453764 9:114387176-114387198 ACCCCCACCCACCTGCTGGCAGG + Intronic
1060906803 9:127314318-127314340 AGTTCAAACCAGGTGCTGCCTGG + Intronic
1060933717 9:127504324-127504346 AAGGCCACCCAGCTCCTGCCTGG - Intergenic
1061011053 9:127954937-127954959 AGCCCCTCCCAACTGCTGCGGGG + Intronic
1061091366 9:128428438-128428460 TGTTCCACCCACCTGCTGCCGGG + Intronic
1061389310 9:130308533-130308555 GGTCCCAGGCAGCTGCTGCAAGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062525006 9:136974642-136974664 AGCCCCACCCACCTGCAGCCTGG - Intergenic
1185910162 X:3973599-3973621 AGTCACACCCAGAAGCTGACTGG + Intergenic
1188897339 X:35685773-35685795 TGTGCCACGCAGCTGCTGCCAGG - Intergenic
1188908643 X:35819378-35819400 AGTCCCTCCCAAGTGCTGACAGG + Intergenic
1192225091 X:69222294-69222316 AGCGCCACCCAGTGGCTGCCTGG + Intergenic
1192235403 X:69292301-69292323 TGTCCCAGCCAGCAGGTGCCAGG - Intergenic
1192356632 X:70410247-70410269 AGTCCCAGCCAGCTTCAGCTGGG - Intronic
1193436209 X:81477736-81477758 AGACCCAGCTAGCTGTTGCCAGG + Intergenic
1194990539 X:100542781-100542803 TGCACCACACAGCTGCTGCCTGG - Intergenic
1195014786 X:100767191-100767213 TGCACCACACAGCTGCTGCCAGG + Intergenic
1196029067 X:111075669-111075691 AGCCCCAACCAGGTACTGCCTGG + Intronic
1196828538 X:119758974-119758996 AGGCACAGCCTGCTGCTGCCCGG - Exonic
1197481040 X:126986162-126986184 AATCCCACCCAGCAGCTGCCGGG - Intergenic
1197722894 X:129756766-129756788 ATTCCCACAGAGGTGCTGCCTGG - Intronic
1198999213 X:142613556-142613578 CTTGCCATCCAGCTGCTGCCAGG - Intergenic
1199324556 X:146482006-146482028 TGCGCCACGCAGCTGCTGCCAGG + Intergenic
1200775505 Y:7166928-7166950 CCTGGCACCCAGCTGCTGCCTGG - Intergenic
1200820812 Y:7580908-7580930 AGGCCCACCCTGCTGGTGCATGG + Intergenic
1200912413 Y:8542678-8542700 AGTCACACCCAGTAGCTGACTGG + Intergenic
1201297208 Y:12474212-12474234 AGTCACACCCAGAAGCTGACTGG - Intergenic
1201556529 Y:15268837-15268859 AGTCACACCCAGAAGCTGACTGG + Intergenic
1201909988 Y:19124303-19124325 CCTACCACCCAGCTGCTGCTTGG - Intergenic
1202239494 Y:22751834-22751856 AGGCCCACCCTGCTGGTGCATGG - Intergenic
1202392481 Y:24385596-24385618 AGGCCCACCCTGCTGGTGCATGG - Intergenic
1202478303 Y:25284521-25284543 AGGCCCACCCTGCTGGTGCATGG + Intergenic