ID: 1105303854

View in Genome Browser
Species Human (GRCh38)
Location 13:19155938-19155960
Sequence GCTTTCTGCACACACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 3, 1: 0, 2: 0, 3: 17, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105303854_1105303862 10 Left 1105303854 13:19155938-19155960 CCTCCCAAGTGTGTGCAGAAAGC 0: 3
1: 0
2: 0
3: 17
4: 156
Right 1105303862 13:19155971-19155993 CAGGTGTGGTGTCTCAGACCTGG 0: 1
1: 0
2: 27
3: 162
4: 765
1105303854_1105303863 26 Left 1105303854 13:19155938-19155960 CCTCCCAAGTGTGTGCAGAAAGC 0: 3
1: 0
2: 0
3: 17
4: 156
Right 1105303863 13:19155987-19156009 GACCTGGAATTCCAGCACTTTGG 0: 1
1: 36
2: 4487
3: 99061
4: 327460
1105303854_1105303858 -9 Left 1105303854 13:19155938-19155960 CCTCCCAAGTGTGTGCAGAAAGC 0: 3
1: 0
2: 0
3: 17
4: 156
Right 1105303858 13:19155952-19155974 GCAGAAAGCACATGGAACCCAGG 0: 3
1: 0
2: 0
3: 24
4: 257
1105303854_1105303859 -4 Left 1105303854 13:19155938-19155960 CCTCCCAAGTGTGTGCAGAAAGC 0: 3
1: 0
2: 0
3: 17
4: 156
Right 1105303859 13:19155957-19155979 AAGCACATGGAACCCAGGTGTGG 0: 3
1: 0
2: 1
3: 32
4: 248
1105303854_1105303864 27 Left 1105303854 13:19155938-19155960 CCTCCCAAGTGTGTGCAGAAAGC 0: 3
1: 0
2: 0
3: 17
4: 156
Right 1105303864 13:19155988-19156010 ACCTGGAATTCCAGCACTTTGGG 0: 14
1: 3708
2: 90037
3: 319695
4: 240478
1105303854_1105303866 30 Left 1105303854 13:19155938-19155960 CCTCCCAAGTGTGTGCAGAAAGC 0: 3
1: 0
2: 0
3: 17
4: 156
Right 1105303866 13:19155991-19156013 TGGAATTCCAGCACTTTGGGAGG 0: 61
1: 13555
2: 314803
3: 264049
4: 150820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105303854 Original CRISPR GCTTTCTGCACACACTTGGG AGG (reversed) Intergenic
900693016 1:3993021-3993043 GTTGGCTGCAGACACTTGGGAGG + Intergenic
901025300 1:6275976-6275998 GCTTCCTGGGCACACTGGGGAGG - Intronic
912023543 1:105138329-105138351 GCCTTCTTCACACTCATGGGAGG + Intergenic
912651926 1:111447778-111447800 GCTTTCTGCACCTACTTGTCTGG - Intronic
915099033 1:153485343-153485365 GCTTTCTCCCCTCACCTGGGTGG + Intergenic
916551437 1:165853495-165853517 CCTTTCTGCAAACACCTGGTTGG - Intronic
916566572 1:165983992-165984014 GCATCCTGGACACACTGGGGTGG + Intergenic
917282078 1:173386786-173386808 GTCTTCTGAACACACTGGGGTGG - Intergenic
920659822 1:207906342-207906364 GCTTCCTGCAAACACTCAGGAGG + Intronic
921321736 1:213947317-213947339 GCTTCCTGCCCACCCTTGGTGGG - Intergenic
921661916 1:217813195-217813217 GTTGTCTGCAGAAACTTGGGTGG + Intronic
1065845559 10:29739810-29739832 GCTCTCTGAACACACTTGCTTGG + Intergenic
1066064792 10:31754268-31754290 GTTTTCTGCATAGACTTGGTGGG - Intergenic
1067553766 10:47253691-47253713 GCTCTCTGCCCAGACCTGGGAGG - Intergenic
1069730483 10:70608609-70608631 ACCTTCTGCACACACTGGGGTGG - Intergenic
1070684817 10:78472567-78472589 GCTTCCTGCCCACCCATGGGAGG + Intergenic
1071883158 10:89921301-89921323 GCTTTCTGAACATATTTGTGTGG + Intergenic
1073496638 10:103897533-103897555 GCATGCTGCACTCACTTGGTCGG + Exonic
1073804954 10:107087801-107087823 GATTTCTGCAGACAGTTAGGAGG - Intronic
1075596202 10:123731264-123731286 GCTGTGTTCACACATTTGGGTGG - Intronic
1075653584 10:124146587-124146609 ACTTTCTGGACAGACTTGAGAGG - Intergenic
1076566935 10:131405250-131405272 GCTCAGTGCACACAATTGGGGGG - Intergenic
1076643088 10:131932031-131932053 GCTTTCTTCTGACACCTGGGCGG + Intronic
1077613533 11:3659731-3659753 GCTGTCTGCATACACCTGGTTGG - Exonic
1077888797 11:6404514-6404536 GGTGTCTGCACACATTTGGCAGG - Intronic
1077985638 11:7348431-7348453 GCTTTCTTAACACACTGGGTTGG + Intronic
1078531870 11:12142874-12142896 GCTCTCTGCACACAGAAGGGAGG + Intronic
1078933426 11:15930624-15930646 GCTTTCTGCACAGTCCTGGGTGG - Intergenic
1079440653 11:20511358-20511380 CCATTCTGTACACACTTGAGAGG - Intergenic
1080898776 11:36467778-36467800 CCTTTCTGCACATACCTGGGAGG - Intergenic
1081225547 11:40517722-40517744 ACTTTCTTCACAGAATTGGGGGG + Intronic
1089176737 11:116554056-116554078 GCATTCAGCACACATTTAGGAGG + Intergenic
1089467131 11:118692581-118692603 GCTGCCTGCACACACCAGGGAGG + Intergenic
1090762453 11:129849413-129849435 ACCTTCTGAACACACTGGGGTGG + Intronic
1092242441 12:6843509-6843531 GCTTTCTGCTCACACAGGTGAGG + Exonic
1092757286 12:11775623-11775645 GCCTTCTGCACACATCTGGTGGG - Intronic
1100178844 12:92061638-92061660 GCTTCCTTCGCACACTTGGCAGG + Intronic
1102742641 12:115221843-115221865 GCATTCTGCAAATACTTGGGAGG + Intergenic
1103166047 12:118771626-118771648 GGTTTGTGCACACACTGGGCTGG + Intergenic
1103852080 12:123939942-123939964 GCTTTCAGCCCACACTCGGGTGG + Intronic
1105303854 13:19155938-19155960 GCTTTCTGCACACACTTGGGAGG - Intergenic
1107012097 13:35679673-35679695 GATGTCTGCCCACACTTGGGAGG + Intergenic
1107648131 13:42516324-42516346 GGTTTCAGCACAAAATTGGGTGG + Intergenic
1111660197 13:91200442-91200464 TCTTTCTGCAGACTCTAGGGAGG + Intergenic
1113450002 13:110402443-110402465 GCCTTCTGGACACACTGGGGTGG + Intronic
1113991949 14:16034894-16034916 GCTTTCTGCTTACAAGTGGGAGG - Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1119446005 14:74663894-74663916 GCCTACTGCACACACATGGTAGG - Exonic
1122683880 14:103488996-103489018 GCTTTCTGCTTACACTGGTGGGG + Intronic
1124222947 15:27865602-27865624 CCTCTCTGCACCCACTCGGGAGG - Intronic
1125272019 15:37950061-37950083 GTTTCCTGCACACCCTTTGGAGG - Intronic
1125614292 15:40996131-40996153 GCTTTCTCCTCACAGTTGTGGGG + Intronic
1128710778 15:69869869-69869891 GCTTTCTCCATACACCTGGAAGG - Intergenic
1129822603 15:78615192-78615214 CCTTGCTTCACATACTTGGGGGG + Intronic
1131072752 15:89476517-89476539 TCTTTCTGCACACCCTAGAGGGG - Intronic
1132079156 15:98850410-98850432 GGGTTCTGCAGACACCTGGGGGG + Intronic
1132859314 16:2062210-2062232 GCTTGCTCCACACAGGTGGGAGG - Intronic
1133532462 16:6667635-6667657 GCTTTTTGGACACAAGTGGGAGG + Intronic
1134057827 16:11181407-11181429 GCTCTCTGCAGGGACTTGGGGGG - Exonic
1135501746 16:23001773-23001795 GCTTTCTGCAGCAACTTGGATGG - Intergenic
1136137216 16:28263822-28263844 GCTTTCTGAACATATTTAGGAGG + Intergenic
1144310969 17:14014031-14014053 AGGTTCTGCCCACACTTGGGGGG - Intergenic
1146584885 17:34073877-34073899 GCTGACTTCACACACCTGGGTGG - Intronic
1147612538 17:41810553-41810575 GCTTTCTGCACACATCTGCTGGG + Intronic
1148242419 17:46009417-46009439 TCTTTCTGCAGACACCAGGGAGG - Intronic
1149848875 17:60023431-60023453 GCTTCATGCCCTCACTTGGGTGG - Intergenic
1149861293 17:60123093-60123115 GCTTCATGCCCTCACTTGGGTGG + Intergenic
1151411527 17:73933450-73933472 TCTTTCTGCAGCCCCTTGGGTGG - Intergenic
1151738190 17:75959579-75959601 GCTTTCTTCATGCACCTGGGTGG - Intronic
1152139906 17:78530179-78530201 CCTTTCTGCTCACGCTTGGTGGG + Intronic
1161790948 19:6359796-6359818 ACTTTCTGCACAAACCTAGGAGG + Intergenic
1165533452 19:36422734-36422756 GCCTTCTGCAAACACCTGGGAGG + Intergenic
1167433518 19:49466067-49466089 GCTGTCTGCCCACAGCTGGGCGG + Exonic
1168087417 19:54058334-54058356 GCTTTCTGACCACTCATGGGAGG + Exonic
1168129780 19:54310856-54310878 GCTTTCTAGACACACCTGGAAGG + Intronic
925411719 2:3643445-3643467 GCTGGCTGCACTCACATGGGAGG - Exonic
925763018 2:7205243-7205265 AACTTCTGCACACAGTTGGGAGG + Intergenic
931514664 2:63041374-63041396 CATTTCTGCACACATTGGGGTGG + Intronic
933561765 2:83896461-83896483 GCTTTCTGCTCACACTTTCCTGG - Intergenic
934861096 2:97764184-97764206 GCTGGCTGCACAGTCTTGGGTGG + Intronic
935436460 2:103040304-103040326 ACTTTCTGGACACACTGTGGTGG + Intergenic
935562144 2:104570053-104570075 GCTTTGCCCACCCACTTGGGAGG - Intergenic
938292565 2:130157829-130157851 GCTTTCTGCACACACTTGGGAGG - Intronic
938463988 2:131515140-131515162 GCTTTCTGCACACACTTGGGAGG + Intergenic
939310457 2:140468662-140468684 GCCTTCTGAACACACTGGTGTGG - Intronic
940065386 2:149622029-149622051 GCTTTCTGCACAGAATTGGTTGG - Intergenic
941027908 2:160478903-160478925 GCTATCTGAATACACTTGGCAGG - Intronic
941092859 2:161198318-161198340 ATTTTCTGGACACACTGGGGTGG + Intronic
941820473 2:169839828-169839850 GCTTTCTGGACACACTGTGTTGG + Intronic
944089310 2:195887839-195887861 TCTTTCAGTACACACTGGGGAGG - Intronic
945877078 2:215289241-215289263 GCTTTCTCCAGACACTTGTATGG - Intergenic
1168908969 20:1430014-1430036 GATGTCTGCCCACACTGGGGAGG - Intergenic
1169759957 20:9080367-9080389 TCTTACTGCACACAATTTGGAGG - Intronic
1169970641 20:11266043-11266065 GCCTTCGGCACACCCTTTGGTGG + Intergenic
1170538590 20:17365832-17365854 ACCTTCTGGACACACTGGGGTGG + Intronic
1170616126 20:17953199-17953221 GCATTTAGCACACACTTGAGTGG - Intronic
1170968840 20:21100782-21100804 GGTTTCTGCACCCAGTTGGTGGG + Intergenic
1173441096 20:43076942-43076964 GCACTCTGGAGACACTTGGGAGG - Intronic
1174227717 20:49016575-49016597 GCTTTATGAACTGACTTGGGGGG - Intronic
1174361618 20:50032264-50032286 GGTTTTTGCACACACGTGGTGGG + Intergenic
1177683607 21:24408567-24408589 GGTTTCTGCTCACACTTAAGGGG - Intergenic
1178686447 21:34715074-34715096 GCTTACTGCGCAGACTTTGGAGG - Intronic
1178903304 21:36615155-36615177 ACCTTCTGGACACACTGGGGTGG + Intergenic
1180854926 22:19039628-19039650 GCTTCCTGCAAACACCTGTGTGG - Intronic
1183456134 22:37924388-37924410 GTTTTCTGCCCACACTGGCGGGG + Intronic
1184387558 22:44185049-44185071 GCTCTCAGCAAACACTTGGGCGG - Intronic
1184770833 22:46595588-46595610 GCTTTGGGCACACCCATGGGAGG + Intronic
949214690 3:1551683-1551705 ACTATCTGGACACACTGGGGTGG - Intergenic
949309492 3:2680447-2680469 GCTTTCTGTACACTGTTGGCAGG + Intronic
953206775 3:40838252-40838274 GCTTTCTGGACACACAGGTGGGG + Intergenic
954804028 3:53204944-53204966 GCTTTCTCCCCAGCCTTGGGTGG - Intergenic
955814456 3:62827148-62827170 GATTTCTTTACACACCTGGGTGG - Intronic
960121328 3:113950995-113951017 GCCTTCTGGACACACTGGGTTGG + Intronic
960725955 3:120670268-120670290 GTTTTCTGCTCAAACTTGGGTGG - Intronic
961869659 3:129978093-129978115 CATTTCAGAACACACTTGGGAGG + Intergenic
964197774 3:154084499-154084521 GCTTTGAGCACACATTGGGGTGG - Intergenic
964534751 3:157708064-157708086 GTCTTCTGCAGACACTTGGATGG + Intergenic
965015629 3:163153492-163153514 GCTTGCTGCAGACACTGTGGGGG + Intergenic
966817845 3:183904146-183904168 GCTTTCTGCAGGCACTGGGTTGG + Intergenic
968793530 4:2686604-2686626 GCTCTCTGAACACACATGGGTGG + Intronic
968826458 4:2901331-2901353 GCTTTCAGCACAGTCTTTGGTGG - Intronic
969905873 4:10395778-10395800 GCTTTCTGATAAGACTTGGGAGG + Intergenic
971417041 4:26441290-26441312 GCTCTTTGCACACACTTGGCCGG - Intergenic
971572118 4:28226307-28226329 GCTTTCTGAACTCACTTTGTTGG - Intergenic
976290054 4:83408733-83408755 GATCTCTGCAAACACTTGGGTGG - Intronic
978103436 4:104872096-104872118 CCTTTCTTCACACAGTTGGCTGG - Intergenic
982307439 4:153947582-153947604 TCTTGATGCAGACACTTGGGAGG + Intergenic
984620307 4:181944763-181944785 TCTGTCTGCAAACACTTAGGAGG - Intergenic
984706876 4:182853824-182853846 GCTTTCTGAAAACACTGGTGGGG - Intergenic
985694849 5:1334247-1334269 GCTTGCCGCAGGCACTTGGGGGG - Intronic
986490559 5:8285291-8285313 ACTTTCTTCACAGAATTGGGGGG + Intergenic
986626047 5:9724918-9724940 GCTTAATGCACACACTTGCATGG - Intergenic
992635727 5:78724470-78724492 GTTTTTTTCATACACTTGGGCGG + Intronic
993502765 5:88680751-88680773 GCTTTCTGGAGACCCCTGGGAGG + Intergenic
994862582 5:105217226-105217248 GCTTTCTGCATACAGTTAGTAGG + Intergenic
995766270 5:115623242-115623264 GTTTTCTTTGCACACTTGGGTGG - Intronic
998026586 5:138821340-138821362 GCTCTCTGCACACAGATGGAGGG - Intronic
998263209 5:140647168-140647190 GGTTTCTGCACGACCTTGGGCGG + Intronic
999028672 5:148264857-148264879 GTTTTCTACACACAGTTTGGAGG - Intergenic
999872500 5:155766923-155766945 ACTTTCTACACACACTGGAGTGG - Intergenic
999891796 5:155985896-155985918 GCCTTCTGCAAACACCTGAGAGG - Intronic
1001116681 5:168946413-168946435 GCTATCTGCAGGCATTTGGGAGG - Intronic
1003424826 6:5991785-5991807 TCTTTCTGAAGACACTAGGGAGG + Intergenic
1004401207 6:15290540-15290562 GCTTTCTGTACACAGTTTGTAGG + Intronic
1006024553 6:31138813-31138835 GCTTTCTGGACACATTGGGTGGG - Intronic
1011166203 6:84449625-84449647 GCTCCCTGCACACACCTGTGTGG - Intergenic
1011860913 6:91754898-91754920 CTTATCTGCACACACGTGGGAGG - Intergenic
1016153594 6:140775337-140775359 GATTTGTGCACACACGTGTGTGG - Intergenic
1018805263 6:167254444-167254466 GCCTTCTGGACACACTTCGTTGG + Intergenic
1019064517 6:169285479-169285501 GCTTTCTGTACAGATATGGGGGG - Intergenic
1021565726 7:22014573-22014595 GTTTGCTGCACCCACATGGGAGG + Intergenic
1021850849 7:24807113-24807135 GCTTTCTGACCACACATAGGAGG - Intronic
1022041796 7:26588314-26588336 GCCTTCTGCACACACAGGCGGGG + Intergenic
1022773484 7:33500133-33500155 GGTTTCTGCACAAAGTTGTGTGG - Intronic
1023346972 7:39280261-39280283 GCCATCTGCACACACCTTGGGGG - Intronic
1024489190 7:49957951-49957973 GCCTTCTGGGCACACTGGGGTGG - Intronic
1024558754 7:50626497-50626519 GCTTGCTGCACACCTGTGGGCGG - Intronic
1028646041 7:93097678-93097700 GCCTTCTGCACACACTGGAGTGG - Intergenic
1030533347 7:110736572-110736594 GCTTTCTGGATATACTGGGGTGG - Intronic
1031303511 7:120094510-120094532 AGTTTCTGCACACACTTGAAAGG + Intergenic
1036806474 8:11837843-11837865 GGATTCTGCACATACTTGGGAGG + Intronic
1038475303 8:27862146-27862168 GGTGTCTCCACACACTGGGGAGG + Intergenic
1043871254 8:85435726-85435748 TCTTGCTGCACAGATTTGGGAGG + Intronic
1044386856 8:91599194-91599216 CCTTTATGCAAACACTTTGGAGG + Intergenic
1044484425 8:92734495-92734517 GATTTCTTCCCACACTTGAGTGG - Intergenic
1045338762 8:101233235-101233257 GCTCTCTGCAGACACTTGCCTGG - Intergenic
1048177102 8:132162724-132162746 GCTTCATGGAAACACTTGGGAGG + Intronic
1048537118 8:135307259-135307281 GCTTGCTAAACACACCTGGGAGG - Intergenic
1049458587 8:142709286-142709308 ACATTCTGGACACACTGGGGTGG + Intergenic
1052269660 9:26614358-26614380 GCTTGCCGCCCACACTTGGCAGG + Intergenic
1054901370 9:70372573-70372595 ACATTTTGGACACACTTGGGAGG + Intergenic
1058247961 9:102654290-102654312 GCATTCTGCCCACACCTGCGTGG - Intergenic
1190303442 X:49069168-49069190 GCTCTCTGCCCACACTTGGAAGG + Intronic
1197364297 X:125544967-125544989 GCTTTCTGCAGCCACTGTGGGGG - Intergenic
1198378738 X:136064525-136064547 GGGTGCTGAACACACTTGGGAGG + Intergenic
1199924701 X:152450486-152450508 ACTTCCTCCACAAACTTGGGAGG - Intronic